ID: 906551218

View in Genome Browser
Species Human (GRCh38)
Location 1:46668050-46668072
Sequence TCCAGCTGCTGCGCAGGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 764}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906551218_906551226 15 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551226 1:46668088-46668110 GGTCGTAGAAAGGGTTGGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 64
906551218_906551224 6 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551224 1:46668079-46668101 CGCGGTAGCGGTCGTAGAAAGGG 0: 1
1: 0
2: 0
3: 0
4: 14
906551218_906551228 28 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551228 1:46668101-46668123 GTTGGCCTGGAGCTCGGCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 220
906551218_906551222 -6 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551222 1:46668067-46668089 GCTGGATCTTGTCGCGGTAGCGG 0: 1
1: 0
2: 0
3: 2
4: 29
906551218_906551223 5 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551223 1:46668078-46668100 TCGCGGTAGCGGTCGTAGAAAGG 0: 1
1: 0
2: 0
3: 0
4: 10
906551218_906551225 10 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551225 1:46668083-46668105 GTAGCGGTCGTAGAAAGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 39
906551218_906551227 22 Left 906551218 1:46668050-46668072 CCCGCACCTGCGCAGCAGCTGGA 0: 1
1: 0
2: 2
3: 61
4: 764
Right 906551227 1:46668095-46668117 GAAAGGGTTGGCCTGGAGCTCGG 0: 1
1: 0
2: 0
3: 31
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906551218 Original CRISPR TCCAGCTGCTGCGCAGGTGC GGG (reversed) Exonic
900110383 1:1003014-1003036 CCCAGCTGCTGCCCAGGGGCAGG - Intergenic
900723912 1:4202259-4202281 GCCAGATGCTGAGCAGATGCTGG - Intergenic
900730376 1:4254979-4255001 TGCAGCTGCTGTGCAGGGGTTGG + Intergenic
901135110 1:6987977-6987999 TCCTGCTGCTGGTCTGGTGCTGG - Intronic
901143914 1:7052721-7052743 TCAGGCTGCTGGGCAGGTGTGGG - Intronic
902080380 1:13816505-13816527 TCCAGCTGCAGCCCAGTTCCAGG + Exonic
902358932 1:15931311-15931333 TCCAGCTGTTCCACAGGGGCAGG - Exonic
902393590 1:16120087-16120109 TCCAGCTGCAGCCCAGGGCCTGG - Intergenic
902477476 1:16695928-16695950 CCCAGGTGCTGGGCAGGTGAAGG + Intergenic
902506203 1:16940078-16940100 ACGAGCTCCTGAGCAGGTGCCGG + Exonic
902754137 1:18537934-18537956 CCCAGCAGCTGAGAAGGTGCTGG + Intergenic
903182893 1:21613979-21614001 TGCGGCTGCTGCTCAGGTGAGGG - Exonic
904026889 1:27509634-27509656 TCCAGGTGCTGAGCAGGGGTGGG + Intergenic
904618207 1:31761081-31761103 TCCAGCTGCTGCAAAGTTCCGGG - Intronic
905375703 1:37518664-37518686 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
906551218 1:46668050-46668072 TCCAGCTGCTGCGCAGGTGCGGG - Exonic
906588703 1:47003549-47003571 TCCAGAAGCTGAGCAGTTGCCGG - Intergenic
907102162 1:51847326-51847348 TCCACCTGCTGGCCCGGTGCTGG - Intronic
907839212 1:58140355-58140377 TCCATCTGCTTGGCAAGTGCTGG + Intronic
907980125 1:59472497-59472519 TCCACCTGCAGCCCCGGTGCGGG + Intronic
908291414 1:62670302-62670324 TCCACCTGCAGCCCTGGTGCGGG + Intronic
909377004 1:74951996-74952018 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
909759310 1:79269532-79269554 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
909904493 1:81178555-81178577 TCCACCTGCAGCCCCGGTGCCGG - Intergenic
910034695 1:82776730-82776752 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
911001518 1:93170641-93170663 TCCACCTGCGGCCCAGGTGCGGG + Intronic
912166232 1:107045180-107045202 TCCACCTGCAGCCCAGGTGTGGG + Intergenic
912312803 1:108640817-108640839 TCCACCTGCAGCCCCGGTGCGGG - Intronic
912316000 1:108667888-108667910 TCCACCTGCAGCTCTGGTGCAGG + Intergenic
912451968 1:109772918-109772940 TCCAGCTGCTGCCCACTTTCAGG - Intronic
912798568 1:112707094-112707116 TCCAGCTGCGCGGCCGGTGCCGG + Exonic
913469072 1:119171917-119171939 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
913470255 1:119179436-119179458 TCCACCTGCGGCCCTGGTGCAGG + Intergenic
913600993 1:120421029-120421051 TCCAGAAGCTGCCCAGCTGCAGG - Intergenic
913692042 1:121289052-121289074 TCCACCTGCAGCCCCGGTGCGGG - Intronic
914145516 1:144991062-144991084 TCCACCTGCAGCCCCGGTGCGGG + Intronic
914191954 1:145419555-145419577 TCCAGAAGCTGCCCAGCTGCAGG + Intergenic
914438363 1:147680714-147680736 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
914589861 1:149097505-149097527 TCCAGAAGCTGCCCAGCTGCAGG + Intronic
914799313 1:150948832-150948854 TCCAGCTGCTCGGAAGGCGCAGG - Intronic
915079462 1:153341859-153341881 TCCATCAGCTGTGCAGGGGCTGG - Intronic
915104195 1:153522189-153522211 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
915139776 1:153760114-153760136 TCCAGCTGCTGGGGAGGTTGAGG + Intronic
915828680 1:159105170-159105192 TCCAGCTGCTGCGGCAGGGCAGG + Intronic
915865476 1:159494556-159494578 TCCATCTGCAGCCCTGGTGCGGG - Intergenic
916605878 1:166342808-166342830 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
916910038 1:169337022-169337044 TCCACCTGCAGCCCCGGTGCGGG - Intronic
918709016 1:187704032-187704054 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
918952067 1:191151794-191151816 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
919167881 1:193918860-193918882 TCCACCTGCAGCGCTGGTGCGGG - Intergenic
919174543 1:194002251-194002273 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
919237090 1:194859412-194859434 TCCACCTGCAGCACCGGTGCGGG + Intergenic
920315571 1:205073776-205073798 TCCAGCTGCGGCGCAGAGGGAGG - Exonic
920479363 1:206307400-206307422 TCCACCTGCAGCCCCGGTGCGGG - Intronic
920881953 1:209888896-209888918 TCCACCTGCAGCCCGGGTGCGGG - Intergenic
920883079 1:209898749-209898771 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
921396305 1:214673095-214673117 TCCACCTGCAGCCCGGGTGCGGG - Intergenic
921801881 1:219411064-219411086 TCCACCTGCAGCCCCGGTGCCGG + Intergenic
921897166 1:220412844-220412866 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
922423285 1:225473119-225473141 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
922463292 1:225829055-225829077 TTCCTCTGCTGGGCAGGTGCAGG + Intronic
922855866 1:228774116-228774138 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
923324740 1:232871392-232871414 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
