ID: 906551031

View in Genome Browser
Species Human (GRCh38)
Location 1:46666668-46666690
Sequence TTGAAAAAGAATGGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1274
Summary {0: 1, 1: 0, 2: 4, 3: 114, 4: 1155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906551031_906551040 27 Left 906551031 1:46666668-46666690 CCCTCCTCTCCATTCTTTTTCAA 0: 1
1: 0
2: 4
3: 114
4: 1155
Right 906551040 1:46666718-46666740 AGAGAGACTGGCAGGGACTAGGG 0: 1
1: 0
2: 0
3: 41
4: 396
906551031_906551037 19 Left 906551031 1:46666668-46666690 CCCTCCTCTCCATTCTTTTTCAA 0: 1
1: 0
2: 4
3: 114
4: 1155
Right 906551037 1:46666710-46666732 AAAACTAGAGAGAGACTGGCAGG 0: 1
1: 0
2: 0
3: 30
4: 421
906551031_906551036 15 Left 906551031 1:46666668-46666690 CCCTCCTCTCCATTCTTTTTCAA 0: 1
1: 0
2: 4
3: 114
4: 1155
Right 906551036 1:46666706-46666728 AGATAAAACTAGAGAGAGACTGG 0: 1
1: 0
2: 5
3: 56
4: 649
906551031_906551038 20 Left 906551031 1:46666668-46666690 CCCTCCTCTCCATTCTTTTTCAA 0: 1
1: 0
2: 4
3: 114
4: 1155
Right 906551038 1:46666711-46666733 AAACTAGAGAGAGACTGGCAGGG 0: 1
1: 0
2: 2
3: 23
4: 403
906551031_906551039 26 Left 906551031 1:46666668-46666690 CCCTCCTCTCCATTCTTTTTCAA 0: 1
1: 0
2: 4
3: 114
4: 1155
Right 906551039 1:46666717-46666739 GAGAGAGACTGGCAGGGACTAGG 0: 1
1: 0
2: 2
3: 47
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906551031 Original CRISPR TTGAAAAAGAATGGAGAGGA GGG (reversed) Intronic
900904706 1:5546691-5546713 TTTCAAAAAATTGGAGAGGAGGG + Intergenic
901255674 1:7824433-7824455 TTGAAAAAGAATAAAGCTGAAGG - Intronic
902066633 1:13693577-13693599 GTGAAGAAAAATGGAGAGCACGG + Intergenic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902450104 1:16491333-16491355 TGGAAAAGGACAGGAGAGGAGGG + Intergenic
902726989 1:18343771-18343793 GTGAAACAGAATGGAGAGTCTGG - Intronic
903388609 1:22946775-22946797 TTGAATAAGAATGGTGAGAGTGG - Intergenic
903767609 1:25744639-25744661 TGGAAAAAGAATGGAAGTGAGGG - Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904193061 1:28762630-28762652 TTGAAAGTGAAGGGAGAGGGAGG + Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904573504 1:31485794-31485816 TTGAAAAAGAAAAGGGAGAAGGG + Intergenic
905133293 1:35777924-35777946 TGGAAATAGAATGGAGAGAAAGG - Intergenic
905303786 1:37003916-37003938 TGCAGAAAGAAGGGAGAGGAGGG + Intronic
905575798 1:39043701-39043723 AAGAAAAAGAAAGAAGAGGAAGG + Intergenic
905602247 1:39263256-39263278 TTGAAGGAGAAGGGAGAGGCTGG + Intronic
905737157 1:40337463-40337485 TTGAATAAAAAGGCAGAGGAAGG + Intergenic
906023159 1:42649151-42649173 TTCAAAAAAAATAAAGAGGAGGG + Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906920825 1:50062664-50062686 TTGAAATAGAATACACAGGAGGG + Intronic
907061811 1:51434628-51434650 TTGGAAATGAATGGTGATGATGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907394946 1:54182875-54182897 AACAAAAAGAATGGAGAGGAAGG + Intronic
907416495 1:54318062-54318084 TAGAAAGAGGATGGAGAGGCCGG - Intronic
907696234 1:56731938-56731960 TTGAATAAGAATGGAGAGAGTGG - Intronic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
908241979 1:62195455-62195477 TAGAAAAAGGATGGAGGGGCCGG + Intronic
908376459 1:63547041-63547063 GGGAAAAAGAATGGGGAGGTGGG - Intronic
908727215 1:67189642-67189664 TTGAAAAAAATTAGAGAAGAGGG + Intronic
908798470 1:67854647-67854669 TATGAGAAGAATGGAGAGGAGGG + Intergenic
908818682 1:68059668-68059690 GAAAAAAAGAATGAAGAGGAAGG + Intergenic
908818899 1:68062288-68062310 TTGAATAAGAATGGTAAGAAAGG - Intergenic
909053710 1:70797985-70798007 TTGAACAAGAATGGTGAGAGAGG + Intergenic
909251224 1:73359223-73359245 AGCAAAAAGAATGTAGAGGAGGG + Intergenic
909307778 1:74103195-74103217 TTTATAAAGAATGGAAATGAGGG - Intronic
909323172 1:74316425-74316447 TATAAAAAGAGTGGAGATGAAGG - Intronic
909533050 1:76702184-76702206 TTGAAAAAGTTTGGTGAGGCAGG - Intergenic
909988593 1:82193285-82193307 TTGAAATAGGGTGGAGAGCAAGG - Intergenic
910062613 1:83111825-83111847 TTGAAAAAGAAAGTAAAGGTAGG + Intergenic
910218869 1:84869447-84869469 GTGAAAAAGATTGCACAGGATGG + Intronic
910245554 1:85134704-85134726 TTGTGAAAGAAAGGAGATGAAGG - Intergenic
910254428 1:85233584-85233606 TTGAATAGGAATGGTGAGAATGG + Intergenic
910288484 1:85578794-85578816 TAGAGAGAGAATGGAGAGGAGGG - Intergenic
910381818 1:86634369-86634391 TTGAATAACAATGGATATGATGG + Intergenic
910476595 1:87614455-87614477 TTGAAGAAGAAAGGAAGGGAGGG + Intergenic
910579332 1:88805156-88805178 TTGAGAAAGTAGTGAGAGGATGG - Intronic
910651539 1:89573682-89573704 TTGAAAAAGGATAGAGAAGCAGG - Intronic
911039958 1:93583568-93583590 TGGAAGCAGAATGGAGAGGAAGG + Intronic
911222569 1:95264516-95264538 TAGAAAGAGAATAGAGAGAAGGG + Intergenic
911271610 1:95808449-95808471 ATGCAAAGGGATGGAGAGGATGG - Intergenic
912016531 1:105044133-105044155 TTCAAAAAAAGTGAAGAGGAGGG + Intergenic
912081075 1:105936792-105936814 TTGAAACAGTATGGAGAAGGAGG - Intergenic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912934942 1:113994879-113994901 ATTAAAAAGAATGAAGAGGCCGG + Intergenic
913028152 1:114867795-114867817 TTGAAAAAGAATGGTGAGAGGGG + Intronic
913081467 1:115391441-115391463 TAGAAAAAAATTGCAGAGGAGGG + Intergenic
913666759 1:121056089-121056111 TTGAAACTGAATGGACAGGCTGG - Intergenic
914018503 1:143843525-143843547 TTGAAACTGAATGGACAGGCTGG - Intergenic
914657058 1:149751728-149751750 TTGAAACTGAATGGACAGGCTGG - Intergenic
914720050 1:150282243-150282265 TGGAAAAAGAGTGGAAAAGAAGG - Intergenic
914925046 1:151877882-151877904 TTGAAACAGAAGGTAGAGCACGG + Intronic
915206095 1:154271559-154271581 TTGAAAAAGAATCTAGAGCAAGG + Intergenic
915419942 1:155772279-155772301 TTCAAAGAGAATAGAAAGGAAGG + Intronic
915640746 1:157224005-157224027 TTCTAAAAGATTGAAGAGGAGGG - Intergenic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
916235352 1:162582311-162582333 TTGAAAAAGGATGAAGATAAGGG + Intronic
916295373 1:163213437-163213459 CTCAGAAAGAATGGAGAGGAGGG - Intronic
916459631 1:165009951-165009973 TTGAAAAAGATAGGAAAAGAAGG - Intergenic
916525252 1:165603431-165603453 TTCAAAAGGTCTGGAGAGGAAGG - Intergenic
916641561 1:166734057-166734079 TTGAATAGGAATGGTGAGAATGG - Intergenic
916739253 1:167633852-167633874 TACAATAAGAATGGAGAAGATGG + Intronic
916888972 1:169098061-169098083 TTAAAAAAGAAAAGAAAGGAAGG + Intergenic
917568207 1:176233931-176233953 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
917790390 1:178495654-178495676 TTGAAAAGGAAGGAAGAGAAGGG + Intergenic
917826041 1:178821581-178821603 TTGAAAAAAAATGGGGGAGAGGG - Intronic
917908631 1:179616348-179616370 AGGAAAGACAATGGAGAGGAAGG - Intronic
918159742 1:181887144-181887166 TTGAAAAGGAGTGGGGAGGGAGG + Intergenic
918209864 1:182341017-182341039 TGGAAAAAGACTTGAAAGGAAGG - Intergenic
918389121 1:184039544-184039566 CTGAAAATGGATGGAGGGGAAGG - Intergenic
918732552 1:188016301-188016323 TTTAAAAAGAAAGAAAAGGAAGG - Intergenic
918781323 1:188703767-188703789 GTGAAACAGAATGGAAAGGCAGG - Intergenic
919143540 1:193604054-193604076 GTGAAAAAGAATGGAGCAAATGG + Intergenic
919201668 1:194362820-194362842 AGCAATAAGAATGGAGAGGATGG + Intergenic
919350566 1:196448122-196448144 ATGAAAAAGAAGGCAGAGCATGG + Intronic
919458302 1:197846202-197846224 CTCAAAAAGAAAGGAAAGGAAGG - Intergenic
919844116 1:201630217-201630239 TTAAAAAAGTATCTAGAGGATGG + Intronic
919935926 1:202250941-202250963 CTGAGGAAGAATGTAGAGGAAGG - Intronic
920410506 1:205756295-205756317 TAGAAAAAGAGAGTAGAGGATGG - Intergenic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920796623 1:209143435-209143457 GGGAAAAAGAAAGGAAAGGAGGG + Intergenic
920874828 1:209825245-209825267 TTCAAAAATAATGCAGAGTAGGG + Intergenic
921496560 1:215849363-215849385 TTAAATAAGAAAGGAGAGCAAGG + Intronic
921652908 1:217700100-217700122 TTGAAAAAAAATAGAGTGAAAGG - Intronic
921822054 1:219628552-219628574 TTGAAGCAGAATAGAGAGCAAGG + Intergenic
921940995 1:220839647-220839669 TTGAAAATGAATGGAGTGCCAGG + Intergenic
922587246 1:226743650-226743672 TTGAAAAAGAATGCAGTGGGAGG + Intergenic
922593063 1:226793141-226793163 TTCTGAAAGAAAGGAGAGGAAGG + Intergenic
922733241 1:227964681-227964703 TAAAAAAGAAATGGAGAGGAAGG - Intergenic
922742080 1:228019712-228019734 TAGATAGAGAATGGAGAGGGTGG - Intronic
923189526 1:231607076-231607098 TTTAAAAAAAATGGAAAAGAGGG - Intronic
923428292 1:233893413-233893435 TAGAGAAAGAATGAAGAAGATGG - Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923751370 1:236749498-236749520 TTAAAAAAGAATGCTGAGGCTGG + Intronic
923752537 1:236759518-236759540 ATGAAAAAGAGGGGAGAGGAGGG - Intronic
923909806 1:238428755-238428777 TTGAATAAGAGTGGTGAGAATGG + Intergenic
923925900 1:238626984-238627006 TCGAACAAAAATGTAGAGGAAGG - Intergenic
923954867 1:239004997-239005019 TTAAAAATGAATGCAGAGGCCGG + Intergenic
924059280 1:240154886-240154908 TTGAAAAGAAAAGGAGGGGAGGG - Intronic
924148539 1:241102577-241102599 TTGAAAAAAAAGGGAATGGAGGG - Intronic
924208109 1:241735458-241735480 TAGAAAAATATAGGAGAGGAGGG - Intronic
924262307 1:242244567-242244589 TTTAGAAACAATGGAGAGGATGG + Intronic
924275104 1:242378022-242378044 ATCAAAAAGAATGGAAAGCAGGG + Intronic
924326355 1:242898218-242898240 TTGAATAGGAATGGCGAGAATGG + Intergenic
1063437882 10:6049282-6049304 TAGAACAAGAAGGCAGAGGAAGG - Intronic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1063914901 10:10871586-10871608 GGGAAAAAGAATGGAAAAGAGGG + Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064485414 10:15783482-15783504 TGGAAAAAGGAAGGAGAGGAGGG - Intronic
1064577475 10:16760835-16760857 ATGAAAGAGTATGGAGAAGAGGG - Intronic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1065311250 10:24417622-24417644 TTGAGACACAGTGGAGAGGAAGG + Intronic
1065476191 10:26140385-26140407 ATGAAAAACAAGGGAGAGGCTGG + Intronic
1065754833 10:28921812-28921834 TTGGAAAAAAAGGGAGAGGAGGG + Intergenic
1066125847 10:32342118-32342140 TTAGAAAAGAATTGAGAGTATGG - Intronic
1066231474 10:33439041-33439063 AAGAAAAAGAAAGGAAAGGAAGG - Intergenic
1066655192 10:37692319-37692341 TTGAAAAAGAATAGAGTAGGAGG + Intergenic
1066771964 10:38853651-38853673 ATGGAATGGAATGGAGAGGAAGG + Intergenic
1066772021 10:38854041-38854063 ATGGAAAAGAATGGAATGGAAGG + Intergenic
1067215925 10:44302800-44302822 TTCAAAACAAATGGTGAGGAGGG + Intergenic
1067463297 10:46474235-46474257 TTGAAATAGAGTGGAGAAAAAGG - Intergenic
1067571159 10:47372175-47372197 TTGGAAATGACTGGAGAGTAGGG + Intronic
1067623897 10:47910403-47910425 TTGAAATAGAGTGGAGAAAAAGG + Intergenic
1067672651 10:48338533-48338555 TTGAAAAGGAATGGTGAGAGTGG - Intronic
1067784988 10:49239329-49239351 TTGAGCAAGCAGGGAGAGGATGG + Intergenic
1068176142 10:53461640-53461662 TTGAATAAGAGTGGTGAGAATGG + Intergenic
1068794225 10:61060218-61060240 TTGCAAAAGAATGGAGCAGCAGG - Intergenic
1068947107 10:62740524-62740546 TTCACAAACAATTGAGAGGAAGG - Intergenic
1069072359 10:64002424-64002446 TTGAAAAGGAGTGGTGAGAAAGG - Intergenic
1069111325 10:64450862-64450884 TTGAGAGAGAAGGGAAAGGATGG - Intergenic
1069167695 10:65183911-65183933 ATGAAACAGAATAGAGAGGCAGG + Intergenic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070338103 10:75472749-75472771 TTGACAAGAGATGGAGAGGAGGG + Intronic
