ID: 906551005

View in Genome Browser
Species Human (GRCh38)
Location 1:46666442-46666464
Sequence CTGGGCAGTGAAGCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906550998_906551005 11 Left 906550998 1:46666408-46666430 CCATAGTGAAGGGGTAGAGAGGG 0: 1
1: 0
2: 4
3: 20
4: 205
Right 906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 221
906550996_906551005 15 Left 906550996 1:46666404-46666426 CCTGCCATAGTGAAGGGGTAGAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906551005 Original CRISPR CTGGGCAGTGAAGCTGTTGC TGG Intronic
900147980 1:1166675-1166697 CTGGGCAGGGAAGCAGCTCCTGG + Intergenic
900597055 1:3484960-3484982 GGGGGCAGTGAGGCTGATGCAGG + Intergenic
901492991 1:9606058-9606080 AGGGGCAGTGAAGGTGTTGCTGG - Intronic
902663877 1:17923973-17923995 CCACCCAGTGAAGCTGTTGCTGG + Intergenic
902766413 1:18619115-18619137 CTGGGCAGGGAAGATGCTGAGGG - Intergenic
903641979 1:24866538-24866560 CTGGGCTCTGATGCTGTAGCAGG + Intergenic
904495461 1:30884096-30884118 CTGGCCAGGGCAGCTGTGGCTGG - Intronic
905832967 1:41089074-41089096 CTGGGCAGTGCTGATGCTGCTGG + Intronic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG + Intronic
907429764 1:54405403-54405425 CTGGGCAGCGACGGTGGTGCCGG - Intronic
907803672 1:57796875-57796897 CTGGTCAGTGAACCGGATGCAGG - Intronic
909325121 1:74341809-74341831 CAGGGCATTGAATCTGTGGCTGG + Intronic
909836442 1:80260793-80260815 CTGTGCAGAGAATCTGGTGCAGG + Intergenic
913347831 1:117825796-117825818 CTGGTCAGTGAGGCTTTTGCTGG - Intergenic
914040231 1:144043012-144043034 CTTGGGAGTGTAGATGTTGCGGG + Intergenic
915018683 1:152760187-152760209 CTGGGGGGTGTAGTTGTTGCAGG - Exonic
916129549 1:161600549-161600571 CTGGGCATTGGGGCTGATGCTGG - Intronic
918635388 1:186768095-186768117 CTGGGCATTGTAGCTCATGCGGG + Intergenic
919750746 1:201036476-201036498 CTGGGCAGCGACCCTGCTGCGGG + Intergenic
920041191 1:203098602-203098624 CTGGGCAGTGAACATGTTCTGGG + Intronic
923662706 1:235972239-235972261 CTGGGCCGTGACGCTGCTGCGGG + Intergenic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1067741480 10:48898830-48898852 CTGGGCAGTGCTGCTGGTTCTGG + Intronic
1070103879 10:73414018-73414040 TTGGGCTGTGACGCTGCTGCTGG - Exonic
1070829040 10:79407558-79407580 CTGGGCGGTGCAGCTGCTGCTGG + Intronic
1073003114 10:100300009-100300031 CTGGGAAGTTAAGCTGGTTCAGG - Intronic
1074825932 10:117215968-117215990 CTGGGCAGGGATGCTGAAGCGGG + Intergenic
1075592052 10:123699046-123699068 CTGGGAAGTGAAGGAGTGGCAGG + Intergenic
1077130208 11:968273-968295 CTGGTCAGTGAGGGTGATGCAGG - Intronic
1077225165 11:1436387-1436409 CTGGGCAGTTCAGTTGCTGCAGG + Intronic
1077486417 11:2840795-2840817 CTGAGCAGAGAAGCTGAGGCTGG - Intronic
1077846255 11:6027660-6027682 TGGGACAGTGGAGCTGTTGCTGG + Exonic
1079415805 11:20235432-20235454 CTGGTTAGTGAGGCTATTGCAGG - Intergenic
1081909624 11:46692524-46692546 CTGGTTAGGGAAGCTGTTGGGGG + Intronic
