ID: 906546644

View in Genome Browser
Species Human (GRCh38)
Location 1:46624143-46624165
Sequence GTGTCCTCTGGGCACCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906546644_906546649 14 Left 906546644 1:46624143-46624165 CCACAGGGGTGCCCAGAGGACAC No data
Right 906546649 1:46624180-46624202 GCTCTGAGACAAACTGAGAAGGG No data
906546644_906546647 -8 Left 906546644 1:46624143-46624165 CCACAGGGGTGCCCAGAGGACAC No data
Right 906546647 1:46624158-46624180 GAGGACACAGTGCAAGCTGCTGG No data
906546644_906546648 13 Left 906546644 1:46624143-46624165 CCACAGGGGTGCCCAGAGGACAC No data
Right 906546648 1:46624179-46624201 GGCTCTGAGACAAACTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906546644 Original CRISPR GTGTCCTCTGGGCACCCCTG TGG (reversed) Intergenic
No off target data available for this crispr