1071316314 10:84402744-84402766 TTGAATAAGAGTGGTGAGAATGG - Intronic
1071323392 10:84487778-84487800 TTGAATAGGAATGGTGAGAAAGG + Intronic
1071891820 10:90016533-90016555 TTCAAAAAAATTGAAGAGGAAGG - Intergenic
1071922340 10:90365184-90365206 AAGAAAAGGAATGGAAAGGAAGG + Intergenic
1072195516 10:93114566-93114588 TTGAAAATGGAAGGTGAGGAGGG + Intergenic
1072223124 10:93344574-93344596 AAGAAAAAGAAGGGAAAGGAGGG + Intronic
1073201816 10:101741367-101741389 CTGAAAAAGGATGGAGAGTGAGG + Intergenic
1073624290 10:105080822-105080844 ATGAAACAGAATAGAGAGCATGG + Intronic
1073745801 10:106467167-106467189 TTGAGAAAGATAGGAGATGATGG + Intergenic
1073787720 10:106908642-106908664 TTGGGAAAGAATGGACAGAATGG - Intronic
1073967874 10:109012480-109012502 TAGAACAAAAATGCAGAGGAGGG - Intergenic
1074188973 10:111119414-111119436 TAGAAAAAGACTGAAGAAGAAGG + Intergenic
1074918954 10:117987795-117987817 TTGAGAAAGACAGGAGAGCAGGG - Intergenic
1075012032 10:118881116-118881138 TTAAAAAAAATTGAAGAGGAGGG + Intergenic
1075186011 10:120258076-120258098 ATGAAACAGAATGGAGAGCCCGG - Intergenic
1075573328 10:123560677-123560699 GGGTAAAAGACTGGAGAGGAGGG + Intergenic
1075947483 10:126448992-126449014 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1076575920 10:131467778-131467800 TTGAAAAGGAGTGGTGAGTAGGG + Intergenic
1077279595 11:1736567-1736589 GTGAAATAGAGTGGAGTGGATGG + Intronic
1077900463 11:6483321-6483343 TGAGAAAAGAATGGAGAGGCTGG - Exonic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078533585 11:12156020-12156042 TTGAAAAGGAGTGGGGAAGAGGG + Intronic
1079470673 11:20774308-20774330 GAAAAAAAGAAAGGAGAGGAAGG - Intronic
1079501430 11:21105505-21105527 TTGACAAAGAAAGGAGAAGATGG + Intronic
1079837840 11:25356265-25356287 GTGAAAAGGAAAGGAGAGGAGGG + Intergenic
1079928889 11:26532581-26532603 GTGAAAAAAAATGCAGAAGATGG - Intronic
1080164522 11:29220986-29221008 TTGAAAAGGAGTGGTGAGAAAGG + Intergenic
1080318288 11:30975324-30975346 TTGAATAAGAATGGTGAGAGTGG - Intronic
1080405975 11:31979459-31979481 GTTAAAAAGAATGGAGTAGATGG + Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080569928 11:33546493-33546515 GTGAAATAGGATGGAGAGAAGGG - Intronic
1080681740 11:34483203-34483225 TTGAAACAGGATTGAGATGAGGG - Intronic
1081217277 11:40417079-40417101 TTAAAAGAGAATAGATAGGAAGG + Intronic
1081708811 11:45203822-45203844 CTGAAAGAGAATGGAGAAAATGG + Intronic
1081877871 11:46422608-46422630 TTTTAAAAGGATGGAGAAGAAGG - Intronic
1081948036 11:47016260-47016282 TTGAACAAAAATGGTGAGAATGG - Intronic
1082731565 11:56804380-56804402 ATGAAAGAGAAGGGAGAAGAAGG + Intergenic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1082917741 11:58456520-58456542 TTCCAAAAGATTGGAGAGGAGGG + Intergenic
1084052677 11:66610754-66610776 TTTACAACGAATGGAGAGAAAGG - Intergenic
1084305707 11:68281939-68281961 TTAATAAGGAATGGATAGGAAGG - Intergenic
1084311790 11:68321147-68321169 TTTACAATGAATGGATAGGATGG - Intronic
1084499962 11:69529655-69529677 TTGAGAGAGAATGGTCAGGAAGG + Intergenic
1084938680 11:72600918-72600940 TGGAAAAAGAATCGAGGGAAAGG + Intronic
1085068180 11:73517325-73517347 TTTAAAAAGTATGTAGAGGCTGG - Intronic
1085630542 11:78112295-78112317 TTGAATAGGAATGGTGAGAAGGG + Intronic
1085812553 11:79697832-79697854 GAGAAAAAGTATGGAAAGGAAGG + Intergenic
1085851865 11:80130116-80130138 TTATCAAGGAATGGAGAGGAGGG - Intergenic
1086082462 11:82919133-82919155 TTGAAGAAGAATGGTGAGAGTGG + Intronic
1086134025 11:83429125-83429147 GTGAGCAAGAGTGGAGAGGAGGG + Intergenic
1086574486 11:88323373-88323395 TTGAATAAGAATGGTGAGAGAGG - Intronic
1086767368 11:90714151-90714173 TTCAAAAAGATTGAAGATGAGGG - Intergenic
1086850959 11:91807660-91807682 TTGAGAAAAACTGAAGAGGAAGG - Intergenic
1087004593 11:93457038-93457060 TTGAATAAGAAGGGTGAGAATGG - Intergenic
1087091506 11:94278395-94278417 TGTAAACAGAATGTAGAGGAGGG + Intergenic
1087215774 11:95492062-95492084 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1087578488 11:100021976-100021998 TGGAAAAAGCAGGGAGAAGAAGG - Intronic
1087599723 11:100298034-100298056 AGGAAAAAGAGTGGAGATGAAGG + Intronic
1088037701 11:105337145-105337167 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1088634251 11:111804269-111804291 TGAAAAAAGAATTGAGAAGATGG + Intronic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1088875269 11:113930448-113930470 ATGAAAAAAATTGGTGAGGAGGG + Intronic
1089075777 11:115737331-115737353 TTGAAAAAGATGTCAGAGGAAGG + Intergenic
1089122840 11:116151498-116151520 TTGAAAAAAAATAAAGTGGAAGG + Intergenic
1089344426 11:117781720-117781742 TGGAAAATGGAGGGAGAGGATGG + Intronic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1090091422 11:123701744-123701766 TTATAAAAGAATGGAGGGCAGGG - Intergenic
1090201352 11:124859940-124859962 CTTTAAAAGAATAGAGAGGATGG + Intergenic
1090298807 11:125615752-125615774 TTAAAAAACAATGCAGAGGCCGG + Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090724133 11:129507674-129507696 TGGAAAAAGAACGAAGTGGAAGG - Intergenic
1090895699 11:130972789-130972811 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1090923860 11:131232562-131232584 GAGAAAAAGAGAGGAGAGGAGGG - Intergenic
1090929880 11:131287693-131287715 TTCAAGAATAAAGGAGAGGAGGG + Intergenic
1091073567 11:132592398-132592420 TGGAAAAAAAATGGAGAAAATGG + Intronic
1091294557 11:134464492-134464514 GTGAAAAGGAATGGGGAGGCAGG - Intergenic
1091398109 12:166334-166356 TTTAAAAAAAATGAAGTGGAGGG - Intronic
1091598155 12:1894341-1894363 TTCCAAAATATTGGAGAGGATGG + Intronic
1091980694 12:4861525-4861547 TTTAAAAAGAGTGGTCAGGAAGG - Intergenic
1092305485 12:7296450-7296472 TTGCAAGAGAAAGGAGAGAAAGG + Intergenic
1092579471 12:9822456-9822478 AGGAAAAAGAATGAAAAGGAAGG + Intergenic
1092703614 12:11260422-11260444 TTGAAGAGGAGTGGAGAGAAAGG - Intergenic
1092703996 12:11264443-11264465 TTAAAAAAAAATGGAAGGGAGGG + Intergenic
1092861418 12:12723488-12723510 TCGAAATAGGAAGGAGAGGAGGG + Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093482570 12:19619787-19619809 TTGAAGGAGAATAGAGAGAAAGG - Intronic
1093863611 12:24198233-24198255 TGTAAAAAGAAAGGAGAGGGAGG + Intergenic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1095189544 12:39240790-39240812 TTGGAAAACAATAGAGATGATGG - Intergenic
1095194779 12:39300845-39300867 GTGAAAAAGAAAAGAGAGAAAGG - Intronic
1095278612 12:40322489-40322511 TTGATGAAGAAAGCAGAGGAAGG + Exonic
1095320004 12:40815687-40815709 TTGAATAGGAATGGTGAGAAAGG + Intronic
1095443796 12:42265104-42265126 TTGAAAAAGAAGGAAGTCGAAGG - Intronic
1095488907 12:42712377-42712399 TTGAACAAGAGTGGTGAGAAAGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1096495104 12:52035473-52035495 TGGAAAAAGAAAGGAAAAGAGGG + Intronic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1096925519 12:55140319-55140341 TTGAATAGGAATGGTGAGCATGG - Intergenic
1097139839 12:56892001-56892023 TTGAAAAGGAATGGTGAGAGAGG - Intergenic
1097392500 12:59032819-59032841 GTGGAAAAGATAGGAGAGGAGGG + Intergenic
1097397844 12:59097731-59097753 GGGAAAAAGAAGAGAGAGGAGGG + Intergenic
1097624149 12:61979631-61979653 TTGAAAAAGGAAGGTGAGTAAGG + Intronic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097934538 12:65230790-65230812 TTAAATAAGAATGGTGAGAATGG + Intronic
1098203037 12:68077298-68077320 ATGAAAAACAAGGGAGATGATGG + Intergenic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1098473766 12:70875447-70875469 GGGTAAAAGAATGGAGAAGAGGG + Intronic
1098525168 12:71479539-71479561 AGTGAAAAGAATGGAGAGGAGGG + Intronic
1098713957 12:73804926-73804948 TTGAATAAGAGTGGAGAGAGTGG + Intergenic
1098926534 12:76357206-76357228 CTGAACAAAAATGGAAAGGAAGG - Intronic
1099001149 12:77179422-77179444 TTGAAAAATCATGGAGAAGCGGG - Intergenic
1099096052 12:78376370-78376392 TTAATAAAGAATAGAGTGGATGG + Intergenic
1099141684 12:78984876-78984898 TAGAAAAAGAATTAACAGGAAGG + Intronic
1099313315 12:81054610-81054632 TTGAAGAAGGTAGGAGAGGAAGG - Intronic
1099720609 12:86357114-86357136 TTGAAAAAGCTTCCAGAGGAAGG + Intronic
1099881151 12:88468014-88468036 TTGAAAAATTATGAAAAGGAAGG - Intergenic
1100274555 12:93060180-93060202 ATGCAAAAGAATCGAGAGCAGGG + Intergenic
1100330955 12:93581800-93581822 ATGAGAAAGGATGGAGAGGATGG + Intronic
1100726526 12:97414605-97414627 TTGACAAAGAAAGGAAGGGAGGG - Intergenic
1100765014 12:97854309-97854331 TAGAAAAAAAATTGAGAGGCCGG - Intergenic
1100777195 12:97988277-97988299 ATAAAAAAGAAAGGAAAGGAAGG + Intergenic
1101056177 12:100916798-100916820 TGGACAAAGAATGGATGGGAAGG + Intronic
1101120256 12:101571755-101571777 TTGAAAGGGAAAGAAGAGGAGGG - Intronic
1101291026 12:103369551-103369573 GTGTGAAAGAATGGAGAGGCAGG + Intronic
1102113873 12:110385855-110385877 TTGAAAAAGATTGCAGGTGAAGG - Intronic
1102664392 12:114557745-114557767 TTGAAAAAGATTCTAGAGCATGG + Intergenic
1102733294 12:115134157-115134179 TTGAAACAGAAAGGAGGGGTTGG + Intergenic
1103022334 12:117544868-117544890 TTGAATAAGAATGGTGAGAGTGG + Intronic
1103521510 12:121539055-121539077 TGGAGAAAGAATGGAGAGGCTGG - Intronic
1104346595 12:128005205-128005227 TTGACAAAGAAAAGAGAAGATGG + Intergenic
1104498974 12:129266550-129266572 ATGAAGAGGAAAGGAGAGGAAGG - Intronic
1104680797 12:130750205-130750227 TTCCAAAAGGAAGGAGAGGAAGG + Intergenic
1104928221 12:132324749-132324771 CTGAACCAGAATGGAGAGGCTGG - Intronic
1105044383 12:132989790-132989812 TTGAAAAAGAGTGGTGAGAGGGG + Intronic
1105309115 13:19190476-19190498 TTGAAAAGGGATGAAGGGGAAGG + Intergenic
1105495360 13:20926094-20926116 TTGACAAAGAAAAGAGAAGATGG + Intergenic
1105641948 13:22274951-22274973 TTGAAATAGAATGGAATGAAAGG + Intergenic
1105739589 13:23309699-23309721 TTGAAAGAAAAAGGAGAGGTGGG - Intronic
1105795391 13:23847075-23847097 TTGAAAAAAAATCAACAGGAGGG + Intronic
1105847974 13:24309180-24309202 TTGAAAAAGAAAGGAGTTAATGG + Intronic
1105955247 13:25275860-25275882 TCAAAAAAGAAGGGAGGGGAGGG + Intronic
1106087144 13:26553519-26553541 CTAAAAAATAATGGAGAGGCCGG + Intergenic
1106723442 13:32459762-32459784 TCCAAAAAAAATGAAGAGGAGGG + Intronic
1106875500 13:34067614-34067636 TTAATAAAGAAAAGAGAGGAGGG + Intergenic
1107054390 13:36087702-36087724 TTAGAAGAGAGTGGAGAGGAGGG - Intronic
1107571400 13:41662770-41662792 TTGAATAGGAATGGTGAGCATGG + Intronic
1107589129 13:41883236-41883258 CTGGTAAAGAATGGAGGGGAAGG + Intronic
1107871133 13:44747623-44747645 TTCAAAAAGGCTGGTGAGGAGGG - Intergenic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1108394936 13:49982824-49982846 TTGTAAAACTATGGAGAGTATGG + Intergenic
1108834402 13:54523297-54523319 TTGAGAGAAAAGGGAGAGGAAGG - Intergenic
1109203827 13:59459897-59459919 CTGAAAAAGGATGCAGGGGAAGG + Intergenic
1109250365 13:60012428-60012450 TGGAAAAAGAATGAAAAGGCAGG + Intronic
1109366884 13:61367391-61367413 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1109589672 13:64462169-64462191 TTGAAAAAGAGGGGTTAGGATGG - Intergenic
1109668089 13:65565550-65565572 TTGCAAAAACATGGACAGGAAGG - Intergenic
1109825598 13:67716837-67716859 TTGATAAAGAAAAGAGAAGATGG + Intergenic
