ID: 906546420

View in Genome Browser
Species Human (GRCh38)
Location 1:46622463-46622485
Sequence TGTGGAATCCAGACTCTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906546420_906546426 26 Left 906546420 1:46622463-46622485 CCCCGTAGAGTCTGGATTCCACA No data
Right 906546426 1:46622512-46622534 AATGTCATCAAATTGCATTTGGG No data
906546420_906546425 25 Left 906546420 1:46622463-46622485 CCCCGTAGAGTCTGGATTCCACA No data
Right 906546425 1:46622511-46622533 GAATGTCATCAAATTGCATTTGG No data
906546420_906546427 27 Left 906546420 1:46622463-46622485 CCCCGTAGAGTCTGGATTCCACA No data
Right 906546427 1:46622513-46622535 ATGTCATCAAATTGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906546420 Original CRISPR TGTGGAATCCAGACTCTACG GGG (reversed) Intergenic
No off target data available for this crispr