1083297489 11:61722925-61722947 CTTGGCAGTGAGGTCGTTGCAGG - Exonic
1083339876 11:61952094-61952116 CTGGGCACTGGAGCTGAGGCTGG + Intronic
1084482902 11:69432369-69432391 ATGGGCAGGGCCGCTGTTGCTGG - Intergenic
1084773386 11:71358559-71358581 CTGGGCAGGGCAGCAGCTGCAGG + Intergenic
1085323341 11:75588280-75588302 CTGGGCCGGGCAGCTCTTGCTGG + Intronic
1085914441 11:80868324-80868346 CTGGGTGGTGAAGGTGTTGGTGG - Intergenic
1087188608 11:95230412-95230434 CTGTGCAGTTTAGCTGTTGATGG - Intronic
1087356273 11:97098164-97098186 CTGTGCAGAGATCCTGTTGCAGG + Intergenic
1088627765 11:111743998-111744020 CTGGGCAGTGAAGATTTGGGAGG + Intronic
1088866134 11:113849812-113849834 CTGGCCAGTGAGACTGATGCTGG + Intronic
1090226431 11:125074756-125074778 CTCGGCAGTGAAGCCCTTGCTGG - Intronic
1090338264 11:125990165-125990187 CTGGGTAGTGTACCTTTTGCTGG - Intronic
1091314616 11:134604735-134604757 CAGGTCAGTGAAGCTGTTCTGGG - Intergenic
1092264487 12:6970462-6970484 CACGGCCCTGAAGCTGTTGCTGG - Exonic
1092532897 12:9360142-9360164 CCTAGCTGTGAAGCTGTTGCTGG - Intergenic
1094333001 12:29316913-29316935 CTGTGATGTGAAGCTGTTGCTGG - Exonic
1095359491 12:41319317-41319339 CTGGGTACTGAAGCTGTGGGTGG + Intronic
1096424653 12:51490896-51490918 CAGACCAGTGAAGCTGTTGCAGG + Intronic
1097018760 12:56005535-56005557 CTGGGGAGTGAGCCTATTGCAGG + Intronic
1098634908 12:72770904-72770926 ATGGGCCTTAAAGCTGTTGCTGG - Intergenic
1101884229 12:108648025-108648047 CTGGAGAGTGCTGCTGTTGCCGG - Intronic
1102038129 12:109783588-109783610 GTGGGCAGAGAAGCTGGGGCTGG + Exonic
1106964479 13:35044977-35044999 CTTGACAGTGATGCTGTAGCTGG - Exonic
1109277934 13:60322796-60322818 CTGGGCAGGGAGGGTGTTCCTGG - Intergenic
1109928514 13:69181666-69181688 CTGGGCCTGGAAGCTGTAGCAGG - Intergenic
1110912076 13:80977584-80977606 CTGGGCAGTGAGCCTGTGGAGGG + Intergenic
1111727096 13:92025523-92025545 GTAGTCAGTGAAGCTGTTGCTGG + Intronic
1117786940 14:59295797-59295819 CTGGGAAGGGAAGCAGTGGCTGG + Intronic
1122919686 14:104874884-104874906 CAGGGCAGGGAAGCTGCAGCTGG - Intronic
1123145436 14:106125364-106125386 CTTGGTAGTGAAGCTGTTTCAGG - Intergenic
1123765844 15:23477806-23477828 CTGGGCAACAAAGCTGTTGCAGG - Intergenic
1125716442 15:41822401-41822423 CTGGCCAGTGGAGCTGCTCCAGG + Exonic
1128722184 15:69958150-69958172 CCAGGCAGTGCAGATGTTGCTGG - Intergenic
1129732534 15:77940304-77940326 CTGGGCCCAGAAGCTGCTGCGGG - Intergenic
1129909044 15:79211005-79211027 CTGGGCACTGTAGCTGTGCCAGG + Intergenic
1130271650 15:82453950-82453972 CCAGGCAGTGAAGGTGTTGGTGG + Intergenic
1130463996 15:84181337-84181359 CCAGGCAGTGAAGGTGTTGGTGG + Intronic
1130474798 15:84255267-84255289 CCAGGCAGTGAAGGTGTTGGTGG + Intergenic
1130482214 15:84369323-84369345 CCAGGCAGTGAAGGTGTTGGTGG + Intergenic
1130488685 15:84413496-84413518 CCAGGCAGTGAAGGTGTTGGTGG - Intergenic
1130500271 15:84492204-84492226 CCAGGCAGTGAAGGTGTTGGTGG - Intergenic