1109836758 13:67868889-67868911 TTTAAAAAGAATAAAGAGAAAGG - Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110214926 13:73014690-73014712 TTAAAAAACAATTGAGAGGAAGG - Intronic
1110307023 13:74000053-74000075 TTTAAAAAAAGTGGGGAGGAGGG - Intronic
1110309359 13:74029896-74029918 GTGAAAAAGTATGGAAAGGAAGG + Intronic
1110999517 13:82161413-82161435 TGGAAAAAAAATGAACAGGATGG + Intergenic
1110999631 13:82163707-82163729 CTGAAAAAGGTTGGACAGGAAGG + Intergenic
1111497483 13:89071089-89071111 TTGATAATCAATGGAGAGCAAGG + Intergenic
1111872359 13:93848854-93848876 TTGAAAGAAAGGGGAGAGGAAGG - Intronic
1112737205 13:102434175-102434197 ATAAAAGAGAATGGAGAGAATGG - Intergenic
1113066042 13:106375109-106375131 AGGAAGAAGAATGGAGAAGAAGG - Intergenic
1113616145 13:111681898-111681920 TTAAAAAAGAGTGGCGAGGCTGG + Intergenic
1113621613 13:111766791-111766813 TTAAAAAAGAGTGGCGAGGCTGG + Intergenic
1113683809 13:112263816-112263838 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114274305 14:21128383-21128405 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1114406783 14:22464181-22464203 CTGAAAAAGAGTGAAGAGGGTGG - Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1114812857 14:25920784-25920806 TTTGAAAAGGATGGAGAGGCAGG + Intergenic
1115139211 14:30149273-30149295 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1115254404 14:31383942-31383964 TTGAATAGGAATGGTGAGAAGGG - Intronic
1115354098 14:32428622-32428644 TTGTAAAAGAAAGGAGAGAGAGG + Intronic
1115401226 14:32963017-32963039 TTCCAAAAGAAAGGAGATGAAGG - Intronic
1115529300 14:34312234-34312256 TAGAAGAAGAATGGAGAGCAAGG + Intronic
1115721751 14:36169422-36169444 TTGAGAGAGAATGGAGAAAATGG + Intergenic
1115735199 14:36320393-36320415 GAGAAAAAGAATGGCGAGGAGGG + Intronic
1115826667 14:37285886-37285908 TAGAAAAAGACTGGAGAGGCCGG - Intronic
1116141999 14:41008513-41008535 TTGAAAAGGAAGAGAGAGAAAGG - Intergenic
1116348628 14:43829601-43829623 TTGAATATGAATGGTGAAGAAGG + Intergenic
1116895192 14:50309599-50309621 GTTAGGAAGAATGGAGAGGAAGG + Intronic
1117080615 14:52148429-52148451 TTGAATAGGAATGGTGAGAATGG + Intergenic
1117575323 14:57091849-57091871 TGGAGAAAGAATGGAAAGAAAGG + Intergenic
1117645143 14:57843631-57843653 TTCTAAAAGACTGGAGACGAAGG + Intronic
1117800707 14:59442053-59442075 TTAAAAAAGAAAAGAAAGGATGG - Intronic
1117856902 14:60043842-60043864 TTTAAAAAAATTGAAGAGGAAGG - Intronic
1117867624 14:60165748-60165770 CTGAATAGGAATGGAGAAGAGGG - Intronic
1118451074 14:65902649-65902671 ATGAAAAATATTGAAGAGGATGG + Intergenic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1119374508 14:74178782-74178804 TTCAAAAAAAATAGAGAGGCTGG + Intronic
1119406970 14:74405116-74405138 TTGTAAAAGCATGGAGAGGGAGG - Intergenic
1119522052 14:75293927-75293949 AAGAAAAAGAAGGGACAGGAGGG + Intergenic
1119984169 14:79116902-79116924 TTGACAAGGCATGGAGAAGAAGG - Intronic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1120072584 14:80120733-80120755 TTGAAACAGTATGGAGAAGTGGG - Intergenic
1120401412 14:84037229-84037251 TTGAAAGAGACTGGAAAGGGAGG - Intergenic
1120408510 14:84119934-84119956 TTGGAAAATAATGCAGAAGATGG - Intergenic
1120453541 14:84702226-84702248 TTGGAACAGAATGTTGAGGAAGG + Intergenic
1120623032 14:86789541-86789563 TTGAAAAGGAATTGAGTGGATGG - Intergenic
1120759873 14:88275422-88275444 TTGAGATGGAATGGAGATGATGG - Intronic
1121118877 14:91363405-91363427 TGGAAAAAGAATGCAAAGGCCGG - Intronic
1121497457 14:94403977-94403999 TAGAATAAGAATGGAGAAGGAGG + Intergenic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121907777 14:97763105-97763127 TTGAAACCAAATGGAAAGGATGG + Intronic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1122595093 14:102885049-102885071 CTGAGAAAGAAGGGAGTGGAGGG - Intronic
1123494086 15:20806857-20806879 TTAAAAAAGACTGGAGAAAATGG + Intergenic
1123550584 15:21375939-21375961 TTAAAAAAGACTGGAGAAAATGG + Intergenic
1123977372 15:25566066-25566088 TTGACAAGGAAAGGAGAAGACGG - Intergenic
1124634257 15:31354806-31354828 TTCAAAACAACTGGAGAGGACGG - Intronic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1124773902 15:32569327-32569349 TTGAAACAGTATTGAGAGGTGGG + Intergenic
1124867111 15:33503331-33503353 TTGCCAAAGAAGGGAGAGGAAGG - Intronic
1124886543 15:33692706-33692728 TGGACAAAGAATGGAGTGGCAGG + Intronic
1125866793 15:43058671-43058693 TAGAAAAAGAATGAAAAGGTTGG - Intronic
1126102100 15:45124807-45124829 TCAAAAAAGATTGGAGAGGCCGG - Intronic
1126193881 15:45909880-45909902 TTGAAAAAAAAAGGAGTGGTAGG - Intergenic
1126276628 15:46891241-46891263 TACAAAATGAATGGAGATGATGG + Intergenic
1126352951 15:47764215-47764237 TTGAAAAAGTATTCAAAGGACGG + Exonic
1126371407 15:47950926-47950948 GAGGAAAAGAATGGAGAAGATGG - Intergenic
1126502199 15:49358190-49358212 TTGAATAGGAGTGGTGAGGAGGG - Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126744691 15:51814150-51814172 TTGACTAAGAATTGAGGGGAGGG + Exonic
1127369184 15:58321074-58321096 ATGAAATAGAATTGAAAGGAGGG + Intronic
1127395930 15:58543989-58544011 TTGAGAAAGAATGGGGATAATGG + Intronic
1127400643 15:58582103-58582125 TTAAAAAAAAAAGAAGAGGAGGG + Intergenic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127597079 15:60496089-60496111 TTGAAAAACGATGGATAGGAGGG - Intronic
1127606020 15:60589704-60589726 TTGACAACTAATGCAGAGGAAGG + Intronic
1127707459 15:61561447-61561469 TTGAAATTGAAGAGAGAGGAGGG - Intergenic
1127771918 15:62239171-62239193 GGGACAAAGCATGGAGAGGAGGG + Intergenic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1128850044 15:70945100-70945122 GTGAAGAGGAATGGAGAGGAGGG - Intronic
1129469964 15:75747517-75747539 TGGTAGAAGAAAGGAGAGGATGG + Intergenic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1130184458 15:81666637-81666659 TTCAGAAAAAAAGGAGAGGAAGG - Intergenic
1130708946 15:86260526-86260548 ATTAAAAAGAAAGGAAAGGAAGG - Intronic
1130788679 15:87128155-87128177 TGGAATAAGTATGGAGAGCAGGG - Intergenic
1130943978 15:88536926-88536948 TAGAAAAAGACTGGAAAGCAGGG + Intronic
1131081512 15:89540325-89540347 CAAAAAAAGAATGGTGAGGAGGG + Intergenic
1131315329 15:91330866-91330888 TTAAAAGGGAATGGAGAGCAAGG - Intergenic
1131579966 15:93633640-93633662 TTGCTAAAGAATGGAGAGCTGGG - Intergenic
1131666748 15:94579205-94579227 TTAAAAAAGAATAGAAAGAAGGG - Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131849242 15:96521003-96521025 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1202958927 15_KI270727v1_random:103193-103215 TTAAAAAAGACTGGAGAAAATGG + Intergenic
1133470344 16:6069100-6069122 GAGAAAAAGAAGGGAGAGGCCGG + Intronic
1133562400 16:6962246-6962268 TTGTAAGAGAAAGGAGAGGGAGG - Intronic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1134795864 16:17036206-17036228 TGGTAACAGGATGGAGAGGAGGG + Intergenic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135230255 16:20699636-20699658 TCGGAAAAGAATGGAGACGGGGG + Intronic
1135269326 16:21055350-21055372 TTGAAAAAGAAATGACAGGCCGG - Intronic
1135745309 16:25011873-25011895 TTGAAAATGAAGGCAGAGAAAGG + Intronic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135894427 16:26386014-26386036 TTGAAAAACACTGGAGAGAAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136730864 16:32411134-32411156 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1136899784 16:34022759-34022781 TTGAAAAGGAGTGGTGAGGGAGG - Intergenic
1137224225 16:46487035-46487057 TTGAATAGGAATGGAGAGAGTGG - Intergenic
1137381669 16:48004978-48005000 TGGAAAAGCAATGGGGAGGAGGG + Intergenic
1137574326 16:49588592-49588614 GGGAAAGAGAATGTAGAGGATGG - Intronic
1137729787 16:50680986-50681008 TTCAAAAGGAATGGAGGTGATGG + Intronic
1137831647 16:51549242-51549264 TTTAAGAATAATGGACAGGATGG - Intergenic
1138110505 16:54320112-54320134 TTGAAAAAGAATCTATAGCAGGG - Intergenic
1138157914 16:54722843-54722865 GTGAAGAAGAATGGAGAGAGAGG + Intergenic
1138333936 16:56237441-56237463 CTGAAAGAGAAAGGAGAGGAAGG + Intronic
1138755020 16:59473750-59473772 TTGAATAAGAATGGTGAGAGTGG - Intergenic
1139088039 16:63612931-63612953 TTCAAAAACAATGGAGATTATGG - Intergenic
1139204964 16:65019405-65019427 TGGGAAAAGAAAGGAGAGAAAGG - Intronic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139289296 16:65842907-65842929 ATCAAAAAGAATTGAGAGCAGGG + Intergenic
1140126580 16:72123387-72123409 TGGAAATAAGATGGAGAGGAGGG - Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140130219 16:72153893-72153915 TGGTAATAGAATGGAGAAGATGG + Intronic
1140163736 16:72527332-72527354 TTGAATAGGAGTGGTGAGGAGGG + Intergenic
1140623441 16:76763940-76763962 TTGAATAAGAGTGGAGAGAGAGG - Intergenic
1140786476 16:78347201-78347223 TGGAAAGAGAATGGAGGGGGCGG - Intronic
1140948855 16:79796725-79796747 TGCAAAAAGAAAGGAGAAGAAGG - Intergenic
1141046246 16:80718620-80718642 TGGAAAAAGAATGCAGCTGAAGG + Intronic
1141095899 16:81162967-81162989 TTGAAAAAGAAGACAGAGGCTGG + Intergenic
1141320378 16:83002969-83002991 TTGCAAAAGCCTGGAGAGGTAGG + Intronic
1141474078 16:84260406-84260428 TTAATAAGGAAAGGAGAGGATGG + Intergenic
1141755899 16:85990640-85990662 TTGGAACAGAATGGAGACGAAGG + Intergenic
1142371532 16:89685678-89685700 GTGAAAGAGATTGGAGAGGCAGG + Intronic
1202995533 16_KI270728v1_random:106135-106157 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1203022220 16_KI270728v1_random:418477-418499 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
1142979917 17:3665758-3665780 AAAAAAAAGAAAGGAGAGGAAGG + Intronic
1143038975 17:4018417-4018439 TTAAAAAAAAAAGGAGAGAAGGG - Intronic
1143638696 17:8182521-8182543 TTCAAAAAGAGGGGAGGGGAGGG + Intergenic
1144247024 17:13376907-13376929 TTGAAACAGACTGAAGAAGATGG - Intergenic
1144377199 17:14656241-14656263 TTGAAAAATCAGGGAGAGAAAGG - Intergenic
1144698566 17:17322121-17322143 TAGAGCAGGAATGGAGAGGATGG + Intronic
1144937128 17:18908889-18908911 TTGAAAAGGAAAGGAAAGGGAGG - Intronic
1145340428 17:21949615-21949637 ATGGAAAAGAATGGAATGGAAGG + Intergenic
1145704346 17:26858293-26858315 TTGGAAATGAATGGAATGGAAGG + Intergenic
1145707518 17:26936490-26936512 ATGAAACGGAATGGAAAGGAAGG + Intergenic
1146077025 17:29740410-29740432 AAGAAAAAGAATAGACAGGAAGG - Intronic
1147641248 17:42001824-42001846 ATGGAGAAGAATGGAGAGGGAGG - Intronic
1148171972 17:45529064-45529086 TTCAAAAACAATGGAGATGCTGG + Intergenic
1148344224 17:46892688-46892710 TTGAAGGAGAGAGGAGAGGAGGG - Intergenic
1148364046 17:47039500-47039522 TTCAAAAACAATGGAGATGCTGG - Intronic
1148760135 17:49995390-49995412 GGGAAAAAGAAGAGAGAGGAGGG - Intergenic
1148780770 17:50120338-50120360 AAGAAAAAGAGGGGAGAGGATGG + Intronic
1149101889 17:52917139-52917161 TTAAAAAAAAATAGAAAGGAAGG - Intergenic
1149385222 17:56136339-56136361 TTGGAAAAGAAAGGAGACTAAGG + Intronic
1149424907 17:56545777-56545799 TAGGAAAATAATGGCGAGGAGGG - Intergenic
1149892096 17:60399304-60399326 CAGAAAAAAAATGCAGAGGAAGG + Intronic
1150000023 17:61429145-61429167 TTTAAAAAGAATGCACAGGTAGG - Intergenic
1150205526 17:63402817-63402839 TTCTAAAAGAAAGGAGATGAAGG - Intronic
1150368921 17:64618810-64618832 TAGAAAAAGAAGGTAAAGGAAGG - Intronic