923328926 1:232904670-232904692 TGCAGATACTGCACAGGTGCTGG - Intergenic
923550245 1:234958004-234958026 TCCACCTGCTGAGCAGGACCGGG - Intergenic
923573892 1:235140706-235140728 TCCACCTGCAGCCCCGGTGCAGG + Intronic
924117597 1:240762900-240762922 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1063148873 10:3319762-3319784 TCCACCTGCAGCCCAGGTGTGGG - Intergenic
1063233612 10:4090006-4090028 TACAGCTGCTCATCAGGTGCAGG + Intergenic
1063309242 10:4937375-4937397 TCCACCTGCGGCCCTGGTGCGGG - Intronic
1063318650 10:5032467-5032489 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1063769772 10:9183762-9183784 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1064461102 10:15535349-15535371 TCCACCTGCGGCGCCGGTGCGGG + Intronic
1065614298 10:27504433-27504455 TCCAGGTGAGGCGGAGGTGCGGG + Exonic
1065730161 10:28703243-28703265 TCCAGCTGCTCAGGAGGTGGAGG - Intergenic
1065995582 10:31056232-31056254 TCCACCTGCGGCCCTGGTGCAGG + Intergenic
1066190341 10:33049638-33049660 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1066575547 10:36820348-36820370 TTCACCTGCTGCCCTGGTGCAGG + Intergenic
1066654862 10:37687829-37687851 TCCAGGAGCTGTGCAGGTGCTGG + Intergenic
1067005867 10:42661459-42661481 TCCTGGTGCTGTGAAGGTGCTGG - Intergenic
1068374097 10:56155536-56155558 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1068435710 10:56988800-56988822 TCCAGCTGATGCATAGGGGCAGG + Intergenic
1068792345 10:61041026-61041048 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1068978214 10:63034001-63034023 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1069504942 10:68989197-68989219 TGCGGCTGCTGCGCAGGTACCGG + Exonic
1069858579 10:71456084-71456106 TCCAGGTGCCTCGCAGCTGCTGG + Intronic
1070146047 10:73773887-73773909 ACTAGGTGCTGAGCAGGTGCAGG + Intronic
1070479294 10:76866275-76866297 TCCTGCTGCTGCATTGGTGCTGG + Intergenic
1070564019 10:77590229-77590251 TCCACCTGCGGCCCCGGTGCGGG - Intronic
1071003832 10:80859666-80859688 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1071055759 10:81506185-81506207 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
1071078785 10:81784630-81784652 TCCACCTGCTGCCCCAGTGCAGG + Intergenic
1071797014 10:89018602-89018624 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1072733724 10:97865537-97865559 CCCAGCTGCTGAGCAGGGGTGGG - Exonic
1073789698 10:106928053-106928075 TCCACATGCAGCGCCGGTGCGGG - Intronic
1074174979 10:110990175-110990197 TCCACCTGCAGCCCTGGTGCGGG + Intronic
1074999304 10:118783315-118783337 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1076261581 10:129071300-129071322 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1076572793 10:131443667-131443689 CACAGCAGCCGCGCAGGTGCCGG + Intergenic
1076911903 10:133394508-133394530 TCCCGCAGCTGCGCAGGGGAAGG - Intronic
1076919737 10:133445432-133445454 GACAGCGGCTGCGCAGGTGAAGG + Intergenic
1077537794 11:3132812-3132834 ACCAGATGCAGCGCAGGTGAGGG + Intronic
1077541487 11:3148518-3148540 TCCAGCGGCTGTCCAGGTGGAGG + Intronic
1077607185 11:3620230-3620252 TTCAGCTGCTGGGCATGTGCTGG + Intergenic
1077673807 11:4180655-4180677 ACCAGATGCTGAGCAGATGCCGG + Intergenic
1077778145 11:5294391-5294413 TCCCCCTGCAGCCCAGGTGCGGG - Intronic
1077888973 11:6405279-6405301 TCAAACTGCTGTGCAGGTCCTGG - Intronic
1078113883 11:8425916-8425938 TCCAGATGCTGCCCTGGTGTTGG - Intronic
1078251828 11:9622983-9623005 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1078618842 11:12889399-12889421 GCCAGCTGCTGCCCTGGTGGGGG - Intronic
1078743618 11:14091275-14091297 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1079615123 11:22482567-22482589 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
1079726148 11:23883379-23883401 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1080105954 11:28512281-28512303 TCCACCTGCTGCCCCGGTGCGGG - Intergenic
1080107428 11:28525745-28525767 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1080551913 11:33379865-33379887 TCTAGGTGCTGTGCAGGGGCAGG + Intergenic
1080557620 11:33431691-33431713 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1080621521 11:33990511-33990533 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1080781748 11:35435957-35435979 TCCTGCTGCTGCCCAGGCGGCGG + Exonic
1081125134 11:39312244-39312266 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1081126863 11:39333017-39333039 TCCACCTGCGGCCCCGGTGCAGG - Intergenic
1081420972 11:42874325-42874347 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
1081607100 11:44534119-44534141 GCCAGGTGCTGTGCTGGTGCTGG + Intergenic
1082698686 11:56401868-56401890 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1083164181 11:60873486-60873508 TCCTGCTGCTGCACCAGTGCTGG + Exonic
1083260683 11:61521193-61521215 TCCAGGGGCTGAGCAGGAGCTGG + Intronic
1083320388 11:61842466-61842488 TCCAGATTCTGGGCAGGGGCCGG + Intronic
1083546183 11:63550616-63550638 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1084107485 11:66989205-66989227 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1084199055 11:67543322-67543344 GCCAGCTGCTGTTCAGGAGCAGG + Intergenic
1084210540 11:67619449-67619471 TCCATCTGCAGCACCGGTGCAGG + Intergenic
1084305862 11:68282965-68282987 TGCAGCTGCAGCCCAGGAGCAGG - Intergenic
1085245677 11:75098620-75098642 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1085375961 11:76060977-76060999 TCCACCTGCGGCCCTGGTGCGGG + Intronic
1085447181 11:76608977-76608999 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1085469110 11:76745566-76745588 TCCAGCTGCTGGGCAGAGACAGG + Intergenic
1086397675 11:86433471-86433493 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1086808093 11:91269168-91269190 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1087117838 11:94543960-94543982 AGCAGCTGCCGCGCAGGAGCAGG - Exonic
1087354611 11:97077012-97077034 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1087486314 11:98763356-98763378 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1087683732 11:101241194-101241216 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1088288195 11:108208470-108208492 TCCAGCTGCTCTGGAGGTGGAGG + Intronic