1130507826 15:84562683-84562705 CCAGGCAGTGAAGGTGTTGATGG - Intergenic
1130586294 15:85185969-85185991 CCAGGCAGTGAAGGTGTTGATGG + Intergenic
1131567391 15:93498708-93498730 CTGGGCAGTGAGTCTGGTGAGGG - Intergenic
1131788251 15:95936271-95936293 CTCGGCAGCGCAGCTGTTTCAGG + Intergenic
1132354292 15:101159634-101159656 CTGGGCAGGGAAGGGGATGCTGG + Intergenic
1132428156 15:101738006-101738028 CCAGGCAGTGAAGGTGTTGGTGG - Intronic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1133234491 16:4381617-4381639 CTGGGCAATGCGGGTGTTGCCGG - Exonic
1133366757 16:5216337-5216359 CTGGGGAGTGGAGCTGGTGGTGG + Intergenic
1134112782 16:11525657-11525679 CTGAGCAGTGAAGCAGATGTAGG - Intergenic
1135521684 16:23182853-23182875 CTGGGCACTGGAGCGGATGCCGG + Intronic
1136693671 16:32056419-32056441 CTTGGTAGTGAAGCTCTTTCAGG + Intergenic
1136794161 16:32999654-32999676 CTTGGTAGTGAAGCTCTTTCAGG + Intergenic
1136875750 16:33854725-33854747 CTTGGTAGTGAAGCTCTTTCAGG - Intergenic
1141724994 16:85782102-85782124 GCGGGCAGTGAAACTGCTGCTGG + Intronic
1142029488 16:87831471-87831493 CTGGTCAGTGAAGCCGTGTCCGG + Exonic
1142351677 16:89583563-89583585 CTGGGCAGTGAAGCTCATGGTGG + Intronic
1203096425 16_KI270728v1_random:1261335-1261357 CTTGGTAGTGAAGCTCTTTCAGG + Intergenic
1143099489 17:4497659-4497681 ACAGGCAGTGAAGCTGTGGCAGG - Intergenic
1143637876 17:8176712-8176734 CTGGGCAGCGTAGCTGGGGCTGG - Intergenic
1144483399 17:15645712-15645734 CTGGGGAGGGAAGCAGCTGCAGG + Intronic
1144493790 17:15734851-15734873 CTGGCCAGTGAAGCCGCTTCAGG - Intronic
1144915285 17:18719315-18719337 CTGGGGAGGGAAGCAGCTGCGGG - Intronic
1145883740 17:28369113-28369135 CTGGGCAGTGAACCTGGACCTGG - Intronic
1147893895 17:43737761-43737783 TGGGGCAGTGGTGCTGTTGCTGG - Intergenic
1148876589 17:50690891-50690913 CTGGCAAGTGAAGCAGTTTCTGG - Intronic
1151701455 17:75744673-75744695 CTCAGCAGTGAAGGTGATGCTGG - Intronic
1151815708 17:76470438-76470460 TGGGGCAGGGAAGCTGGTGCAGG + Intergenic
1152007231 17:77690331-77690353 GTGGTCAGTGCAGCTGTTTCAGG - Intergenic
1152661078 17:81542419-81542441 CTGGGCAGTGAGGCTCCTGCAGG + Intronic
1153451889 18:5238700-5238722 CTGGGCAGTGACCGGGTTGCTGG - Intergenic
1157693380 18:49701436-49701458 CTGGGGAGTGAAGAAGCTGCTGG - Intergenic
1160342320 18:78100333-78100355 CTGGGAAGAGATGCTTTTGCAGG - Intergenic
1164435193 19:28222710-28222732 TTGGGCAGTGAGGCTGTCACTGG - Intergenic
1165256734 19:34580807-34580829 CTAGGCAGTGAGGCTGGTGCCGG - Intergenic
1165265858 19:34663585-34663607 CTAGGCAGTGAGGCTGGTGCCGG + Intronic
1167737578 19:51305661-51305683 CTGGCAAGTGAGGCTGATGCTGG - Intergenic
925922133 2:8645255-8645277 CTGAGCAGTGAAGCTGAAGAAGG - Intergenic
927286166 2:21359138-21359160 CAGTGCAGGGCAGCTGTTGCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
934775094 2:96932287-96932309 CTGTGCTGTGGAGCAGTTGCTGG - Intronic