1151157073 17:72132600-72132622 GGGAATAAGAATGGAGAGGATGG + Intergenic
1151190428 17:72394101-72394123 CTGAAACAGACTGGAGAGGAAGG - Intergenic
1151199446 17:72456895-72456917 TTAAAAGAGAATTGAGAGGCAGG - Intergenic
1151757843 17:76084862-76084884 ATGAGAAAGAAAGGAGTGGAGGG + Intronic
1151998188 17:77625402-77625424 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
1152024041 17:77797190-77797212 TGGAAAAAGAATGGAGGGGCAGG - Intergenic
1152523498 17:80874090-80874112 TTGAAAAAGATTGAAAAAGATGG + Intronic
1153884612 18:9452504-9452526 TGGATAGAGAATGGAGAGAAAGG + Intergenic
1154037527 18:10818286-10818308 TTTAAAAGGAATTGAGGGGAAGG + Intronic
1155396288 18:25390096-25390118 TAGAAAAAGAATGGAAAGGTGGG + Intergenic
1155535723 18:26815221-26815243 TTTCAAAAGATTGAAGAGGACGG - Intergenic
1156277545 18:35598042-35598064 TTGAAAAAGAAGAGAAGGGAGGG - Intronic
1156468489 18:37362704-37362726 TTGACACAGGATGGGGAGGAAGG - Intronic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156654172 18:39263901-39263923 TTGAATAGGAGTGGAGAGGAAGG - Intergenic
1156885896 18:42135533-42135555 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1157055651 18:44225568-44225590 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157353502 18:46912692-46912714 TTGAAAAAATATAGAGAGAAAGG + Intronic
1157386898 18:47264944-47264966 TTGAAAAAGAAATAAAAGGAAGG - Intergenic
1158186576 18:54778701-54778723 TGGAAGAAGAATGGAAAGGAAGG - Intronic
1158372766 18:56828510-56828532 TTGAAAAATAATAGACAAGACGG + Intronic
1158499059 18:57983547-57983569 AAGAAAAAGAAGGGAGAGGGAGG + Intergenic
1158623676 18:59053386-59053408 TTGGAAAAGAATGCAGAAGAAGG - Intergenic
1158748882 18:60235514-60235536 TGGGAAAAGAATGAATAGGATGG - Intergenic
1159857820 18:73610387-73610409 TTGGGAAGGAAAGGAGAGGAAGG - Intergenic
1160134558 18:76261440-76261462 TTGAAAAGGAATGTAAAAGAAGG + Intergenic
1160290038 18:77583937-77583959 TTGAGAAAAAATGGAGGTGATGG + Intergenic
1160999177 19:1900858-1900880 AAGAAAAAGAAGGGAAAGGAGGG + Intergenic
1161805200 19:6439530-6439552 TTGAAAAAAAATACAGAGGCCGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162187567 19:8917772-8917794 TTGACAAAGAGTGGAAAGGAAGG - Intronic
1162266685 19:9581403-9581425 TAGAAGAAAAGTGGAGAGGAAGG + Intronic
1162476477 19:10903302-10903324 TTGAAAAAGAATGAAGTTGGAGG - Intronic
1162488258 19:10975603-10975625 TCAAAAAAGAATTGAGAGGCTGG - Intronic
1162762078 19:12894470-12894492 TTGTAAAAAAAAGGAGAGAAGGG + Intronic
1163646812 19:18494236-18494258 TTTAAAAAGAGGGGAGGGGAAGG + Intronic
1163912858 19:20213226-20213248 TAGAAAATGAATGCAGAGGCTGG + Intergenic
1164135224 19:22408396-22408418 TTCAATAAGAATGGTGAGAAAGG - Intronic
1164426706 19:28148024-28148046 TTGAAAATGAATGGACATTATGG + Intergenic
1164444333 19:28304153-28304175 TTGAAACAGAAGGTAGAGGTAGG + Intergenic
1164523392 19:28995864-28995886 TTAAAAAAAAATGAAGAGGGGGG + Intergenic
1164644728 19:29850062-29850084 TAGAACAAAAATGCAGAGGAAGG + Intergenic
1165674542 19:37710162-37710184 TTAAAAGAAAATGGAGTGGATGG + Intronic
1166018088 19:39998489-39998511 TTGGAGAAGATTGGAGAAGATGG - Intronic
1166297611 19:41896711-41896733 TGAAAAAAGGAAGGAGAGGAAGG - Intronic
1166461170 19:42989920-42989942 TCCAAAAAGAATGGAAAGCAGGG + Intronic
1166478463 19:43149898-43149920 TCCAAAAAGAATGGAAAGCAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167153948 19:47726672-47726694 TTAAAAAAGAAGGAAGAAGAGGG - Intronic
1167308942 19:48725283-48725305 AAGAAAAAGAATGGAGAGTCAGG + Intronic
1167407309 19:49320967-49320989 TTCCAAAAAATTGGAGAGGAGGG + Intronic
1167534973 19:50044168-50044190 GTGATAAAGAGAGGAGAGGAAGG + Intronic
1167740193 19:51320154-51320176 TTTAAAGAGAATGGAGAGAGGGG - Intronic
1167799201 19:51729472-51729494 GGAAAAAAAAATGGAGAGGAAGG + Intergenic
1168155230 19:54470481-54470503 AAGAAAAAGAAAGGAAAGGAAGG + Intronic
1168464934 19:56594819-56594841 TGGAAGAAGGATGGAGGGGAAGG - Intergenic
1168656672 19:58134271-58134293 TTGAAAAACATTGTAGAGGGAGG + Intronic
925579195 2:5393132-5393154 TAGAAAAAGAAAGGAGAGAGGGG - Intergenic
925690114 2:6513339-6513361 TTGAAAAAGAAAAGAAAGGTAGG - Intergenic
926505111 2:13704479-13704501 TTGGAAAAGAATGGAGTGGTTGG + Intergenic
926775732 2:16420695-16420717 ATGGAACAGAATTGAGAGGAAGG + Intergenic
927018963 2:18997812-18997834 TTGAAATTCAATGGAGAGCAAGG - Intergenic
927492909 2:23532391-23532413 TTGAAGCAGAATGGAGACGGTGG + Intronic
927746390 2:25625751-25625773 TGGCTAAAGAAGGGAGAGGAAGG - Intronic
928250010 2:29667821-29667843 TTCAAAAAAATTGAAGAGGAGGG - Intronic
928357107 2:30627402-30627424 AGGAAACAGAATGTAGAGGAGGG - Intronic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
928635208 2:33238690-33238712 TCTAAAAAGGATGGAGAGGATGG - Intronic
929195593 2:39181236-39181258 TTGAAAAGGAGTGGCCAGGAGGG - Intronic
929223020 2:39484855-39484877 TTGAAAAATAAAGGAAATGAAGG - Intergenic
929325490 2:40605695-40605717 TTAAAAAAAAATGGAGTTGAGGG + Intronic
929654814 2:43720143-43720165 TGGATAAAGAAGGGAGTGGAGGG - Intronic
929732465 2:44510636-44510658 TTTAAAAAGAATGTAGGCGATGG - Intronic
929806198 2:45147422-45147444 TTGAAAACGAGTGGTGAGAATGG - Intergenic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
930030432 2:47055357-47055379 TTGAAGAAGGGAGGAGAGGAGGG - Intronic
930042398 2:47137025-47137047 TTGAAAAGGAATGGTGAGAGAGG + Intronic
930180220 2:48348557-48348579 TTGCAAAAGAATGGCAGGGACGG + Intronic
930248258 2:49006818-49006840 TTGAGAAAGGATGGAAGGGATGG - Intronic
930289984 2:49481580-49481602 TTGAAAAAAAAATGAGACGAAGG + Intergenic
930323981 2:49890009-49890031 GAGAAAATGAATAGAGAGGAAGG - Intergenic
930486178 2:52014161-52014183 TTGAAGAGGAATGGTGAGAATGG + Intergenic
930731909 2:54735976-54735998 TGGAAAAAGAATGGGGAAGGAGG + Intronic
930749930 2:54924857-54924879 TTGAAAAAAAAAGAAGAGGCTGG - Intronic
931919664 2:67000016-67000038 TTTAAAAATAATGGAGGTGATGG - Intergenic
931977819 2:67662682-67662704 TTGAAGAATACTGGAGAGGTAGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932745731 2:74331938-74331960 TTGAAAAGAAGAGGAGAGGAGGG - Intronic
933884271 2:86703320-86703342 TTGGAAAATCATGGAGAGGAGGG + Intronic
934195857 2:89837106-89837128 TTGGAATGGAATGGAGTGGAAGG + Intergenic
934555363 2:95284320-95284342 TTAAAAAAAATTGTAGAGGAGGG - Intronic
934757857 2:96837156-96837178 TTGAAAAAGAATAGAGTGAGAGG - Intronic
935209591 2:100927359-100927381 TAGAAAAAGAATGGAGTGCCAGG - Intronic
935344218 2:102090128-102090150 TTGAAAAAAAAAGGATAGGCTGG - Intronic
935429890 2:102964512-102964534 TGGAAAAATAATGAAGAGGTTGG - Intergenic
935442091 2:103111125-103111147 TTGAAAAGGAACAGATAGGATGG + Intergenic
935517853 2:104065670-104065692 TTGAAAAAGAATAAAGTTGAAGG + Intergenic
935632869 2:105226362-105226384 TTGTAAAAGAATGGACAGAGAGG + Intergenic
936017974 2:108973988-108974010 TGGAGAATGAATGGACAGGATGG - Intronic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936588374 2:113779108-113779130 TTAGAAAAAAATAGAGAGGAGGG + Intergenic
936633600 2:114231382-114231404 TTCGAATAGAATGGAGAGGCAGG - Intergenic
936673845 2:114691102-114691124 TTGAATAAGAGTGGTGAGAAAGG + Intronic
936719359 2:115232015-115232037 ATGAGAAAGGCTGGAGAGGAAGG - Intronic
937013123 2:118579578-118579600 TTGAAAAACACTGGAGAGTTTGG + Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937194885 2:120144637-120144659 TTCAAAAAGATAGAAGAGGAAGG + Intronic
937619608 2:123970675-123970697 AAGAAAAAGAAGGGAAAGGAAGG + Intergenic
937868299 2:126770145-126770167 TTGAAAGAGAAGGCAGAGGAGGG - Intergenic
938182919 2:129199900-129199922 TTGTTAAAGAATGGTAAGGAAGG - Intergenic
938214122 2:129493796-129493818 AAGAAAAAGAATGAAGAAGAAGG + Intergenic
938267262 2:129937397-129937419 TTAAAAAAAAATAGAGATGAGGG + Intergenic
939047394 2:137265899-137265921 TTGGAGAGGAATGGATAGGATGG - Intronic
939318019 2:140577940-140577962 TTGAAAGAGATTAGAGAGGAAGG - Intronic
939474650 2:142672137-142672159 TTGATAAAGGATTGAGATGATGG - Intergenic
939549706 2:143599031-143599053 TTGGAAAGGAAGGGAGAGTAGGG + Intronic
939592917 2:144087906-144087928 TTGAATAAGAATGGAGAAATTGG - Intronic
939887793 2:147700090-147700112 TGGAGAAAGGAAGGAGAGGAAGG - Intergenic
940221756 2:151359993-151360015 CTGAAAAAGAAGGGAAAGGAAGG + Intronic
940368466 2:152875184-152875206 TTAAAAAAGAATTTAGAGAATGG - Intergenic
940577978 2:155538370-155538392 TTGAAAAAGGATAAAGATGAAGG - Intergenic
940719267 2:157263366-157263388 GTGCAAGAGAATGGTGAGGATGG - Intronic
940727371 2:157349696-157349718 TTGAAAAAGAAATGGGAGGCAGG - Intergenic
940790525 2:158026050-158026072 ATGAAGAAGGCTGGAGAGGAAGG - Intronic
941146218 2:161849438-161849460 TTGAATAAGAATGGTGAGAGTGG + Intronic
941265933 2:163362420-163362442 TTGAAAAGGAATGGTGAGAGGGG + Intergenic
941331955 2:164189183-164189205 TTGAAAAAAAATGGAAGGTATGG + Intergenic
941413849 2:165194245-165194267 GTAAAAAAGAAGGGAGAGGTGGG + Intronic
941515318 2:166466680-166466702 GTGAAAAAGAAAAGGGAGGAGGG - Intronic
941647025 2:168051608-168051630 TTAAAAAAGAGTAGAGTGGAGGG - Intronic
941719831 2:168801179-168801201 TGCAACAAGAGTGGAGAGGAGGG - Exonic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942847134 2:180440579-180440601 CTGAAAAGCAATGGGGAGGAGGG - Intergenic
943163154 2:184281274-184281296 TTGAAAAGGAATGGTGAGAGAGG + Intergenic
943339287 2:186658681-186658703 TTGAGAAGGAATGCAGAGGGAGG + Intronic
943382323 2:187166494-187166516 TTGAAAAAGAAAGCAAAGAAGGG - Intergenic
943475587 2:188351115-188351137 TAGAAAAATAATTCAGAGGATGG + Intronic
943557514 2:189423821-189423843 TTCCAAAAAATTGGAGAGGAGGG + Intergenic
943618298 2:190118821-190118843 TTGAATAGGAATGGTGAGAAAGG - Intronic
944186463 2:196954263-196954285 TTGACAAAGAAAGGGGAAGATGG + Intergenic
944546357 2:200802765-200802787 TAGCAAAAGAATGGAAAGCAAGG + Intergenic
945275325 2:207982267-207982289 TTGAGAAAGAAAGAAAAGGAAGG - Intronic
945359159 2:208875725-208875747 TTGAATAAGACTGGTGAGGGTGG + Intergenic
945430592 2:209759110-209759132 TTGAATAAGAGTGGTGAGAATGG - Intergenic
945472596 2:210244643-210244665 TTGACAAAGAGTGGTGAGAAGGG + Intergenic
945480854 2:210343965-210343987 TTGAAAAGGAATGGTGAGAGTGG + Intergenic
945566564 2:211407912-211407934 ATGAAACAGAATGGAGAAGATGG - Intronic
945691507 2:213042348-213042370 TACAAAGAGAATGGAGAGGCAGG - Intronic
945822635 2:214683779-214683801 TAGAAAAACAATAGAGAGGGAGG + Intergenic
946082275 2:217132064-217132086 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946537389 2:220646610-220646632 GTCAAAAAGAAAGGAGAGGAAGG - Intergenic
946669587 2:222088603-222088625 TTGAAATTGAAGGGGGAGGAGGG + Intergenic
946768559 2:223063284-223063306 GTGAGAAGGACTGGAGAGGAAGG + Intronic
946779602 2:223179316-223179338 TTTAAAAAAAATGGAGAAAAGGG + Intronic
947046261 2:225990081-225990103 TAGAGAATGAATGGACAGGAGGG + Intergenic
947388864 2:229619932-229619954 TTCAAAAACAAAGGTGAGGATGG - Intronic
947400324 2:229725178-229725200 GAGAGAAAGAAGGGAGAGGAAGG + Intergenic
947561888 2:231161732-231161754 TTGAGAAAGAATGGTGAGAGAGG + Intronic
947772983 2:232685652-232685674 TTTAAAAAGAAGGAAGAGAATGG + Intergenic
