ID: 906545987

View in Genome Browser
Species Human (GRCh38)
Location 1:46619833-46619855
Sequence CAGAGTTCCCACTGCGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906545987_906545997 18 Left 906545987 1:46619833-46619855 CCCCCCTCGCAGTGGGAACTCTG No data
Right 906545997 1:46619874-46619896 TCTACCTGCTGTGTGCCTTTGGG No data
906545987_906545996 17 Left 906545987 1:46619833-46619855 CCCCCCTCGCAGTGGGAACTCTG No data
Right 906545996 1:46619873-46619895 GTCTACCTGCTGTGTGCCTTTGG No data
906545987_906545994 -10 Left 906545987 1:46619833-46619855 CCCCCCTCGCAGTGGGAACTCTG No data
Right 906545994 1:46619846-46619868 GGGAACTCTGAGTGGCAGCAGGG No data
906545987_906545995 -7 Left 906545987 1:46619833-46619855 CCCCCCTCGCAGTGGGAACTCTG No data
Right 906545995 1:46619849-46619871 AACTCTGAGTGGCAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906545987 Original CRISPR CAGAGTTCCCACTGCGAGGG GGG (reversed) Intergenic
No off target data available for this crispr