935146019 2:100396049-100396071 TGGGGCTGTGAAGCTGCTGCGGG - Intronic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
936028555 2:109053192-109053214 CTTGGAAGTGCAGATGTTGCTGG - Intergenic
936347895 2:111689039-111689061 CTGGGATGTCCAGCTGTTGCTGG - Intergenic
936401377 2:112166981-112167003 CTGGGCTGTGTATCTGTGGCTGG + Intronic
937290901 2:120781195-120781217 CTGGGCAGTGAGGGTGCAGCAGG - Intronic
937532304 2:122844160-122844182 CAGGTCAGGGAAGCTTTTGCTGG + Intergenic
938080542 2:128367750-128367772 CTGGGCAAAGAAGCTTGTGCTGG + Intergenic
941884675 2:170515751-170515773 CTGGGCAGTGGCGCTGGGGCTGG - Intronic
943095710 2:183426793-183426815 CTGGGGAGTGTATCTGTTGAAGG + Intergenic
944567206 2:201003370-201003392 CTGGGCTGGGAAGCTGAGGCAGG + Intronic
945026429 2:205624115-205624137 CTGGGCACTCCAGCTGGTGCTGG - Intergenic
945538367 2:211049468-211049490 CTGGGCAGAGCTGCTGCTGCTGG + Intergenic
946328633 2:218997619-218997641 CTGAGCAGTCAGGCTGTTCCTGG - Intergenic
948103498 2:235394066-235394088 GTGGGCAGTGCAGCTCCTGCCGG + Intergenic
948567965 2:238898423-238898445 CTGGGGAATGGTGCTGTTGCTGG + Intronic
948794912 2:240397551-240397573 CTGGGCAGTGCAGGGGGTGCTGG - Intergenic
1169727277 20:8749233-8749255 ATCTGCAGTGAAGCTGATGCTGG + Intronic
1175844739 20:62052497-62052519 CTGGGGTGTGGAGCTGGTGCGGG - Intronic
1175987732 20:62772277-62772299 ATGGGCAGTGGAGCTGGGGCAGG - Intergenic
1176254051 20:64141420-64141442 AAGTGCTGTGAAGCTGTTGCAGG + Intergenic
1177056099 21:16303213-16303235 CTGGGCAGTGACGATGTGTCTGG + Intergenic
1177364495 21:20116929-20116951 CTGGTTAGTCAAGGTGTTGCAGG + Intergenic
1180994296 22:19957528-19957550 CTGGGCAGAGAAGCTTGGGCAGG + Intronic
1181116527 22:20635400-20635422 CTGGGCAGGGCAGCAGGTGCAGG - Intergenic
1181670960 22:24425232-24425254 CGGGCCTGGGAAGCTGTTGCGGG + Intronic
1181898416 22:26131641-26131663 CAGGGCCGGGAAGCTGTTGGAGG + Intergenic
1183178638 22:36243691-36243713 CTGGTCAGTCAGGATGTTGCGGG + Intergenic
1183283925 22:36951021-36951043 CAGGGCAGTGGGGCTGTTGTGGG + Intergenic
1183485772 22:38087063-38087085 CTGGGCAGTGACACCCTTGCCGG + Intronic
1184879771 22:47297477-47297499 CTGTGCAGTGCAGCTGTGCCCGG + Intergenic
951467810 3:23020790-23020812 CTGGTCAGTGAGGATGTTGCAGG - Intergenic
952986544 3:38790366-38790388 CTGGACAGAAAAGCTGTTGAGGG - Intronic
953119636 3:40027151-40027173 GTGGGGAGTGAAGCTGTTCATGG - Intronic
953785469 3:45907852-45907874 CTGGGCACTGTACCTGTTGCTGG - Intronic
954289507 3:49642348-49642370 CTGGGGAGTGCAGCTGCTGCTGG - Exonic
956640896 3:71414412-71414434 CTGGGCAGTGCATCTGTGACTGG - Intronic
963413143 3:144957907-144957929 CTGGGCAAAGTAGCTGGTGCTGG - Intergenic
964682040 3:159352137-159352159 CTGGGGCGTGGAGCTGTAGCAGG + Intronic
967757916 3:193191021-193191043 CAGGGCAGAGAAGTTGTTGGGGG - Intergenic
968509292 4:988300-988322 CTGGGCCCTGACGCTGGTGCAGG + Exonic
968552246 4:1229671-1229693 CTGGGCAGAGCAGCTGGTGTTGG + Intronic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