1088570949 11:111222389-111222411 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1089629973 11:119778451-119778473 TCCAGCTGCTGAACATCTGCAGG + Intergenic
1089800318 11:121022072-121022094 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1090075831 11:123579520-123579542 TCCAGCGGCTCGGCAGGTGCAGG + Intronic
1090229301 11:125089909-125089931 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1090307608 11:125704650-125704672 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1090657169 11:128854928-128854950 TCTAGCTGGAGCGCACGTGCAGG + Intronic
1090776650 11:129971780-129971802 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1091233375 11:134002836-134002858 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1092137502 12:6159887-6159909 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
1092142033 12:6190819-6190841 TCCACCTGCAGCGCTGGTGCGGG - Intergenic
1092147627 12:6225519-6225541 TCCAGCTTCTACACAGGTGAGGG + Exonic
1092471845 12:8787678-8787700 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1092473040 12:8795137-8795159 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1092583762 12:9876119-9876141 TCCACCTGCAGCCCAGGTGCGGG - Intergenic
1092834150 12:12472382-12472404 TCCACCTGCAGCTCTGGTGCAGG - Intergenic
1093189478 12:16057787-16057809 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1093346324 12:18040623-18040645 TCCACCTGCGGCCCTGGTGCAGG + Intergenic
1093527018 12:20115178-20115200 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1093653833 12:21673955-21673977 TCCACCTGCTGCCCAGGTGCGGG - Intronic
1093793795 12:23286340-23286362 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1093973030 12:25391841-25391863 TCCATCTGCAGCCCTGGTGCAGG + Intergenic
1094338527 12:29386189-29386211 TCCACCTGCAGCCCAGGTGCGGG - Intergenic
1094409911 12:30157272-30157294 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1094448799 12:30562045-30562067 TCCACCTGCAGCCCGGGTGCGGG + Intergenic
1094661358 12:32472704-32472726 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1094666559 12:32526084-32526106 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1094718122 12:33033879-33033901 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1094843661 12:34352188-34352210 CCCCGCTGCCGCGCATGTGCGGG - Intergenic
1095180873 12:39145268-39145290 TCCACCTGCTTCGCCGGCGCTGG - Intergenic
1095478575 12:42610895-42610917 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1097128865 12:56795787-56795809 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1097684100 12:62676319-62676341 ACCAGCTGCTGCAAAGATGCTGG + Intronic
1099559550 12:84155071-84155093 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1100326944 12:93549220-93549242 TCCAGGTGCTGAGCATGTCCTGG - Intergenic
1100584767 12:95969546-95969568 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1100600710 12:96109274-96109296 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1100734560 12:97512733-97512755 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1100864596 12:98843441-98843463 ACCAGAAGCTGAGCAGGTGCTGG + Intronic
1101009067 12:100430714-100430736 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1101021696 12:100559794-100559816 TCCACCTGCAGCCCTGGTGCCGG + Intronic
1101461891 12:104905460-104905482 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1102309835 12:111836065-111836087 TCCACCTGCGGCCCGGGTGCAGG + Intergenic
1102387180 12:112519880-112519902 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1103146073 12:118597124-118597146 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1103783317 12:123414061-123414083 TCCATCTGCAGCCCCGGTGCGGG - Exonic
1104344571 12:127983797-127983819 TCCACCTGCGGCCCTGGTGCGGG + Intergenic
1104462453 12:128966619-128966641 GCCAGGTGCTGCCCAAGTGCTGG - Intronic
1104582714 12:130022467-130022489 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1104749316 12:131228224-131228246 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1105037825 12:132939166-132939188 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1105876612 13:24560654-24560676 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1106643359 13:31608777-31608799 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1106692886 13:32137562-32137584 TACACCTGCTACACAGGTGCTGG + Intronic
1107298729 13:38942633-38942655 ACCAGAAGCTGAGCAGGTGCTGG + Intergenic
1107311754 13:39086020-39086042 TCCAGCAGTTGCCCAGGTCCTGG + Intergenic
1107590390 13:41898527-41898549 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1108469385 13:50753255-50753277 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1108858885 13:54829448-54829470 TCCATCTGCAGCCCCGGTGCGGG - Intergenic
1109124646 13:58504219-58504241 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1109141120 13:58714495-58714517 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1109441438 13:62379641-62379663 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1109512461 13:63396960-63396982 TCCAGCTGCTGCACACAGGCAGG - Intergenic
1109745889 13:66622361-66622383 TCCACCTGCAGCCCCGGTGCAGG + Intronic
1110023998 13:70511859-70511881 TCCACCTGCAGCTCTGGTGCGGG - Intergenic
1110225980 13:73120471-73120493 TCCAGCTGCTCGGGAGGTGGAGG - Intergenic
1110368946 13:74718800-74718822 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1111556102 13:89883814-89883836 TCCACCTGCAGGGCTGGTGCGGG - Intergenic
1111841338 13:93454734-93454756 TCCACCTGCAGCCCGGGTGCGGG - Intronic
1112282627 13:98076283-98076305 TCCACCTGCGGCCCGGGTGCAGG - Intergenic
1112533095 13:100223997-100224019 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1112613174 13:100976108-100976130 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1113050528 13:106206400-106206422 TCCAGCTACTTCGGAGGTGAAGG - Intergenic
1113102363 13:106734555-106734577 TCCATCTGCTGCACAGCTGCAGG + Intergenic
1113482612 13:110632977-110632999 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1113538058 13:111083820-111083842 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1114183139 14:20381906-20381928 TCCAGAGTCTGCGCAGGTACAGG - Exonic