947841340 2:233209664-233209686 TGGAAAAAGAATGGAAATGCAGG - Intergenic
947877557 2:233477787-233477809 TTTAAAAAGTACGGAAAGGAAGG - Intronic
947955915 2:234191262-234191284 GTGAAAGAGAAAGGAGAGGGAGG + Intergenic
947963758 2:234261336-234261358 TAGAAAGTGAATGGACAGGAGGG - Intergenic
948216096 2:236234059-236234081 ATGAAACAGAATAGAGATGAAGG + Intronic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
948584156 2:239008292-239008314 ATGAAGGAGGATGGAGAGGAAGG - Intergenic
949007876 2:241660330-241660352 AAGAAACAGAATGGAGAGGCAGG - Intronic
1169133336 20:3179618-3179640 TTGAAAAAGAATAGAGGGGCTGG - Intergenic
1169393355 20:5208175-5208197 AGGAAAAGGAAGGGAGAGGAGGG - Intergenic
1169686459 20:8279159-8279181 TTGCAAAAGAATTGAAAGCAGGG + Intronic
1170161466 20:13316888-13316910 TTGAAAAGGAATGGTGAGAAGGG - Intergenic
1170291236 20:14771104-14771126 TAGAACAAAAATGTAGAGGAAGG + Intronic
1170379984 20:15747833-15747855 TTGAAAAAGAGTGGTGAGAGGGG + Intronic
1170851766 20:20011319-20011341 TTAAAAAAGAAAGGAAGGGAAGG - Intergenic
1170862374 20:20119154-20119176 TTCAAAAAAATTGAAGAGGAGGG - Intronic
1170876432 20:20254139-20254161 GGGGAGAAGAATGGAGAGGAGGG - Intronic
1170978171 20:21186016-21186038 ATGAAAAATAATGGAAAGTATGG + Intronic
1170978211 20:21186519-21186541 ATGAAAAATAATGGAAAGTATGG - Intronic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171367589 20:24636625-24636647 TTGACAAGGAAAGGAGATGATGG + Intronic
1172219349 20:33262361-33262383 ATGAAAGAGAAAGGAGAAGAGGG + Intergenic
1173008756 20:39161563-39161585 TTCAAAAAAACTGAAGAGGAAGG - Intergenic
1173067977 20:39732608-39732630 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1173079998 20:39856903-39856925 ATGAAAAATAAGGGAGAGGAAGG - Intergenic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173391300 20:42636813-42636835 TTAAAATAAAATGGAGATGAAGG + Intronic
1173481460 20:43403456-43403478 TTGAACAAGAGTGGTGAGAAAGG + Intergenic
1173487747 20:43454124-43454146 CTAAAAAAGAAAGGAGAGAAAGG - Intergenic
1173644327 20:44624170-44624192 GTGAGAAGGAATGGAGAGGCTGG - Intronic
1173712187 20:45168629-45168651 TTCCAAAAAACTGGAGAGGAGGG + Intergenic
1173827779 20:46058383-46058405 CGGAAAAGGACTGGAGAGGAGGG - Intronic
1174264599 20:49322267-49322289 TTGGAAATGATTGGTGAGGATGG + Intergenic
1174694301 20:52541971-52541993 TTGGAAAAGACAGGAGATGAGGG - Intergenic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174908732 20:54582392-54582414 TTCAAAAAAACTGAAGAGGAAGG - Intronic
1174911866 20:54616678-54616700 TTGTGAAAAACTGGAGAGGAAGG - Intronic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1174965240 20:55206169-55206191 TTGAATAGGAATGGTGAGAATGG + Intergenic
1175000104 20:55618436-55618458 TTGAAAAGGAGTGGTGAGAATGG + Intergenic
1175038464 20:56022749-56022771 CAGCACAAGAATGGAGAGGAGGG - Intergenic
1176528051 21:7936305-7936327 CTGAAATAGAATGGATTGGAAGG - Intergenic
1176528724 21:7941566-7941588 ATGGAAAAGAATGGAATGGAAGG - Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1176865727 21:14053734-14053756 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
1176940471 21:14917912-14917934 TTTAAAATGCCTGGAGAGGAGGG - Intergenic
1176997563 21:15574473-15574495 TTGAAAAATGATGAAGGGGATGG + Intergenic
1177000910 21:15611590-15611612 TTGAAAAGGAGTGGTGAGGAGGG - Intergenic
1177749133 21:25257748-25257770 TTGATAAATAAAGGACAGGATGG - Intergenic
1177811267 21:25927095-25927117 TTGAAAAAGAATGAATTCGACGG + Intronic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178331540 21:31699030-31699052 TTGAAAAAGAGTGAAGTGGGAGG + Intronic
1179076086 21:38123132-38123154 TAGAAGAAAAACGGAGAGGAAGG - Intronic
1179137777 21:38695803-38695825 TTGATAAAGAATGGAGTGGGTGG + Intergenic
1180541610 22:16453998-16454020 TTGAATAAGAATGGTGAGAGAGG - Intergenic
1182172574 22:28247706-28247728 TTGACAAAGAAGGCAGAGAAAGG + Intronic
1182405755 22:30128301-30128323 TGAAAAAATACTGGAGAGGATGG - Intronic
1182551971 22:31105456-31105478 CTGCCACAGAATGGAGAGGAGGG - Intronic
1182665039 22:31951837-31951859 CTTAAAAGAAATGGAGAGGAGGG + Intronic
1182676133 22:32041479-32041501 TGGGAAAAGAAAGGAAAGGATGG - Intergenic
1182742671 22:32579942-32579964 GTGAAATTGAATGGAGGGGAAGG + Intronic
1182803084 22:33047965-33047987 TGGAAAAAGAATGGAGTTGAAGG - Intronic
1182859448 22:33546563-33546585 TAAAAAAAGAATGGATAAGATGG - Intronic
1184012861 22:41762379-41762401 TACAAAAGGAAAGGAGAGGAAGG - Intronic
1184975696 22:48060165-48060187 TTAAAAAAAAAAGGAGAAGAAGG + Intergenic
1185096886 22:48813315-48813337 AAGGAAAAGAATGGAGTGGAGGG + Intronic
1203296904 22_KI270736v1_random:49839-49861 TAGGAAAGGAGTGGAGAGGAGGG + Intergenic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
1203297507 22_KI270736v1_random:53635-53657 ATGGAAAGGAATGGAGTGGAAGG + Intergenic
1203297832 22_KI270736v1_random:55629-55651 GTGGAAAAAAATGGAGTGGAGGG + Intergenic
1203298104 22_KI270736v1_random:57638-57660 TTGAAAAGGAAAGGAATGGAAGG + Intergenic
1203300431 22_KI270736v1_random:73336-73358 GTGGAAAGGAATGGAGTGGAGGG + Intergenic
1203303277 22_KI270736v1_random:92025-92047 GTGTAAAGGAATGGAGTGGAAGG + Intergenic
1203309912 22_KI270736v1_random:135500-135522 ATGGAATAGAATGGAGTGGATGG + Intergenic
1203312365 22_KI270736v1_random:151707-151729 ATGGAATGGAATGGAGAGGAGGG + Intergenic
949108641 3:231299-231321 GTAAAAAAGAGAGGAGAGGAAGG - Intronic
949501572 3:4685000-4685022 TGGAAAAAGATTGCAGAGGGTGG - Intronic
949561545 3:5207326-5207348 TTAAAAAAGAAAGAAAAGGAGGG - Intronic
950062744 3:10085684-10085706 TGAAAAAAGAATTGAGAGGTCGG - Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951123752 3:18959843-18959865 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
951221807 3:20076514-20076536 TTCAAAAAGCACGGAAAGGAGGG - Intronic
951722400 3:25714234-25714256 TTGGAAAATAATGTAGAGCATGG + Intergenic
951850481 3:27134055-27134077 TAGAGAAAGAAAAGAGAGGAAGG + Intronic
952043732 3:29291966-29291988 CTGAATAAGATTGGAGAAGATGG - Intronic
952215520 3:31274265-31274287 TAAAAAGAGAAGGGAGAGGATGG - Intergenic
952474050 3:33686962-33686984 TTAAAAAAGAAGAGAGAGGGTGG - Intronic
952841925 3:37653689-37653711 GTGAGAAAGACAGGAGAGGAAGG - Intronic
953422710 3:42767010-42767032 TTGAAAGAGAGTAGAGAGAAGGG - Intronic
954411661 3:50373848-50373870 TGAGGAAAGAATGGAGAGGAGGG + Intronic
954615078 3:51965386-51965408 TTGACAGAGAGTGGGGAGGATGG - Intronic
955182020 3:56681997-56682019 TTTGAAAAGAATGGAAAGGTAGG - Intronic
955192259 3:56772246-56772268 GGGAAAAGCAATGGAGAGGAAGG + Intronic
955636771 3:61038717-61038739 GAGAAAAAGAAAGGAGGGGAGGG + Intronic
957433068 3:80138830-80138852 TTGAAGGGGAAGGGAGAGGAGGG + Intergenic
958022270 3:88011876-88011898 TTGAAAAACAATGGTGAGTCAGG - Intergenic
958025960 3:88049560-88049582 TTTAAAAAGTTTGGAGAGGCAGG + Intergenic
958612385 3:96444090-96444112 TTGCAAAAGAATGGACAGAGAGG + Intergenic
958624162 3:96603373-96603395 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
958825883 3:99030422-99030444 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
958884566 3:99711435-99711457 TTGAAAAAGAAAGGCGAGAATGG - Intronic
959089220 3:101884642-101884664 AGGAAGAAGGATGGAGAGGAAGG + Intergenic
959163798 3:102751145-102751167 TTTAAAAAATATGGATAGGATGG + Intergenic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
959679951 3:109083618-109083640 TTCAAAAAAACTGAAGAGGAAGG + Intronic
959714319 3:109416364-109416386 TTGAAGAAGAAAGGAAATGAGGG + Intergenic
959795884 3:110427873-110427895 CCAAAAAAGAATGGAGAAGAAGG - Intergenic
959995066 3:112671488-112671510 TTCAAAAAGAAAGGAGTGGCTGG - Intergenic
960240723 3:115338870-115338892 TTGAAAATGAATAGAGGGGGTGG - Intergenic
960488694 3:118283584-118283606 TTAAAAAAAAATGTAGAGGTGGG - Intergenic
960812444 3:121637491-121637513 TTGAAGAAGAAGGGAGAAAATGG - Intronic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961166281 3:124766096-124766118 TTGAAACTGCAGGGAGAGGAGGG - Intronic
961497900 3:127307424-127307446 TTGAAACATAAGGGAGAGGAAGG - Intergenic
962215098 3:133514301-133514323 TAGAAAAAAAAGGCAGAGGAAGG + Intergenic
963026508 3:140924414-140924436 TGGAAAAACAAATGAGAGGAGGG - Intergenic
963091179 3:141485557-141485579 ATGACAGAGAATGGAAAGGAAGG + Intergenic
963113219 3:141703453-141703475 TTGAAAAGGAATGGTGAGAGTGG - Intergenic
963929188 3:150984454-150984476 TTTCCAAAAAATGGAGAGGAAGG - Intergenic
964119141 3:153163579-153163601 TGGAAAAAAAATGGGGGGGAAGG + Exonic
964285216 3:155110156-155110178 TTGAAAAGGACTGGAAAGGAGGG + Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964609434 3:158595438-158595460 TTGAACATGAATTGAGAAGAGGG + Intronic
964995381 3:162871942-162871964 TTGAAAAGGAATGGTGAGAGAGG - Intergenic
965085932 3:164098248-164098270 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
965325335 3:167295886-167295908 TTCCAAAAGATTGAAGAGGAGGG + Intronic
965397779 3:168181050-168181072 AAGAAAAAGAACGGATAGGAAGG - Intergenic
965536780 3:169831623-169831645 TGAAAAAAGAATGGAGAGAGTGG + Intronic
965688631 3:171332078-171332100 TTGGAAAAGTATAGAGAAGACGG + Intronic
965722846 3:171680528-171680550 TAGAAAAAGACAGGAGAGGCCGG - Intronic
965939775 3:174165236-174165258 TTGAATAGGAATGGTGAGAATGG + Intronic
965959351 3:174410167-174410189 TTGAAATGGAAAGGAGAGGAAGG - Intergenic
966175786 3:177136578-177136600 TTGATTAAAAATTGAGAGGATGG - Intronic
966341127 3:178925924-178925946 TTGAATAAGAATGGTGAGAGAGG - Intergenic
966363562 3:179156197-179156219 TTGGAAAAGAATGGAGTGGAAGG + Intronic
966544801 3:181134972-181134994 GTGAAGAAAAGTGGAGAGGAAGG + Intergenic
966654727 3:182342909-182342931 TTGTAAAAGAATGGAAAGAAGGG - Intergenic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
966836872 3:184056094-184056116 TTAAAGAAGAATGGAAAGGGTGG + Intronic
966838376 3:184067594-184067616 TTCAAACACAAAGGAGAGGAAGG + Intergenic
967006234 3:185385525-185385547 TCCAAAAAAAATGAAGAGGAGGG + Intronic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
967676479 3:192305054-192305076 TTAACAGAGAAGGGAGAGGAAGG + Intronic
968107357 3:196011033-196011055 TTGAATAAAAAAGGAAAGGAGGG + Intergenic
969684796 4:8665391-8665413 TTTAAACAGAATGGATGGGAGGG - Intergenic
969839946 4:9873929-9873951 TTTAAAAAGTCTGCAGAGGAGGG - Intronic
969993614 4:11289808-11289830 TTGAATAGAAATGGAGAGCAGGG + Intergenic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970825000 4:20260950-20260972 TTGTAAGAGAATGGAGGAGAGGG - Intronic
970905832 4:21215251-21215273 TTGAAAAAAAAAGGACAGCAAGG - Intronic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971381930 4:26107098-26107120 GTAAAAAAGAATTGAGAGCATGG + Intergenic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
971715458 4:30169800-30169822 ATGAAAAGGAATGAAGAGAAAGG - Intergenic
971727732 4:30335590-30335612 AAGAGAAAGAAAGGAGAGGAAGG + Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
972598549 4:40551571-40551593 TTAAAAAAGAAAGGAAAGGAGGG + Intronic
972796126 4:42421472-42421494 CTGGAAAAAAATGGAGATGATGG + Intronic
973105127 4:46326157-46326179 TTACAAAAGAATGGGGAGGGTGG + Intronic
973181473 4:47274091-47274113 TTGAGAAAAAATGAAGAAGAGGG - Intronic