968958966 4:3733252-3733274 CTGGGCAGAGATGCTGCTTCAGG + Intergenic
969058230 4:4415305-4415327 CTGTGAAGTGAAGCTGATGACGG - Intronic
969300255 4:6293255-6293277 CTGGGCCCTGTCGCTGTTGCTGG + Intronic
970513985 4:16809185-16809207 CTGGTCAATGTAGCTGTTTCTGG - Intronic
970523743 4:16911254-16911276 CTGTGCAGTGCAGGTGTTTCTGG + Intergenic
975620468 4:76291311-76291333 CTGGGCATGGATGCTGCTGCTGG - Intronic
978269153 4:106868082-106868104 CTTGGCAGAAAAGCTATTGCTGG + Intergenic
979309885 4:119190789-119190811 CAGGGCAGTGGAGATGTTTCAGG + Intergenic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
984336613 4:178400526-178400548 CTGGGAACTGAAGCAGTTCCTGG + Intergenic
985570852 5:643969-643991 CTGGGCAGGGCAGCTGGTGGCGG - Intronic
987100461 5:14587003-14587025 GTGGGCAGTGGAGCTGATGATGG + Intronic
992460335 5:76954078-76954100 CTGCGCAGTGCAGCTGCGGCCGG - Exonic
995466271 5:112452237-112452259 CTTGGCATTGAAGCTGTAGGAGG - Intergenic
996141293 5:119913031-119913053 CTGGTTAGTCAAGGTGTTGCAGG + Intergenic
998920099 5:147058720-147058742 TTGGACAGTGAATCTGCTGCAGG + Intronic
999514603 5:152288467-152288489 CTGGGCTGTGATGCTCATGCTGG - Intergenic
1001295200 5:170494294-170494316 TTGGGCACTGTAGCTGGTGCTGG - Intronic
1002087462 5:176785042-176785064 CTGTGCTGGGAAGCTGCTGCTGG + Intergenic
1002098285 5:176844850-176844872 CTGGGCAGGGAGTCTGTGGCTGG - Intronic
1002803614 6:550895-550917 CAGGGCAGAGAAGATGTGGCAGG - Intronic
1002916272 6:1530330-1530352 CTGGGCAGGGGAGCTGTTTGGGG - Intergenic
1004020963 6:11775230-11775252 CTGGGTAGAGAAGGTGATGCAGG - Intronic
1004191465 6:13467654-13467676 GTGGGAAGTGAAGCTCTTGTTGG - Intronic
1005419508 6:25634322-25634344 CTGGCCAGTGCAGCTCTTCCAGG + Intergenic
1005898597 6:30198409-30198431 CTGGTAAGTGAGGCTGTTTCAGG - Exonic
1006447212 6:34086372-34086394 CGGGTGAGTCAAGCTGTTGCTGG - Intronic
1006836836 6:37004221-37004243 CTGGAGCGTGAAGCTGTTCCAGG + Intergenic
1007935315 6:45727482-45727504 CTTGGCATAGAAGCTGCTGCAGG + Intergenic
1007944327 6:45811801-45811823 CTAGGCAGTGAAGCTTTGGATGG - Intergenic
1008073001 6:47116681-47116703 CTGGGTAGGGAAACTATTGCAGG + Intergenic
1010402736 6:75465489-75465511 TTAGGCACTGAAGCTCTTGCAGG - Intronic
1010989002 6:82458487-82458509 CTGTGCAGAGAATCTGGTGCAGG - Intergenic
1011090513 6:83593305-83593327 CTGGGAAGTGATGCTGTGTCAGG - Intronic
1014094311 6:117443522-117443544 CTGGACAGTGCAGCTGTAGAAGG - Intronic
1015754980 6:136597815-136597837 TTGGACAGTGAAGCTATTGATGG - Intronic
1015858657 6:137652725-137652747 CTGGGCACCAAAGCTGTTGTAGG - Intergenic
1016519545 6:144931209-144931231 CTATGGAGTGAACCTGTTGCAGG + Intergenic
1016562112 6:145408283-145408305 CTGGGTAGTACAGCTGTTACTGG - Intergenic
1017278990 6:152603201-152603223 CTGAGCACTGAGGCAGTTGCTGG + Intronic
1018287626 6:162257750-162257772 CTGGGCAGTGCAGCAGTTCTAGG + Intronic