1114560239 14:23584829-23584851 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1114735683 14:25041428-25041450 TCCTGCTGCTGAGAAGGAGCTGG - Intronic
1116151163 14:41144635-41144657 TCCAGCTGCCGCGGTGGGGCAGG + Intergenic
1116250960 14:42482333-42482355 TCCACCTGCAGCCCCGGTGCCGG - Intergenic
1116651869 14:47603993-47604015 CCCAGAAGCTGAGCAGGTGCCGG + Intronic
1116689381 14:48085250-48085272 TCCAGATACTGAGCAGATGCTGG - Intergenic
1116804502 14:49479553-49479575 GCCAGCTACAGCGTAGGTGCTGG - Intergenic
1117077941 14:52122657-52122679 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1117297635 14:54393852-54393874 TCCATCTGCAGCCCCGGTGCGGG + Intergenic
1117571854 14:57056564-57056586 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1119673371 14:76536698-76536720 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1120029372 14:79623209-79623231 TACAGCTGCAGAGCAGGTGTGGG + Intronic
1120696817 14:87653994-87654016 TCCTGCAGCTGTGCAGGTGGGGG + Intergenic
1121021594 14:90583617-90583639 TCCAGCTGCAGGGCAGGGTCTGG + Intronic
1121048129 14:90802737-90802759 GGACGCTGCTGCGCAGGTGCAGG + Intronic
1122493385 14:102135459-102135481 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1123799215 15:23803326-23803348 TCCATCTGCAGCCCAGGTGCGGG + Intergenic
1124114777 15:26831127-26831149 TCCATCTGCAGCCCTGGTGCGGG - Intronic
1124573201 15:30884169-30884191 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1124818404 15:33019434-33019456 TCCACCTGCGGCCCCGGTGCAGG - Intronic
1125112289 15:36047365-36047387 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1125546944 15:40512797-40512819 TCCAGCTGCTGCCCTGCTCCAGG + Intergenic
1125609772 15:40962031-40962053 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1126342335 15:47654809-47654831 TCCAGAAGCTGAGCAGGTGTTGG + Intronic
1126592706 15:50355451-50355473 CCCCGCTGCCGCGCAGGCGCCGG - Intergenic
1126693985 15:51310546-51310568 TCAAGCTGCTGCCAAGGTGATGG - Intronic
1127765994 15:62186512-62186534 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1128110914 15:65075437-65075459 TCCACCTGCAGCCCTGGTGCAGG + Intronic
1128598498 15:68975617-68975639 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1128669912 15:69567306-69567328 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1128813235 15:70587122-70587144 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1129233916 15:74212414-74212436 TCCAGCTCCTGCTCAGCTGGAGG + Intergenic
1129280321 15:74480292-74480314 TCCACCTGCAGCGCAGGTGTGGG - Intergenic
1129373942 15:75115944-75115966 TCCACCTGCAGCCCCGGTGCAGG - Intronic
1129777430 15:78246085-78246107 TCCACCTGCAGCCCGGGTGCGGG - Intergenic
1129888777 15:79057291-79057313 TCCAGCTACTGCGCACTTCCTGG + Intronic
1130132939 15:81159034-81159056 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1131012632 15:89031647-89031669 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1131507858 15:93032240-93032262 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1131585389 15:93687645-93687667 TTCAGCTGCTGCGCAGTTTGGGG + Intergenic
1131992316 15:98104213-98104235 TCCACCTGCCGCCCCGGTGCAGG - Intergenic
1132098805 15:99008224-99008246 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1132628167 16:902206-902228 TCCGGCTGCTGCGCTGGCCCAGG - Intronic
1133362585 16:5186312-5186334 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1134232563 16:12439949-12439971 TCCAGCTGGTGTGTGGGTGCAGG + Intronic
1135262051 16:20989590-20989612 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1135280931 16:21153010-21153032 TCCACCTGCAGCCCCGGTGCAGG + Intronic
1135299322 16:21312728-21312750 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1135942628 16:26836047-26836069 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1136163369 16:28435781-28435803 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1136199594 16:28679206-28679228 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1136215940 16:28793379-28793401 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1136470110 16:30474128-30474150 GCCACCTGCTGGGCACGTGCAGG + Intronic
1137442584 16:48509100-48509122 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
1138561559 16:57803565-57803587 TCCTGCTGCCGCCCAGGCGCTGG + Intronic
1139125467 16:64072276-64072298 TCCATCTGCAGCCCTGGTGCGGG - Intergenic
1139442377 16:66974641-66974663 TCCACCTGCTGCCCCAGTGCTGG + Exonic
1139676482 16:68527113-68527135 TCCAACTGCAGCCCCGGTGCGGG + Intergenic
1141141775 16:81501064-81501086 TCCAGGAGCTGCTCAAGTGCCGG + Intronic
1141447418 16:84070425-84070447 TCCAGCTGCTCCGGAGGCCCTGG + Intronic
1141465670 16:84204563-84204585 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141584313 16:85023280-85023302 TCCAGCTACTCCGGAGGTGGAGG - Intergenic
1141610224 16:85177012-85177034 TCCAGCTGCTGCCAAGGAGAGGG - Intronic
1141732759 16:85833825-85833847 GCCACCTGCTGCGGAGGAGCAGG - Intergenic
1141899390 16:86980795-86980817 GCCAGCTGCTGCCCAGTAGCAGG - Intergenic
1141900181 16:86985838-86985860 GCCAGCTGCTGCCCAGTAGCAGG - Intergenic
1141924730 16:87160629-87160651 ACCTTCTGCTGCTCAGGTGCTGG + Intronic
1141984870 16:87573166-87573188 TCCAGGTGCTGCACTGGGGCTGG + Intergenic
1142361790 16:89630867-89630889 TTCAGCTTCTGCGACGGTGCCGG + Intronic
1142505739 17:362006-362028 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1142737531 17:1910761-1910783 CCCAGCTGCTCCGGAGGTGGAGG - Intergenic
1143881515 17:10033727-10033749 GCCAGCTGGATCGCAGGTGCAGG - Intronic
1144467220 17:15506101-15506123 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1144723278 17:17486765-17486787 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1146306100 17:31730962-31730984 TGCAGCTGCTGTGGAGGTGCTGG - Intergenic
1146488338 17:33261989-33262011 TCCAGATGCTGCCCTGGAGCGGG - Intronic
1146740387 17:35278861-35278883 TCCACCTGCTGCCCTGGTGGGGG - Intergenic
1147431886 17:40376242-40376264 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1148016947 17:44528386-44528408 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1148204048 17:45768515-45768537 TCCAGGTCCTGCCCTGGTGCTGG + Intergenic