973267761 4:48228393-48228415 TTCAATAAGATTGGAGAGGCAGG + Intronic
973729744 4:53811592-53811614 TGGACAAAATATGGAGAGGAAGG + Intronic
973801055 4:54479085-54479107 TAAAAAAAAAAAGGAGAGGAAGG - Intergenic
974250730 4:59379361-59379383 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
974333842 4:60514251-60514273 TTGACAGAGAATGGAGAGTGAGG + Intergenic
974537977 4:63193675-63193697 TTAAAAAAGAATTGCCAGGAAGG - Intergenic
974966295 4:68764539-68764561 TTTCAAAAAATTGGAGAGGAGGG + Intergenic
975190521 4:71455491-71455513 AAGAAAAAAAATGGAGAAGATGG + Intronic
975194586 4:71509206-71509228 TTGAATAAGAATGGTGAGACAGG - Intronic
975214116 4:71734247-71734269 TTGAATAGGACTGGAGAGAAAGG - Intergenic
975238423 4:72028670-72028692 TGGAAAAGGAATGCAGAGGTAGG + Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975561351 4:75710988-75711010 TTGAATAGGAATGGTGAGAAAGG - Intronic
975612940 4:76219271-76219293 TTGAACTAGAATGGAGAGCCAGG + Intronic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
975918322 4:79351710-79351732 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
975931640 4:79531194-79531216 TTTAAAAAGATAGGAGAGGAAGG - Intergenic
976025024 4:80676491-80676513 TTCAAAAAAATTGAAGAGGAGGG - Intronic
976105135 4:81608692-81608714 TTGAAAAAGAGTGGTGAGAGTGG - Intronic
976147182 4:82053417-82053439 TTGAAAAAAAATGAAAAGAAAGG + Intergenic
976228945 4:82820490-82820512 TTAGAAAAGAATGGTGAGGTGGG + Intronic
976271339 4:83233538-83233560 TTAAAAAATAATGGAGTGGCAGG + Intergenic
976705177 4:88012527-88012549 TTTAAAAAAAATAGAGAGGCAGG - Intronic
976882584 4:89946911-89946933 ATTAAAAAAAATGGACAGGAAGG + Intronic
976938797 4:90674163-90674185 TTCTAAGAAAATGGAGAGGAGGG + Intronic
977616552 4:99093237-99093259 TTGAAAAGGAATGGTGAGATGGG - Intergenic
977905331 4:102471266-102471288 TTGAATAAGAGTGGAGAGAGTGG - Intergenic
978121694 4:105087476-105087498 CTGAAACAGAATGGAGACAAAGG + Intergenic
978220210 4:106263168-106263190 TTTAAAAAAAATGGATAGAAAGG - Intronic
978354551 4:107857901-107857923 TTTAAAAAGAATGGAAAGCACGG - Intronic
978482585 4:109211018-109211040 TTGAGAGTGAACGGAGAGGAGGG + Intronic
978485355 4:109247341-109247363 CTGAAAAAAAAAGGAAAGGAGGG + Intronic
978624063 4:110664520-110664542 TTGAAAGAGAAGGGTGAGGATGG + Intergenic
978631801 4:110756168-110756190 TTAAAAAAGTATTGAGATGAAGG + Intergenic
978692733 4:111534816-111534838 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
979483413 4:121244239-121244261 TTGTAAAAGAAGGGGGAGAATGG - Intergenic
979647137 4:123083165-123083187 TTGAAAAGGAATGGGCAGAAGGG + Intronic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
979973701 4:127169444-127169466 ATGAAAAGGAATGGAGAAGAAGG - Intergenic
979979533 4:127237550-127237572 TGGAAAAAGAAAGAAAAGGAGGG + Intergenic
980050538 4:128034946-128034968 TTGAAAAGGAATAGACAGGCCGG - Intronic
980289132 4:130823128-130823150 TTAAAAAGGAATAGTGAGGATGG + Intergenic
980608564 4:135125562-135125584 TGGACAAAGAATGGAGATGCTGG - Intergenic
980863372 4:138525621-138525643 TTGAAGAGGAATGGTGAGAATGG - Intergenic
981036429 4:140174318-140174340 TTGAAAAAGAATGAATTGGGAGG - Intergenic
981049646 4:140297547-140297569 GAGAAAGAGGATGGAGAGGAAGG - Intronic
981063472 4:140454144-140454166 TTGAATAGGAGTGGTGAGGATGG + Intronic
981105873 4:140880533-140880555 AAAAAAAAGACTGGAGAGGAGGG - Intronic
981120041 4:141039344-141039366 TAGAGAAAGAAAGGGGAGGAAGG + Intronic
981405283 4:144360543-144360565 TTCAGAATGACTGGAGAGGAGGG + Intergenic
981453731 4:144929637-144929659 TTGAATAAGAGTGGTGAAGAGGG + Intergenic
981576710 4:146213311-146213333 TAAAAAAAAAAAGGAGAGGAGGG + Intergenic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
982290411 4:153775830-153775852 TTGAATAAGAATGGAGAGAGTGG + Intergenic
982374696 4:154677096-154677118 TCGAGAAACAAGGGAGAGGAGGG + Intronic
982526336 4:156483926-156483948 TCCAATAGGAATGGAGAGGAGGG - Intergenic
982542144 4:156687201-156687223 TTGAACAAGAAGGCAAAGGATGG + Intergenic
983161257 4:164418084-164418106 TTGAATACGAATGGTGAGAATGG - Intergenic
983172051 4:164547319-164547341 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
983418583 4:167489193-167489215 TTGAATAAGAATGGTGAGAGAGG + Intergenic
983473842 4:168190767-168190789 TTCCAAAAGACTGAAGAGGAGGG + Intergenic
983499689 4:168484585-168484607 AAGAAAAAGAAAGGAGAGGCTGG - Intronic
983523366 4:168734434-168734456 TTTTAAAAGATTTGAGAGGAGGG + Intronic
983582570 4:169324064-169324086 TTGGACAAGAATGGAGAAAAAGG - Intergenic
983668651 4:170211215-170211237 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
983831580 4:172334761-172334783 TTGAAAAGGAATGGTGAGAATGG + Intronic
983841479 4:172461986-172462008 TAGAAAAAAAAGGCAGAGGAAGG + Intronic
983946737 4:173594426-173594448 TTGATAAATAATCCAGAGGATGG + Intergenic
984085739 4:175309088-175309110 TAGAAAAAAAAAGGAGAAGAAGG - Intergenic
984374633 4:178911955-178911977 TTAAAAAAGAAAGGAAAGGTAGG + Intergenic
984550998 4:181158664-181158686 TTCAAAAAGAACAGAGATGAGGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
985157363 4:187003528-187003550 TTGAATAAGAATGGTGAGAGAGG - Intergenic
985205232 4:187528639-187528661 TTGAAAATGCATGGACAGGCTGG - Intergenic
985911161 5:2884333-2884355 AGGATACAGAATGGAGAGGAAGG + Intergenic
986212740 5:5689573-5689595 TTGACAAAGAAAGGGGAAGATGG + Intergenic
986374119 5:7112831-7112853 ATGGAAAAGAAAGGAAAGGAGGG + Intergenic
986677946 5:10204398-10204420 TTCAAAAAAATTGGAAAGGAGGG + Intergenic
986683155 5:10251417-10251439 TTGACAGAAAATGCAGAGGAAGG + Intronic
987038282 5:14038976-14038998 TTAAAAGAGAATAGAGAGGGAGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987401276 5:17479736-17479758 TTGAAAATGAAGGGAGAAAATGG + Intergenic
987638833 5:20584726-20584748 ATGCAAAAGAATTGAAAGGAGGG + Intergenic
987657234 5:20822399-20822421 ATGAAAAGGAATGGAGAAAAAGG + Intergenic
987767577 5:22253629-22253651 TTGAAAGAGAATGTTGAGAAAGG - Intronic
987862040 5:23501257-23501279 TTCAAAAATATTGAAGAGGAGGG - Intergenic
987956589 5:24749008-24749030 TATAAAAGGAATAGAGAGGAGGG - Intergenic
987981869 5:25096205-25096227 TTGAAAGCCTATGGAGAGGAAGG - Intergenic
988228676 5:28447397-28447419 ATGAACAAGAATGGAGAAAAAGG - Intergenic
988332016 5:29853873-29853895 TAGAAAAAGACTGTAGATGAAGG - Intergenic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
988626457 5:32880673-32880695 TTGAATAAGAGTGGTGAGGGTGG + Intergenic
988649674 5:33134357-33134379 TTAGAAAAAATTGGAGAGGATGG - Intergenic
988692811 5:33589592-33589614 TTGCACAATAATGGAGAAGATGG - Intronic
988766312 5:34381549-34381571 ATGAAAAGGAATGGAGAAAAAGG - Intergenic
988975536 5:36512132-36512154 TTGAATAAGAGTGGTGAGGGAGG - Intergenic
989233374 5:39114515-39114537 TTAAAGAAGAATGGAGGGTAAGG + Intronic
989547055 5:42686781-42686803 TTGAAAAGGAATGGTGAGAGAGG - Intronic
990211196 5:53482679-53482701 TGGAAAAAGAAGGCAGTGGAGGG - Intronic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990486990 5:56268926-56268948 TGGATAAAGAATGGATAGAATGG - Intergenic
990834832 5:60006124-60006146 TTGAAAATAATTGTAGAGGAAGG + Intronic
990984468 5:61628336-61628358 TTGAATAGGAATGGTGAGAAAGG - Intergenic
991317546 5:65326410-65326432 TCACAAAAGGATGGAGAGGATGG + Intronic
991388349 5:66115233-66115255 ATGAAAAAGAATACAGAAGAAGG - Intergenic
992107466 5:73461839-73461861 TTGACAAAGAAAAGAGAAGATGG - Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992750640 5:79857557-79857579 TGGCAGAAGAATGGAGAGGAGGG - Intergenic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
993353378 5:86877082-86877104 TTGACAAAGAAAAGAGAAGATGG - Intergenic
993475371 5:88357866-88357888 TTGAACAAAAAGGCAGAGGATGG - Intergenic
993676885 5:90826328-90826350 TTGACAAAAAATGAAGAAGATGG - Intronic
993799361 5:92312654-92312676 TTGAAATAGAATGGAGACAGTGG - Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
993959476 5:94279551-94279573 TAGAAAAAGAATGGGAAGAAAGG - Intronic
994149769 5:96433844-96433866 TTGAGAAACAAAGGGGAGGAGGG - Intronic
994473122 5:100235134-100235156 ATGAAAGAGAATGGAGAGCCCGG - Intergenic
994654330 5:102571217-102571239 TTCAAAAATATTGAAGAGGAGGG + Intergenic
995073116 5:107947878-107947900 TAGAAAAGGAATAGAGTGGAAGG - Intronic
995186624 5:109279104-109279126 CTTAAAATGAATGGAGAGAAGGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995856165 5:116594491-116594513 ATGAATAAGAATGTAGAGAAAGG - Intergenic
995961835 5:117851023-117851045 TTGACAAAGTATGAAGAAGAGGG + Intergenic
996158153 5:120128907-120128929 TTGAAAAGGAATGGTGAGAGAGG + Intergenic
996361994 5:122658905-122658927 TAAAAAATGGATGGAGAGGATGG + Intergenic
996433635 5:123409499-123409521 TTGAAAAGGAGTGGTGAGAAGGG - Intronic
996723427 5:126651941-126651963 AAGAAAAAGAAAGGAAAGGAAGG + Intergenic
996847304 5:127913985-127914007 GTGAATAAAAATGGAGAGGGGGG + Intergenic
996851269 5:127955652-127955674 TTGAATAAGAATGGTGAGACTGG - Intergenic
996976080 5:129436344-129436366 TTACCAATGAATGGAGAGGAGGG - Intergenic
997067224 5:130575620-130575642 TAGTAAGAGAAAGGAGAGGAGGG + Intergenic
997099152 5:130948883-130948905 TTGAATAGGAATGGTGAGAATGG - Intergenic
997144033 5:131412711-131412733 GTGCAAAAGAATTGAGAGTAGGG - Intergenic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997295627 5:132766624-132766646 TAGAAAGAGGAAGGAGAGGAAGG + Intronic
997710145 5:135997120-135997142 CAGAAAAAGAACAGAGAGGATGG - Intergenic
997876316 5:137550937-137550959 TTGAATAAGAATGGTGAGAGAGG - Intronic
998814797 5:146002455-146002477 TTAAAAAAGAAAGAAAAGGAAGG + Intronic
999586408 5:153094550-153094572 TTAAGAGAGAATGGAGGGGAAGG + Intergenic
999799309 5:155018577-155018599 TTGAAAAAAAGTGGAGAGAGAGG + Intergenic
1000403284 5:160856015-160856037 TTGAAAAAAAATAAAGTGGAAGG - Intergenic
1000927430 5:167210782-167210804 TAGAAAATGCATGTAGAGGAAGG - Intergenic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001712208 5:173788063-173788085 GAGAGTAAGAATGGAGAGGAAGG + Intergenic
1001799592 5:174531433-174531455 TTCAAAAAGAAAGGAGTGGTAGG - Intergenic
1001854044 5:174995388-174995410 GTGAAGAAGAATGAAGTGGAGGG + Intergenic
1002572428 5:180149970-180149992 CAGAAAAAGAAGGGAGAGAAAGG - Intronic
1002616214 5:180458094-180458116 TTGGAAAGAGATGGAGAGGAGGG - Intergenic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003558475 6:7161582-7161604 TTGAGAAAGATAGGAAAGGAGGG - Intronic
1003564945 6:7214899-7214921 TTGAAACACAGTGGAGTGGAGGG - Intronic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1003829466 6:9991463-9991485 TAAAGAAAGAATGCAGAGGACGG - Intronic
1003839357 6:10104342-10104364 GTGAAAAGGAAGGGAGAGAATGG - Intronic
1003852893 6:10242872-10242894 TTAAATAAGAATGCAGAGCAGGG - Intergenic
1004076618 6:12349718-12349740 TTTAAAAAGAATGAAGGGCAAGG - Intergenic
1004077391 6:12357016-12357038 TTGAAAAAAAATGGTAAGAAGGG + Intergenic
1004201785 6:13555271-13555293 TTTAAAAAGACTGGAGAGGAAGG + Intergenic
1004333613 6:14743826-14743848 TTGAGAAAGAAAGGAGAGAAGGG + Intergenic
1004588569 6:17026808-17026830 TTGAAAAGGAATGGTGAGTGGGG + Intergenic
1004839721 6:19569242-19569264 TTGAGAAGGAATGGGGAGGGAGG - Intergenic