1018918891 6:168157057-168157079 CTGGGCACTGATGCTGTTGGAGG - Intergenic
1018922103 6:168182487-168182509 AGGGGCAGTGAAGCTGGCGCAGG + Intergenic
1019798162 7:3067406-3067428 CTGGGGAGTGGAGGGGTTGCTGG + Intergenic
1020736649 7:11957779-11957801 TGAGGCAGTGAAGCTGTGGCTGG - Intergenic
1023275865 7:38518000-38518022 CTGGGCAGTGAGCCTGTGGAGGG - Intronic
1026296268 7:69055161-69055183 CTGCGCAGTGGAGTTGCTGCAGG - Intergenic
1029209011 7:98889830-98889852 CTGGGCACTGTAGCTCATGCCGG - Intronic
1029574803 7:101396380-101396402 CTGGGAAGTGAGGCTGAGGCTGG - Intronic
1031196436 7:118620317-118620339 CTGGGCCATGGAGCTGGTGCTGG - Intergenic
1031197090 7:118628876-118628898 CTGGGCCATGGAGCTGGTGCTGG + Intergenic
1032171552 7:129588685-129588707 CTGGACATTGAAGGTGTTTCTGG - Intergenic
1034521158 7:151620993-151621015 CTGGGCAAGGTAGCTCTTGCCGG - Intronic
1036756556 8:11475102-11475124 CTGGGCAGTCCAGTGGTTGCAGG + Intergenic
1037009185 8:13819545-13819567 CTGGTCAGTGAGGCTGTGGAGGG + Intergenic
1039779001 8:40765164-40765186 TTGGGCATTGAAGCCATTGCTGG - Intronic
1040761616 8:50852350-50852372 CTGGGCAGTGTGGCTCTGGCAGG + Intergenic
1043925131 8:86028159-86028181 CTGGGAGGTGAGGCTGTGGCTGG - Intronic
1045117872 8:99003467-99003489 ATAGGCACTGAAGCTCTTGCAGG + Intergenic
1045260606 8:100570206-100570228 CTGGCAAGTGAAACTGATGCTGG - Intergenic
1047493782 8:125395347-125395369 CTGGGCAGGGATGTTGCTGCTGG + Intergenic
1048224426 8:132570987-132571009 CTGGGTAGTGAAGCTCTAGAAGG - Intergenic
1052991262 9:34520578-34520600 CTGGGCAGAGGAGGTGGTGCTGG + Intronic
1056961808 9:91131610-91131632 CTTTGCAGAGAAGCTGTTACTGG + Intergenic
1057704213 9:97386243-97386265 CTTGGCATTGAGGCCGTTGCTGG + Intergenic
1057798310 9:98173673-98173695 CTGGGCTGCGAAGCTGTTATGGG - Intronic
1057857739 9:98614968-98614990 CAGGACAGAGAAGCTGTTCCAGG - Intronic
1058032074 9:100210989-100211011 CTGGGAAGTGCTGCTGCTGCTGG - Intronic
1059891977 9:118814017-118814039 CTGGGAAGTGAGACTGATGCTGG - Intergenic
1060847623 9:126849742-126849764 CTGGAAAGTGCAGCTGTTACAGG - Intergenic
1060911410 9:127354103-127354125 CTGGGGAGGGAAGCCGTTGGGGG + Intronic
1061036045 9:128114903-128114925 CAGGGGAGTGAAGCTGCGGCGGG + Intergenic
1061322776 9:129841702-129841724 CAGGACAGGGAAGCTGTTGAAGG + Intronic
1061541424 9:131279622-131279644 GTGAGCAGTGAAGCTGCTGGAGG + Intergenic
1062473063 9:136714666-136714688 CTGGGCACTGAATCTGTTTCCGG - Intronic
1188762860 X:34053995-34054017 CTGGGCACCAAAGCTGTTGCAGG - Intergenic
1189510426 X:41656304-41656326 CTGGCAAGTGAGGCTGATGCTGG + Intronic
1189516242 X:41715896-41715918 CTGGCAAGTGAGGCTGATGCTGG + Intronic
1192261854 X:69510406-69510428 CTTGGCAGGAAAGCTGTGGCAGG - Intronic
1195383422 X:104291714-104291736 CTGGCAAGTGAGGCTGATGCTGG + Intergenic
1202376187 Y:24239609-24239631 CCAGGCAGTGAAGGTGTTGATGG - Intergenic
1202494593 Y:25430509-25430531 CCAGGCAGTGAAGGTGTTGATGG + Intergenic