1149916476 17:60614051-60614073 TCCACCTGCGGCCCCGGTGCGGG + Intronic
1150289443 17:63973033-63973055 TGCTGCTGCTGCACAGGTGCTGG + Intergenic
1150521163 17:65867237-65867259 TCCAGCTGCTGTGCACAGGCCGG - Intronic
1150804537 17:68308860-68308882 TCCACCTGCAGCGCCGGTGCGGG - Intronic
1150819733 17:68425542-68425564 TGCAACTGCTGGGGAGGTGCGGG + Intronic
1151567394 17:74906991-74907013 TCCACCTGCGGCCCCGGTGCAGG - Intergenic
1151660772 17:75516844-75516866 CCGAGCGGCTGCGCCGGTGCCGG + Exonic
1151672778 17:75580912-75580934 TCCAGCTGCGGCCCTGGTACTGG + Intergenic
1151768075 17:76142248-76142270 TCCAGCTCCTGGGCAGAGGCGGG - Intergenic
1152157771 17:78646140-78646162 CCCAGCTGCTCCTCAGTTGCAGG + Intergenic
1152594068 17:81229657-81229679 AGCAGCTGCTGGGCTGGTGCTGG + Intronic
1152991465 18:367297-367319 TTATGCTGCTGAGCAGGTGCTGG + Intronic
1153771771 18:8422419-8422441 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
1153832390 18:8935371-8935393 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1154057166 18:11023597-11023619 TCCACCTGCCGCCCCGGTGCGGG - Intronic
1155207974 18:23577577-23577599 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1156038743 18:32794986-32795008 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1156455363 18:37290198-37290220 TCCAGCTGCTGTGCATGGACAGG - Intronic
1156863727 18:41866170-41866192 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1156943240 18:42795642-42795664 TCCACCTGCAGCCCGGGTGCGGG + Intronic
1157856835 18:51111791-51111813 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1157979728 18:52366851-52366873 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1158282238 18:55840654-55840676 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1158460666 18:57643607-57643629 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1158697188 18:59714040-59714062 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1158705682 18:59790403-59790425 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1159230878 18:65605666-65605688 TCCATCTGCAGCCCCGGTGCGGG + Intergenic
1159472873 18:68879943-68879965 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1159590513 18:70330281-70330303 TCCAGCCCCTGCGCAGTTCCTGG - Intergenic
1159656033 18:71031285-71031307 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1159744030 18:72209540-72209562 TCCACCTGCTGCCCCGGTGCAGG + Intergenic
1160176546 18:76600078-76600100 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1160198628 18:76777657-76777679 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1160222661 18:76988678-76988700 CACAGCGGCTGTGCAGGTGCGGG + Intronic
1160322969 18:77913901-77913923 TCCAGGTGCTGGGTGGGTGCTGG + Intergenic
1160491303 18:79338342-79338364 TCCAGCTACGGAGAAGGTGCTGG - Intronic
1160539655 18:79613599-79613621 CCCAGCTGCTGTGAGGGTGCCGG + Intergenic
1160578667 18:79871394-79871416 GCCAGCTGGTGCTCAGGTCCAGG - Intronic
1160597650 18:79988356-79988378 GCCAGCCGTTGTGCAGGTGCGGG + Exonic
1161106116 19:2444890-2444912 TCCAGCTGCTGTGCTGGTCCAGG - Intronic
1161401354 19:4067267-4067289 CCCAGCCTCTGCGCAGGGGCGGG + Intergenic
1161597104 19:5156198-5156220 GCCACCTGCTGCCCAAGTGCTGG + Intergenic
1162107070 19:8376177-8376199 TCCACCTGCAGCCCCGGTGCAGG + Intronic
1162230217 19:9259926-9259948 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1162632631 19:11941243-11941265 TCCACCTGCAGCCCTGGTGCAGG - Intronic
1162814653 19:13186651-13186673 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1162987169 19:14278019-14278041 TCCACCTGCTGCCCTGGTGCGGG + Intergenic
1163218922 19:15900096-15900118 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1163692127 19:18743740-18743762 TCCAGCGGCGGTGCAGGTGGCGG - Intronic
1164143961 19:22498936-22498958 TCCATCTGCAGCCCCGGTGCGGG - Intronic
1164270521 19:23668475-23668497 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1165314540 19:35046617-35046639 TCCAGGTGCTGGCCTGGTGCCGG + Intronic
1165389715 19:35531434-35531456 TCAACCTGCTGTGCAGGTGATGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167782286 19:51606728-51606750 TGCCCCTGCTGTGCAGGTGCAGG - Intergenic
1168262636 19:55205127-55205149 TCCAGCTGCTAAGCTGGGGCCGG - Intronic
1202711496 1_KI270714v1_random:21754-21776 CCCAGGTGCTGGGCAGGTGAAGG + Intergenic
925098905 2:1229546-1229568 TCCACCTGCAGCCCCGGTGCCGG - Intronic
925537738 2:4935262-4935284 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
926308205 2:11655435-11655457 TCATGCTGCTGCCCAGGAGCTGG - Intergenic
926468866 2:13227734-13227756 AGCAGCTGGTGAGCAGGTGCAGG + Intergenic
926524230 2:13956693-13956715 TCCAGCAGGTTCGCAGGTGAAGG - Intergenic
926690742 2:15731537-15731559 TCCAACTGCTTTGCAGGGGCTGG - Intronic
926980230 2:18560465-18560487 TCCAGCGGCTGCGCAGAGGCGGG - Exonic
927196738 2:20553001-20553023 ACCGGATGCTGAGCAGGTGCTGG - Intergenic
927900476 2:26814772-26814794 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
927942123 2:27111461-27111483 TCCACCTGCGGCCCCGGTGCAGG - Intronic
928401266 2:30980302-30980324 TCCTGCTGCTCCGCAGCTGTGGG - Intronic
928753267 2:34494706-34494728 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
929233781 2:39585768-39585790 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
929269041 2:39952558-39952580 ACCAGATGCTGAGCAGATGCTGG + Intergenic
929379760 2:41336003-41336025 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
929588989 2:43133159-43133181 TGCAGGTGCTCAGCAGGTGCAGG + Intergenic
929951660 2:46414835-46414857 TCCAGCTACTGGGGAGGTGGAGG + Intergenic
930039286 2:47107692-47107714 TCCACCTGCAGCCCTGGTGCGGG + Intronic
930468159 2:51780283-51780305 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
932230573 2:70080917-70080939 CCCAGCTGCTGGGCAGGTTGAGG - Intergenic
932740292 2:74285876-74285898 CCCAGCTGCTGAGCAGCTCCAGG - Exonic
932902118 2:75711987-75712009 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
933060771 2:77734727-77734749 TCCACCTGCGGCCCCGGTGCCGG - Intergenic
933442027 2:82326231-82326253 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
933487182 2:82938389-82938411 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
933506384 2:83181412-83181434 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