1004997597 6:21209256-21209278 TGGACAAAGGATGGAGAGGTGGG - Intronic
1005158039 6:22830594-22830616 TAGAACAAAAAGGGAGAGGAAGG - Intergenic
1005413107 6:25571859-25571881 ATGAAAAAGAAAGGTGGGGATGG + Intronic
1005426065 6:25703711-25703733 TTAACAGAGAATGGAGAAGAGGG - Intergenic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1005443249 6:25894227-25894249 GGAAAAAAGAAGGGAGAGGAAGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1005766747 6:29018452-29018474 TTAAAAAAAATTGAAGAGGAGGG - Intergenic
1005880359 6:30053422-30053444 TTAAAAAAAACTGAAGAGGAAGG + Intergenic
1005913862 6:30334835-30334857 CTCAAAAAGAATCAAGAGGATGG - Intronic
1006118720 6:31791213-31791235 TAGAAAAAGAAGGGAGAGACTGG + Intronic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006391143 6:33759561-33759583 TAAAAAAAGAAGGGAGGGGAAGG + Intergenic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1006924625 6:37647703-37647725 AAGAAAGAGAAGGGAGAGGAGGG + Intronic
1006935057 6:37711530-37711552 TTGAGAAGGAATGGTGATGAGGG - Intergenic
1007004425 6:38347067-38347089 TTTAAAAAGAAAGAACAGGAGGG - Intronic
1007145923 6:39631322-39631344 TTGAAGAAAAATGGTGAGAATGG + Intronic
1007344698 6:41220466-41220488 TTGAATTAGAATGGTGAGAATGG + Intergenic
1007442546 6:41875634-41875656 TAGTAAAATAATGGAGTGGATGG - Intronic
1007514048 6:42397160-42397182 GGGAGAAAGAAAGGAGAGGAAGG + Intronic
1007536052 6:42590210-42590232 TTGTAAAAGCTTGGAGATGATGG + Intronic
1007893764 6:45325189-45325211 TTGAAAAACAAAGGAGAAAATGG - Intronic
1007936258 6:45735068-45735090 GTGAAAAATAATAGAGAGGGAGG - Intergenic
1007970727 6:46049420-46049442 TGAAAAAAGAAAAGAGAGGAAGG - Intronic
1008106122 6:47442649-47442671 TGGAAAGGGAATGGAGAGGCAGG - Intergenic
1008457355 6:51726481-51726503 ATGTAAAAGGATGGATAGGATGG - Intronic
1008698314 6:54068137-54068159 GTCAAAAAGAAAGGAGAGGAGGG - Intronic
1008864284 6:56191058-56191080 TTGAAAAGGAATGGTGAGAGAGG - Intronic
1008978883 6:57460047-57460069 CTGAAAAAGCATGGAGAACAAGG - Intronic
1009025637 6:57996992-57997014 TTTAAAAACACTGGACAGGAAGG - Intergenic
1009167019 6:60353036-60353058 CTGAAAAAGCATGGAGAACAAGG - Intergenic
1009201199 6:60748460-60748482 TTTAAAAACACTGGACAGGAAGG - Intergenic
1009411351 6:63368634-63368656 AAGAAAAAGAATGCAGACGAGGG - Intergenic
1009911822 6:69939139-69939161 TTGAAAAAGATTTTTGAGGAGGG + Intronic
1010297165 6:74211965-74211987 GGGAAAAAAAATGGATAGGAGGG - Intergenic
1010485584 6:76408787-76408809 ATCAAAAAGAATGAAGCGGAAGG - Intergenic
1010544059 6:77127988-77128010 TCCAAAAAAAATGAAGAGGAAGG + Intergenic
1010638372 6:78288416-78288438 TTTAAAAAAACTGAAGAGGAGGG - Intergenic
1010689102 6:78888180-78888202 TTGCCAAAGAATGGAGGGAAGGG + Intronic
1010896739 6:81374287-81374309 TTGAATAGGAATGGAGAGAGAGG - Intergenic
1010906553 6:81498520-81498542 TTGAAAAAGAGTGGTGAGAGTGG + Intronic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1011393723 6:86882966-86882988 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1011559576 6:88600959-88600981 TGGAGAAAGTATGGGGAGGAGGG - Intergenic
1011679230 6:89767117-89767139 TTGAAAAAGAGTAGAGGGCATGG - Intronic
1012131523 6:95499327-95499349 TAGAAAAAGAATTGAGAAGATGG - Intergenic
1012145390 6:95673935-95673957 TAGAAAAAAAAAGGACAGGATGG - Intergenic
1012374835 6:98548743-98548765 TAGCAAAATAGTGGAGAGGAGGG + Intergenic
1012690914 6:102309506-102309528 ATGAAAAACACTGGAGATGATGG + Intergenic
1012765316 6:103359964-103359986 TTCAAAAAAAATCAAGAGGAAGG + Intergenic
1012833835 6:104240243-104240265 TAGAAGAAGAATGCAGAAGAGGG - Intergenic
1012845987 6:104389368-104389390 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1013033155 6:106355957-106355979 TGGGATAGGAATGGAGAGGAGGG - Intergenic
1013474919 6:110498176-110498198 TTGAAAGAGAGTGGGGAGGGAGG - Intergenic
1013494445 6:110684420-110684442 TTGAAATAGAATGGTGGGGTGGG + Intronic
1014070753 6:117178945-117178967 TTGAAAAAGAGTGGTGAGTGGGG - Intergenic
1014203389 6:118628543-118628565 TTAAAAAAAAAAGGAGAAGAAGG + Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014475359 6:121865518-121865540 TTAAAAAAGGAGGGAGAGGAAGG - Intergenic
1014518579 6:122409497-122409519 TTGAAAAAGAAGGTATAAGAGGG + Intronic
1014970315 6:127806921-127806943 GTGAAAAAGACGGGAGAAGAGGG - Intronic
1015255305 6:131172622-131172644 TAGAAAAAGAAAGGAGGGGCTGG - Intronic
1015793919 6:136991745-136991767 TTTAAAGAGAAGGCAGAGGAAGG - Intergenic
1015831078 6:137369601-137369623 TCAAAAAGGAATGGGGAGGATGG + Intergenic
1016112933 6:140248429-140248451 TTGTAGAAAAATGCAGAGGAAGG + Intergenic
1018285858 6:162236832-162236854 GAGAGAAAGAAAGGAGAGGAAGG + Intronic
1018427739 6:163698687-163698709 TGGAAGAAGAATGGACGGGATGG - Intergenic
1018600301 6:165531049-165531071 ATTAAATAGAAGGGAGAGGAAGG - Intronic
1018605324 6:165591581-165591603 TTGGCAAAGACTGGAGAGCAGGG - Intronic
1018613977 6:165668678-165668700 AAGAAAAAGAAAGGAAAGGAAGG + Intronic
1018651000 6:165991134-165991156 TTGAAACAGGATGGATGGGAAGG - Intergenic
1018659533 6:166073406-166073428 TTGAAAAGGAATGAAGATGCTGG - Intergenic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1020123589 7:5519741-5519763 TTGAAAAGGAGTGGAGAGTGGGG - Intergenic
1020438124 7:8188329-8188351 TGCTACAAGAATGGAGAGGAGGG - Intronic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1020826865 7:13039662-13039684 TTTTAAAGGATTGGAGAGGAAGG - Intergenic
1021024960 7:15654450-15654472 TTGAATAAGAGTGGTGAGGGAGG + Intronic
1021435443 7:20608875-20608897 ATGAAAAAGAATTAAGAGCAGGG - Intergenic
1021937063 7:25641469-25641491 GAGCAAAAGAATGGAGAGGGAGG - Intergenic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1022452138 7:30525444-30525466 TGGAAGAAGAATGGAGACTATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022661180 7:32368091-32368113 TTGAATAAGAGTGGCGAGCATGG - Intergenic
1023122342 7:36922574-36922596 TTGACAGAGAAGGGAAAGGAAGG + Intronic
1023294167 7:38698012-38698034 TTAAAAAAGAAATGAGAGGCTGG - Intergenic
1023451274 7:40288206-40288228 TTCCAAAAGCAAGGAGAGGAGGG - Intronic
1023616141 7:42022161-42022183 TTAAAAAGAAATGGAGGGGAGGG + Intronic
1024023461 7:45391525-45391547 TTGACAAAGAAGGAAGAAGAGGG + Intergenic
1024168524 7:46759693-46759715 ATGAGAAAGAGTGGAGACGATGG - Intronic
1024227718 7:47339626-47339648 TTGAGAAAGAATTAAGTGGAAGG - Intronic
1024505103 7:50156074-50156096 ATGAAAAAGCATGGTGCGGAGGG + Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024953901 7:54895390-54895412 TTGAAATAGAACAGAGAGAAGGG - Intergenic
1025297123 7:57783998-57784020 TTTAAAATGAATGAAAAGGAGGG - Intergenic
1026208863 7:68284333-68284355 TCCAAAAAAAATGGAGAGAAGGG + Intergenic
1026211658 7:68311307-68311329 TTGACAAAGAAGAGAGAAGATGG + Intergenic
1026234245 7:68512168-68512190 TTTAAAAAGACTGGCGAGGACGG + Intergenic
1026245020 7:68612195-68612217 AAGAAAGGGAATGGAGAGGAGGG - Intergenic
1026422684 7:70257029-70257051 TTAAAAAACAATGAAGAGCAAGG - Intronic
1027446428 7:78278987-78279009 TTGAAGAAAAATGAAGATGATGG + Intronic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1028699798 7:93764121-93764143 TTGAATAAGAATGGTGAGACTGG - Intronic
1028709171 7:93888607-93888629 GAGAAAAAGAAAGGAGAGAAAGG + Intronic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1028810033 7:95075528-95075550 GTGATAAAGTATGGAGAGGTAGG + Intronic
1028970868 7:96857526-96857548 TAGAAAAAAAAAGGTGAGGAGGG - Intergenic
1029133402 7:98350776-98350798 TAGAAACAGACTGGAAAGGATGG + Intronic
1029330160 7:99846614-99846636 TTGAATAAGAATGGTGAGAGTGG + Intronic
1029993698 7:104985619-104985641 TTCAACAGGAATAGAGAGGACGG + Intergenic
1030490496 7:110227304-110227326 TTGAAAGACAAAGGAGAGGTGGG - Intergenic
1030696686 7:112592608-112592630 TTGAATAAGAGTGGTGAGAAAGG - Intergenic
1030765898 7:113409261-113409283 TTGAATAAAAAGGTAGAGGAAGG + Intergenic
1031137832 7:117904504-117904526 TTGAATAAGAAAGGGCAGGAAGG + Intergenic
1031205094 7:118746433-118746455 TTGAAAAAGAATTCAGTGGTAGG + Intergenic
1031348042 7:120693510-120693532 ATGAAAAAAAATTGAGAGGAAGG + Intronic
1031376152 7:121028182-121028204 TTCAGTAAGAATGGAGAGGCAGG + Intronic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1032761434 7:134947144-134947166 TTCTAAAAGAATGGAAAGCAAGG - Intronic
1033191221 7:139282022-139282044 TGGGGAAAGAATGGAGAGGAAGG - Exonic
1033284704 7:140030995-140031017 TTTAAAAAAAGTTGAGAGGAAGG + Intronic
1033623659 7:143086873-143086895 TTGAAAAGGAGTGGTGAGAATGG - Intergenic
1034175413 7:149095850-149095872 TTAAAAAAGAAAAGAGAGGTCGG + Intergenic
1034309345 7:150072841-150072863 TGGAAGAGGAAAGGAGAGGAGGG + Intergenic
1034455748 7:151168651-151168673 AAGAAAAAGAATGTAAAGGACGG - Intronic
1034797512 7:154027799-154027821 TGGAAGAGGAAAGGAGAGGAGGG - Intronic
1035521342 8:277159-277181 TTGGACAAAAAAGGAGAGGAAGG - Intergenic
1035651073 8:1265504-1265526 TTAAAAAAGAATGGGGAGAAAGG + Intergenic
1036034272 8:5002334-5002356 GCTAAAAAGAATGGAGAGGAAGG - Intergenic
1036079123 8:5534083-5534105 TTGACAAAGAAAGGGGAAGATGG + Intergenic
1036144555 8:6242754-6242776 TTGAAAAAGAATGTTAAGGTGGG + Intergenic
1036216726 8:6886149-6886171 TTGAAAAAGAATGAAGTTGGAGG + Intergenic
1036590893 8:10167096-10167118 TTGGAAGAGAATGGAGAGGAGGG - Intronic
1036723830 8:11201419-11201441 GGGGAAACGAATGGAGAGGAAGG + Intergenic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037389774 8:18381078-18381100 ATGAAAACGGATGGACAGGAAGG + Intergenic
1037406496 8:18547984-18548006 AGGAAAAAGAATGAAAAGGAAGG - Intronic
1037560256 8:20067228-20067250 TTGAAGAAGACTGGTGAGGGTGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038175860 8:25181918-25181940 ATGAAAAAGAACCAAGAGGAGGG - Intergenic
1038355503 8:26825376-26825398 TTGACAAAAAATGGGGAGGGTGG + Intronic
1038514413 8:28173163-28173185 TTGCAAAAAACTGAAGAGGATGG - Intronic
1038595605 8:28882995-28883017 TAGGAAAAGAAAGGACAGGAAGG - Intronic
1039299077 8:36189995-36190017 GTGGAAAAGAATGGAGATGATGG - Intergenic
1039564268 8:38538879-38538901 ATGAAAAAGTCTTGAGAGGATGG - Intergenic
1040420312 8:47233514-47233536 TTGAAAAGGAATGGTGAGAGGGG - Intergenic
1040734953 8:50493874-50493896 TTGAAAAATAATGGAGATAATGG - Intronic
1040782219 8:51122592-51122614 TGGAAAAAAAATGGAGATTATGG - Intergenic
1040799392 8:51324314-51324336 TTGAATAAGAGTGGTGAGAATGG + Intronic
1041453375 8:58031864-58031886 ATGAAAAGGAAGGGGGAGGAAGG - Intronic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1042231818 8:66564210-66564232 TTGAAAAGGAATTTAAAGGAAGG - Exonic
1042358942 8:67860453-67860475 TTGAAAATGAATAGTGAGGGAGG + Intergenic
1042379641 8:68098037-68098059 CTGAAACAAGATGGAGAGGAAGG + Intronic
1042751911 8:72166717-72166739 TTGAAAAAGAGTGGTGAGAGTGG + Intergenic
1042781284 8:72493899-72493921 TAGCAAAAGCTTGGAGAGGAAGG - Intergenic
1043790551 8:84462396-84462418 TTGAAATACAATTCAGAGGACGG - Intronic
1043820164 8:84853736-84853758 TAAAAACAGAATGGAGAGGCTGG + Intronic
1043825976 8:84928899-84928921 TTAAAAAACAATGGATATGAAGG + Intergenic
1043923609 8:86011703-86011725 TGGAAAAAGAAGGAAGATGATGG + Intronic
1044370979 8:91410416-91410438 TAGATAATGAATGGAGAGGTAGG - Intergenic