935408620 2:102736267-102736289 CCCAGCTGCTGTGCGGCTGCTGG - Intronic
935806648 2:106754982-106755004 CCCAGCTGCTGGGGAGGTGGAGG + Intergenic
935896773 2:107747288-107747310 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
936172639 2:110190180-110190202 TCCACCTGCAGCCCTGGTGCGGG - Intronic
936252723 2:110879288-110879310 TCCAGCTGCTGTCCTGGTGTGGG - Intronic
936346961 2:111682263-111682285 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
936407362 2:112218002-112218024 GCCAGCTGCTGTGGAGGTGGAGG - Intronic
937209525 2:120259698-120259720 TCCACCTGCAGCCCCGGTGCGGG - Intronic
937643163 2:124236358-124236380 TTCTGCTCCTGGGCAGGTGCAGG - Intronic
938126008 2:128672070-128672092 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
938401095 2:130991857-130991879 TCCACCTGCAGCCCCGGTGCGGG + Intronic
938804572 2:134794276-134794298 TCCAGGAGCTTCTCAGGTGCAGG - Intergenic
939229835 2:139410754-139410776 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
939281825 2:140074192-140074214 TCCACCTGCAGCCCAGGTACGGG + Intergenic
939972477 2:148678348-148678370 TCCATCTGCAGCCCTGGTGCGGG - Intronic
940742674 2:157528195-157528217 CCCAGCTGAGGGGCAGGTGCGGG - Exonic
941309856 2:163914030-163914052 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
941705801 2:168657386-168657408 TCCACCTGCAGCCCCGGTGCGGG - Intronic
942795519 2:179814265-179814287 GCCAGCTGCTGTGGAGGTGCAGG - Intronic
943106091 2:183546626-183546648 TCCACCTGCTGCCCCAGTGCAGG - Intergenic
943494675 2:188606342-188606364 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
943790102 2:191922000-191922022 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
943811456 2:192194485-192194507 TCCAGCTGCTGCACTGCCGCGGG + Exonic
943906052 2:193502409-193502431 TCCACCTGCTGCCCGGGTGCAGG - Intergenic
944729710 2:202503783-202503805 TCCACCTGCAGCCCAGGTGTGGG + Intronic
944761975 2:202825171-202825193 TTCAGATGCTGCGCAGGCCCAGG + Intronic
944857860 2:203785521-203785543 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
945745851 2:213718904-213718926 TCCACCTGCAGCCCTGGTGCGGG + Intronic
945872760 2:215245688-215245710 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
947026705 2:225744546-225744568 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
948676124 2:239597756-239597778 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
948992839 2:241563487-241563509 TCCAAGTGCTGTCCAGGTGCTGG + Intronic
1168897088 20:1331152-1331174 TCCAGCTGAGGCAGAGGTGCTGG - Intronic
1169814385 20:9641537-9641559 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1170649571 20:18227177-18227199 TCCACCTGCTGCCCTGGTGCTGG + Intergenic
1170989963 20:21292292-21292314 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1171234074 20:23510173-23510195 CCCAGCGGGTGCGCATGTGCAGG + Intergenic
1172217849 20:33249119-33249141 TCCAGAAGCTGAGCAGATGCTGG - Intergenic
1173601669 20:44299547-44299569 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1175210142 20:57348810-57348832 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1175767410 20:61601120-61601142 TCCAGAAGCTGAGCAGATGCCGG - Intronic
1175829575 20:61954762-61954784 TGCATCTGCTGCCCACGTGCAGG + Intronic
1175855880 20:62120894-62120916 TCCAGCTCCTGGGGAGGTGGAGG - Intergenic
1176045091 20:63088421-63088443 CACAGCTGCAGCCCAGGTGCTGG - Intergenic
1176342606 21:5712903-5712925 TCCAGCTGCTGGGGAGGAACTGG - Intergenic
1176344766 21:5733456-5733478 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1176351580 21:5854040-5854062 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1176381813 21:6117556-6117578 TCCACCTGGTGCTCAGGTGTGGG + Intronic
1176454472 21:6897344-6897366 TCCGGCTGCTGAGCAGCTTCTGG - Intergenic
1176474860 21:7145054-7145076 TCCAGCTGCTGGGGAGGAACTGG - Intergenic
1176500061 21:7590999-7591021 TCCACCTGCGGCCCTGGTGCGGG + Intergenic
1176502221 21:7611553-7611575 TCCAGCTGCTGGGGAGGAACTGG + Intergenic
1176536927 21:8110972-8110994 TCCAGCTGCTGGGGAGGAACTGG - Intergenic
1176539087 21:8131526-8131548 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1176558038 21:8314571-8314593 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1176604747 21:8819905-8819927 TGCAGCAGCTGCACAGGGGCGGG + Intergenic
1176663290 21:9660414-9660436 TCCACCTGCGGCCCTGGTGCAGG + Intergenic
1176832645 21:13762392-13762414 TCCGGCTGCTGAGCAGCTTCTGG - Intergenic
1177942324 21:27425826-27425848 CCCAGCTGCTTCCCACGTGCTGG - Intergenic
1178327063 21:31654598-31654620 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
1178398815 21:32265744-32265766 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1178585576 21:33868265-33868287 TCCAGCTGCAGCCCCGGTGTGGG - Intronic
1178670858 21:34590602-34590624 ACCAGGTGCTGAGCAGGTGCTGG - Intronic
1178983283 21:37283133-37283155 TCCAGCTGCAGCCCCGGTGTGGG - Intergenic
1179084554 21:38206012-38206034 TCCAGCTGCTCTGGAGCTGCTGG - Intronic
1179605704 21:42513978-42514000 GCCGGCTGCCCCGCAGGTGCGGG - Exonic
1179741659 21:43420683-43420705 TCCACCTGGTGCTCAGGTGTGGG - Intronic
1180347037 22:11711510-11711532 TGCAGCAGCTGCACAGGGGCGGG + Intergenic
1180383466 22:12162731-12162753 TGCAGCAGCTGCACAGGGGCGGG - Intergenic
1180755160 22:18155900-18155922 TCCACCTGCGGCCCAGGTGTGGG + Intronic
1180830885 22:18905686-18905708 ACCAGCTGCTGGGCCGGGGCTGG - Intergenic
1180982490 22:19885397-19885419 TCCAGCTGCTGTCCCGGGGCAGG + Intronic
1181068952 22:20320625-20320647 GCCAGCTGCTGGGCCGGGGCTGG + Intergenic
1181077603 22:20392358-20392380 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1181522626 22:23458376-23458398 TGCAGCTGCTGGGCAGGGGTGGG - Intergenic
1181602188 22:23959228-23959250 TCCAGCTGCTGGGCAGGAAAAGG - Intronic
1181606321 22:23982079-23982101 TCCAGCTGCTGGGCAGGAAAAGG + Intronic
1182502021 22:30754769-30754791 TCCTGCTGCTGTGCTGGGGCAGG + Intronic
1182615223 22:31583870-31583892 TTTAGCTGCTGCACAGGTTCTGG + Exonic
1183241034 22:36658641-36658663 TCCAGCCCTTGCCCAGGTGCTGG + Intronic
1183685308 22:39358012-39358034 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1183959663 22:41403871-41403893 TACTGCTGCTGCGCATGGGCAGG - Intergenic
1184420597 22:44380835-44380857 TCCCGCTGCTGCGGGGGTTCTGG - Intergenic
1184498737 22:44859444-44859466 TCCAGAAGCTGAACAGGTGCTGG + Intronic
1185064908 22:48627328-48627350 TGCAGCTGCCGGGCACGTGCTGG - Intronic
1203241876 22_KI270733v1_random:27376-27398 TCCAGCTGCTGGGGAGGAACTGG - Intergenic
1203244037 22_KI270733v1_random:47881-47903 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1203280973 22_KI270734v1_random:130957-130979 ACCAGCTGCTGGGCCGGGGCTGG - Intergenic
949259051 3:2084040-2084062 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
949539397 3:5020408-5020430 TCCAGATGCTGGGCTGGTGGTGG - Intergenic
949749383 3:7333263-7333285 TCCAGCACCTGCTCAGGTGGAGG - Intronic
950256893 3:11513193-11513215 TCCACCTGCAGCCCCGGTGCGGG - Intronic
950600313 3:14029443-14029465 TCCACCTGCAGCCCCGGTGCAGG - Intronic
951146521 3:19234232-19234254 TCCACCTGCAGCCCCGGTGCGGG - Intronic
952275321 3:31870528-31870550 TCCACCTGCAGCCCCGGTGCGGG + Intronic
952713384 3:36453715-36453737 TCCACCTGCAGCCCCGGTGCGGG + Intronic
952730721 3:36634320-36634342 TCCATCTGCAGCCCCGGTGCGGG + Intergenic
953002961 3:38951564-38951586 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
953089902 3:39713728-39713750 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
954620209 3:51990985-51991007 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
956195811 3:66651940-66651962 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
956481525 3:69677858-69677880 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
956632670 3:71331510-71331532 TCCACCTGCGGCCCCGGTGCGGG + Intronic
956855332 3:73269605-73269627 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
957560093 3:81811956-81811978 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
957919608 3:86731458-86731480 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
958810692 3:98857920-98857942 TCCACCTGCAGCCCCGGTGCGGG - Intronic
959252632 3:103966876-103966898 TCCAGCTGCTGCAGTGGGGCAGG - Intergenic
960149727 3:114238237-114238259 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
960199337 3:114812644-114812666 TCCACCTGCAGCCCGGGTGCGGG - Intronic
960761595 3:121078479-121078501 TCCACCTGCGGCCCTGGTGCAGG - Intronic
961460534 3:127047090-127047112 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
961484598 3:127208166-127208188 TCAAGCTGCTGTGCTGGTGAAGG - Intergenic
961862901 3:129931751-129931773 TCCAGCAGCTGCTAAGGTGCTGG + Intergenic
962283211 3:134067322-134067344 TCCTGCCGCTGCACAGGAGCAGG + Intronic
962349100 3:134643940-134643962 CCCAGCTGCTCCGGAGGTGGAGG - Intronic
962722463 3:138188104-138188126 TTCAGCCGGTGCCCAGGTGCTGG - Intronic
963397287 3:144750221-144750243 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
963440481 3:145333790-145333812 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
963589920 3:147245552-147245574 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
963742850 3:149097668-149097690 TCCACCTGCAGCCCAGGTGCAGG - Intergenic
963744226 3:149109769-149109791 TCCACCTGCAGCCCGGGTGCAGG + Intergenic
963760663 3:149284399-149284421 TCCACCTGCGGCCCTGGTGCGGG + Intergenic
964014457 3:151928569-151928591 TCCACCTGCAGCTCCGGTGCGGG + Intergenic
965109347 3:164401836-164401858 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
965220140 3:165918393-165918415 TCCACCTGCAGCACCGGTGCAGG - Intergenic
965220827 3:165924284-165924306 TCCACCTGCCGCCCAGGTGCGGG - Intergenic
965298199 3:166976246-166976268 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
965446536 3:168780521-168780543 TCCACCTGCAGCCCTGGTGCTGG + Intergenic
966190941 3:177271675-177271697 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
966725075 3:183101313-183101335 TCCACCTGCAGCCCCGGTGCGGG + Intronic
966853445 3:184178236-184178258 TCAAGCTGCTGCCCAGGTACAGG + Intronic
967499079 3:190176996-190177018 TCCATCTGCAGCCCCGGTGCAGG - Intergenic
967805217 3:193709748-193709770 TCCAACTGCTCTGCTGGTGCTGG + Intergenic
968610273 4:1553903-1553925 TCCCACAGCTGCGGAGGTGCAGG - Intergenic
968698755 4:2044899-2044921 CCCAGCCTCTGAGCAGGTGCTGG - Intergenic
968912840 4:3484677-3484699 TCCTGCTGCTGTGGGGGTGCAGG + Intronic
969026894 4:4180528-4180550 CCCAGCTGCTCGGGAGGTGCAGG + Intergenic
969440812 4:7215542-7215564 TCCACCTGCAGCCCCGGTGCGGG + Intronic
969464774 4:7349705-7349727 CCCAGGTGCTGCGGAGGTCCAGG + Intronic
969654906 4:8491357-8491379 TCCACCTGCTGCCCTGGTGCGGG - Intronic
970615685 4:17766756-17766778 TCCGCCTGCTGCCCCGGTGCGGG - Intronic
970649251 4:18159217-18159239 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
970673092 4:18418284-18418306 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
970709218 4:18842626-18842648 TCCAGCTGCTGTGGCGGTGTGGG + Intergenic
970803604 4:20004428-20004450 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
971455916 4:26843788-26843810 CCCAGAAGCTGAGCAGGTGCTGG - Intergenic
971563631 4:28113189-28113211 TCCACCTGCAGCCCAGGTGTGGG + Intergenic
971905119 4:32716172-32716194 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
972531096 4:39962171-39962193 CCCAGCTGCTGGGCAGGTGGAGG - Intronic
972900198 4:43672771-43672793 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
973041734 4:45477298-45477320 TCCACCTGCGGCCCCGGTGCAGG - Intergenic
973373378 4:49271032-49271054 TGCAGCAGCTGCACAGGGGCGGG - Intergenic
973387632 4:49524176-49524198 TGCAGCAGCTGCACAGGGGCGGG + Intergenic
973587689 4:52409692-52409714 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
973852672 4:54976843-54976865 TCCCTCTGGTGTGCAGGTGCTGG - Intergenic
973894281 4:55396328-55396350 TGCAGCTGCTGGGCCGGCGCCGG - Exonic
973951970 4:56025028-56025050 ACCAGCTGCTGGGGAGGTGGGGG + Intronic
974128890 4:57729719-57729741 TCCACCTGCGGCCCAGGTGTGGG - Intergenic
974484713 4:62491844-62491866 TCCACCTGCAGCCCAGGTGCAGG - Intergenic
974590515 4:63942829-63942851 TCCATCTGCAGCCCAGGTGCGGG - Intergenic
974804460 4:66860582-66860604 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
975595114 4:76043241-76043263 TCCACCTGCAGCCCTGGTGCGGG - Intronic
975596292 4:76050603-76050625 TCCACCTGCAGCCCTGGTGCGGG - Intronic
975994998 4:80303207-80303229 TCCACCTGCTGCCCCAGTGCGGG + Intronic