1044601683 8:94011648-94011670 CTGAATCAGAATGGAGAGAAGGG + Intergenic
1044606077 8:94048810-94048832 ATGAAAAAAAATGGACAAGATGG - Intergenic
1044877014 8:96679457-96679479 TTCAAAAAAATTGGAGAAGAGGG - Intronic
1044955246 8:97473170-97473192 ATAAAAAAGAATATAGAGGAGGG - Intergenic
1045673084 8:104578493-104578515 TTCAAAAAAATTGAAGAGGAAGG + Intronic
1045833384 8:106491213-106491235 ATGAAAAAGAAAGGAAAGCAAGG - Intronic
1045994453 8:108346153-108346175 TTGAGAAATAATGCAGAAGATGG - Intronic
1046045641 8:108961022-108961044 TTGACAAAGAAAGGGGAGGATGG + Intergenic
1046305472 8:112359322-112359344 TCCAAAAAGAATGTAGAGGGTGG - Intronic
1046453116 8:114419892-114419914 TTGAAAAAGAGTGGTGAGAGAGG - Intergenic
1046656073 8:116896392-116896414 TTCAAAAAAACTGAAGAGGAAGG + Intergenic
1046669053 8:117037430-117037452 TTGGAGGAGAATGGAGAGGAAGG + Intronic
1046964342 8:120147047-120147069 TAGAAAAAGAAGGGAAAGAAAGG - Intronic
1047272438 8:123375010-123375032 AAAAAAAAGAATGGAAAGGAAGG + Intronic
1047359966 8:124160188-124160210 TTGCAAAAGATGGGAGAAGAGGG + Intergenic
1047394990 8:124489374-124489396 AAGAAAAAGAAAGGAAAGGAAGG - Intronic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047642014 8:126830853-126830875 TTGAATAAGAACAGAGAGGGTGG + Intergenic
1047983331 8:130206329-130206351 GTTAAAAAGTATGGAGAGCATGG - Intronic
1048021457 8:130543249-130543271 TGGGAATAGAATGGAAAGGATGG - Intergenic
1048226575 8:132593105-132593127 CTGCAAAAGAATGGACAGAAAGG + Intronic
1049148191 8:141017373-141017395 TTGAGAAAGATGGGTGAGGAGGG - Intergenic
1049875984 8:145020969-145020991 CTGTAGAAGAATGGAGAGTAGGG - Intergenic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050444497 9:5704506-5704528 ATTAAAAAGAAGGGAGAGGCAGG - Intronic
1050452021 9:5791979-5792001 TTGGAAATGATGGGAGAGGAGGG + Intronic
1050810168 9:9735429-9735451 TTGAAAGAGAATGGAGAACACGG + Intronic
1051197734 9:14581570-14581592 TTGAATAAGAGTGGGGAGGCTGG - Intergenic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051797930 9:20895908-20895930 TTGAAAAAGAATAGTGAGAGAGG + Intronic
1051907609 9:22114496-22114518 ATGAAGGAGAAAGGAGAGGAAGG + Intergenic
1051997911 9:23241349-23241371 TTGCAAAAAAATGAAGATGAGGG + Intergenic
1052375437 9:27713409-27713431 CAGAAACAGAATGGAGAGGCAGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053182115 9:35981613-35981635 TTGGAAAACATTAGAGAGGAAGG + Intergenic
1053266741 9:36720678-36720700 TTAAAACAGGATGGAGAGGCGGG + Intergenic
1053541397 9:38977509-38977531 TTGGGAGAGAAAGGAGAGGAGGG + Intergenic
1053596245 9:39564546-39564568 TTGAAGAAGGAAGGAGGGGAAGG + Intergenic
1053805818 9:41800552-41800574 TTGGGAGAGAAAGGAGAGGAGGG + Intergenic
1053854214 9:42321187-42321209 TTGAAGAAGTAAGGAGGGGAAGG + Intergenic
1054570010 9:66800471-66800493 TTGAAGAAGGAAGGAGGGGAAGG - Intergenic
1054624741 9:67386399-67386421 TTGGGAGAGAAAGGAGAGGAGGG - Intergenic
1054963707 9:70998375-70998397 TTGCAGCAAAATGGAGAGGAAGG + Intronic
1054976038 9:71146611-71146633 TTCCAGAAGAATGGAGAAGAAGG - Intronic
1055015336 9:71610954-71610976 TTGAAAAGGAATGGTGAGAAAGG - Intergenic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1055330599 9:75179003-75179025 GTGAAAAGGACTGGAGGGGAAGG - Intergenic
1055332353 9:75197456-75197478 GGGAAAAAGAAAGGAAAGGAGGG - Intergenic
1055356070 9:75438239-75438261 TTTAATTAGAAAGGAGAGGAAGG + Intergenic
1055562956 9:77539542-77539564 TTCCAAAAGATTGAAGAGGAGGG - Intronic
1056651879 9:88472094-88472116 CTGAAAAAGAAAGGAGGGGCCGG - Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057747003 9:97760397-97760419 TTGAGAAAGAAGGGTAAGGATGG - Intergenic
1058119699 9:101124992-101125014 TATAAAAGGAATGGAGGGGAGGG - Intronic
1058481901 9:105404248-105404270 AAAAAAAAGAATGGAGAGAAAGG + Intronic
1058609237 9:106756989-106757011 TTTAGAAAGAATGGAGGCGAGGG - Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058765733 9:108181147-108181169 TATACAGAGAATGGAGAGGAGGG + Intergenic
1058799555 9:108531601-108531623 TCAAAAAAGAAAAGAGAGGAAGG + Intergenic
1059045827 9:110865124-110865146 TTGAAAAGGAATGGTGAGAGGGG + Intergenic
1059243182 9:112826117-112826139 CTGAATAAGACTTGAGAGGATGG - Intronic
1059780469 9:117521226-117521248 AAAAAAAAGAATGCAGAGGAGGG + Intergenic
1059916469 9:119108219-119108241 TTTAATAAGAATGGTGAGGTGGG - Intergenic
1059965532 9:119609939-119609961 AAGAAAAGGAATGGAAAGGAGGG - Intergenic
1060043014 9:120317761-120317783 TTGAAAGAGTATGGAAAAGATGG - Intergenic
1060294160 9:122332030-122332052 TTTAGAAAGAAGGGAGGGGAGGG + Intergenic
1060368898 9:123050068-123050090 TTGACAAAGAATGCAGACGATGG - Intronic
1060869345 9:127027198-127027220 TAGGAAGAGAATGGAGTGGAGGG - Intronic
1061053222 9:128208035-128208057 AAAAAAAAGAATGGGGAGGAAGG - Intronic
1062078753 9:134607433-134607455 TAAAACAGGAATGGAGAGGAGGG - Intergenic
1062516240 9:136938000-136938022 TCACAAAAGAATGGAGAAGAGGG + Intronic
1062542377 9:137047311-137047333 TTAAAAAAAAATGGTGAAGAGGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1203728874 Un_GL000216v2:73147-73169 TTGGAATACAATGGAGTGGAAGG - Intergenic
1203388239 Un_KI270438v1:74201-74223 ATGGAAAAGAATGGAATGGAAGG + Intergenic
1203349864 Un_KI270442v1:70810-70832 ATGAAATGGAATGGAAAGGAAGG + Intergenic
1203680784 Un_KI270756v1:62316-62338 ATGGAAAAGAATGGAATGGAAGG - Intergenic
1203680841 Un_KI270756v1:62706-62728 ATGGAATGGAATGGAGAGGAAGG - Intergenic
1185953761 X:4465932-4465954 ATGAAGAAAAATGGAGAAGACGG - Intergenic
1186045481 X:5532410-5532432 GAGAAGAAGAAGGGAGAGGAAGG + Intergenic
1186774703 X:12853476-12853498 GAGAAAAAGAATGAAAAGGAAGG - Intergenic
1186872723 X:13788379-13788401 TGGAAAGAGAGTGGAGAGAAGGG + Intronic
1186887935 X:13933394-13933416 TAGAAAAAGAATGGAGGATATGG - Intronic
1187024644 X:15421749-15421771 TTCAAAGAGACTGAAGAGGAGGG + Intronic
1187560680 X:20400132-20400154 TTGAAAATGGATGGTGATGATGG - Intergenic
1187676281 X:21719700-21719722 TTCCAAAAGGAGGGAGAGGAAGG - Intronic
1187756149 X:22529028-22529050 TTGAACAGGAATGGTGAGAAAGG - Intergenic
1188390653 X:29615389-29615411 AAGAAAAACAAAGGAGAGGAGGG + Intronic
1188393382 X:29649204-29649226 TTACAAAAAATTGGAGAGGAGGG + Intronic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1188595526 X:31895176-31895198 TGGAGAAAGAATGGAGAGACAGG + Intronic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1189188917 X:39079122-39079144 TTGAATAGGAATGGTGAGAAAGG + Intergenic
1189209564 X:39273143-39273165 TTGAATAAGAGTGGTGAGGGAGG + Intergenic
1189528028 X:41847201-41847223 TTCAAAAGGAATGGAGAGAAAGG - Intronic
1189632994 X:42974967-42974989 TGGAAAAAGAGGGGAGAAGAAGG + Intergenic
1189951999 X:46241874-46241896 TTTTAAAAGATTGAAGAGGAGGG + Intergenic
1189989003 X:46577186-46577208 ATTAAAGAGAATAGAGAGGAGGG + Intronic
1190024258 X:46908534-46908556 TTGAATAAGAGTGGAGAGAGTGG - Intergenic
1190432029 X:50387443-50387465 TGGTAAAAGAAAGGAAAGGAGGG - Intronic
1191037047 X:56037191-56037213 TTGAATAAGAGTGGTGAGAATGG + Intergenic
1192001260 X:67154323-67154345 TTTAAAAAAAAAAGAGAGGAAGG + Intergenic
1192880771 X:75281302-75281324 TTGAAGAGGAATGGTGAGGGTGG + Intronic
1193239107 X:79144920-79144942 AAGAAAAGGAAAGGAGAGGAAGG - Intergenic
1193752727 X:85366162-85366184 TTGAAAAATAATGCTGATGAAGG + Intronic
1193889117 X:87021276-87021298 TTGAAAAGGAATGGTGAGAGTGG - Intergenic
1194485641 X:94482566-94482588 TTGAATAAGAGTGGTGAGAAAGG + Intergenic
1195149523 X:102051922-102051944 TTGAAAAAGAATGGTGAGAGAGG + Intergenic
1195154300 X:102107847-102107869 TTCAAAATGAATAGAGAGGTGGG + Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195813589 X:108860503-108860525 TTGAAAATGCAGGGAAAGGAAGG - Intergenic
1196239790 X:113329772-113329794 TTGAACAAAAAGGCAGAGGAAGG - Intergenic
1196322964 X:114365226-114365248 TTGAAAAGGAATTGAGTTGATGG + Intergenic
1196998548 X:121411926-121411948 TTACAAAATAATGAAGAGGAGGG - Intergenic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197099234 X:122632418-122632440 TTGAATAAGAATGGTGAGAGTGG + Intergenic
1197136985 X:123072475-123072497 TTGAAAAAGGATGGATTGGCCGG - Intergenic
1197290620 X:124652761-124652783 ATTAGAAAAAATGGAGAGGAGGG - Intronic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197600531 X:128521825-128521847 CTGAAACAGCATGTAGAGGATGG + Intergenic
1197740720 X:129891285-129891307 TTGAAGATGAATGGTGGGGAGGG + Intergenic
1197793056 X:130274322-130274344 ATAAGAAAGGATGGAGAGGAAGG + Intergenic
1197922097 X:131605887-131605909 ATGAAACAGAATGGAGAGCCTGG + Intergenic
1197989999 X:132307816-132307838 TTGAATAAGAATGGTGAGAGAGG + Intergenic
1198004621 X:132480314-132480336 TTGGAAAGGAATGGAAAGAATGG - Intronic
1198080452 X:133234867-133234889 ATGCAAAAGACTGGAAAGGATGG - Intergenic
1198157781 X:133979159-133979181 TTGATAAATAATTGATAGGAAGG - Intronic
1198202258 X:134433709-134433731 AGCAATAAGAATGGAGAGGATGG - Intergenic
1198429376 X:136550178-136550200 TTGAAAAAGAGTAGAGGGGTAGG - Intronic
1198442357 X:136675442-136675464 TTGAAATTTAAAGGAGAGGAAGG - Intronic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198727827 X:139695527-139695549 TGGAAAAAACATGGAGTGGATGG + Intronic
1198813616 X:140562125-140562147 TTGAAAAGGAATGGTGAAAATGG + Intergenic
1199064553 X:143399656-143399678 TTCAAAAATAATACAGAGGATGG - Intergenic
1199372718 X:147070044-147070066 TTCAGAGAGACTGGAGAGGAAGG + Intergenic
1199543482 X:148983279-148983301 TGGAAAGAGAATGAAGAGAATGG + Intronic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1200367021 X:155677451-155677473 TCCAAAGAAAATGGAGAGGAAGG - Intergenic
1200708323 Y:6461965-6461987 TTGAAAATGAATTGAGAGACAGG - Intergenic
1200951239 Y:8902041-8902063 TTGCAAGAGTATGGAGAGTATGG + Intergenic
1201025789 Y:9702743-9702765 TTGAAAATGAATTGAGAGACAGG + Intergenic
1201103455 Y:10745968-10745990 TTGGAATGGAATGGAGTGGAGGG - Intergenic
1201112248 Y:10808081-10808103 GTGAAATCGAATGGAGTGGAAGG - Intergenic
1201113573 Y:10818871-10818893 ATGGAAAGGAATGGAGTGGAAGG - Intergenic
1201115142 Y:10829652-10829674 GTGGAAAGGAATGGAGTGGAAGG - Intergenic
1201122667 Y:10885027-10885049 TTGGAAAGGAATGGAGTAGAGGG - Intergenic
1201123800 Y:10894501-10894523 TTGGAAAGGAATGGAGTAGAGGG - Intergenic
1201124601 Y:10901577-10901599 TTGGAATGGAAAGGAGAGGAGGG - Intergenic
1201128364 Y:10934016-10934038 ATGGAATGGAATGGAGAGGAAGG - Intergenic
1201129363 Y:10940936-10940958 GTGAAATAGAATGGAATGGAAGG - Intergenic
1201130824 Y:10950721-10950743 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201131346 Y:10954176-10954198 TTGGAACAGAATGGAATGGAGGG - Intergenic
1201131679 Y:10956479-10956501 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201135839 Y:10989489-10989511 GTGGAAAGGAATGGAGCGGAGGG - Intergenic
1201174445 Y:11299629-11299651 TTGGAATAGAATGGAATGGAAGG - Intergenic
1201174926 Y:11302650-11302672 ATGAAACGGAATGGAAAGGAAGG - Intergenic
1201195930 Y:11494580-11494602 ATGGAATAGAATGGAAAGGAAGG + Intergenic
1201316617 Y:12653473-12653495 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201894910 Y:18982884-18982906 AGGAAAAAGAAACGAGAGGAGGG + Intergenic