976847866 4:89510791-89510813 ACCAGCAGCTGAGCAGATGCTGG + Intergenic
976980224 4:91217917-91217939 TCCACCTGCAGCCCCGGTGCGGG - Intronic
977750891 4:100608712-100608734 TCCACCTGCAGCCCCGGTGCGGG - Intronic
978080324 4:104582394-104582416 TCCATCTGCAGCCCCGGTGCGGG + Intergenic
979290744 4:118976997-118977019 TCCAGCTGCAGCCCCGGTGCGGG - Intronic
979308394 4:119174199-119174221 TCCACCTGCAGCCCTGGTGCGGG + Intronic
979688666 4:123538330-123538352 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
979899633 4:126201238-126201260 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
979991537 4:127380354-127380376 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
980043306 4:127964184-127964206 TCCACCTGCAGCCCCGGTGCGGG - Intronic
980595363 4:134948098-134948120 TCCACCCGCTGCCCTGGTGCAGG - Intergenic
980628665 4:135407032-135407054 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
980815629 4:137942484-137942506 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
981061190 4:140427247-140427269 TCCACCTGCTGCGCCCGGGCTGG - Intronic
982647735 4:158044540-158044562 TCCACCGGCTGCCCGGGTGCGGG + Intergenic
982728261 4:158928115-158928137 TCCACCTGCAGCACAGGTGTGGG + Intronic
982814508 4:159868979-159869001 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
984238745 4:177193143-177193165 TCCACCTGCAGCCCAGGTGCGGG - Intergenic
984241770 4:177227512-177227534 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
984770637 4:183433558-183433580 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
984901819 4:184592280-184592302 TCCACCTGCGGCCCTGGTGCGGG + Intergenic
984948646 4:184990034-184990056 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG + Intergenic
985412036 4:189695636-189695658 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
986661828 5:10065917-10065939 TCCACCTGCGGCCCGGGTGCGGG + Intergenic
986698069 5:10375570-10375592 TCCACCTGCAGCCCGGGTGCGGG + Intronic
986988788 5:13527764-13527786 CCCAGAAGCTGCGCAGATGCTGG + Intergenic
987156689 5:15096462-15096484 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
987283805 5:16436594-16436616 TCCACCTGCGGCCCTGGTGCGGG + Intergenic
987315364 5:16718365-16718387 TCCACCTGCAGCCCTGGTGCGGG + Intronic
987383938 5:17311720-17311742 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
987532708 5:19142717-19142739 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
988073579 5:26324874-26324896 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
988154982 5:27439397-27439419 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
989346867 5:40439073-40439095 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
989965893 5:50465427-50465449 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
990461594 5:56035903-56035925 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
991330165 5:65485425-65485447 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
992296808 5:75334099-75334121 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
992828317 5:80570429-80570451 TCCAGGCTCTGCGCAGGTGAGGG + Exonic
992884088 5:81140533-81140555 TCTAGCTGCTTCGCAGGCTCAGG - Intronic
992947520 5:81824127-81824149 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
993678534 5:90847464-90847486 TCCACCTGCAGCCCTGGTGCGGG - Intronic
994096416 5:95851580-95851602 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
994251439 5:97541823-97541845 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
994254722 5:97579941-97579963 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
994701630 5:103141981-103142003 TCCACCTGCAGCCCTGGTGCGGG - Intronic
994935350 5:106246624-106246646 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
995388260 5:111612098-111612120 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
995536806 5:113144685-113144707 TCCAGCTGTTGTTGAGGTGCAGG - Intronic
995568742 5:113457557-113457579 TCCACCTGCAGCCCAGGTGCAGG + Intronic
995596386 5:113753065-113753087 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
995920469 5:117305076-117305098 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
996435771 5:123430968-123430990 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
997760635 5:136444628-136444650 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
998174650 5:139894347-139894369 TCCTGCTGCTGGCCAGCTGCAGG + Intronic
1001037953 5:168311355-168311377 CCCTGCTGCTGGGCAGGTGCGGG + Intronic
1001608338 5:172980225-172980247 TCCAGCTGCTGCGGAGGGTGAGG - Intergenic
1001766983 5:174257437-174257459 TCCAGCTGTTATGCTGGTGCTGG + Intergenic
1002004563 5:176221972-176221994 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1003489159 6:6606419-6606441 TCCACCTGCCGCCCAGGTGCAGG - Intronic
1003502553 6:6714331-6714353 CCCAGCTGCTGCAGAGATGCTGG + Intergenic
1003581511 6:7344629-7344651 TCCACCTGCAGCCCCGGTGCCGG + Intronic
1003736969 6:8887579-8887601 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1003836141 6:10074657-10074679 TCCACCTGCGGCTCTGGTGCGGG - Intronic
1003845806 6:10172168-10172190 TCCACCTGCAGCCCAGGTGCGGG + Intronic
1003862865 6:10337825-10337847 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1003896951 6:10617006-10617028 TCCACCTGCGGCCCTGGTGCGGG - Intronic
1004037043 6:11933495-11933517 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1004338150 6:14783550-14783572 TCCACCTGCGGCCCAGGTGTGGG - Intergenic
1004665462 6:17745254-17745276 TCCACCTGCAGCTCCGGTGCGGG - Intergenic
1004689022 6:17976141-17976163 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1004906278 6:20239427-20239449 TCCACCTGCGGCCCCGGTGCCGG + Intergenic
1005035498 6:21552229-21552251 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1005117646 6:22356345-22356367 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1005559130 6:27020000-27020022 TCCCGCTGCTGCGCTGGTTCCGG - Intergenic
1005978159 6:30816244-30816266 TCCACCTGCAGCCCCGGTGCTGG - Intergenic
1005992834 6:30914205-30914227 GCCAGCTGCTGCGCATGCGCCGG + Intronic
1006005847 6:31000879-31000901 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1006007893 6:31017212-31017234 TCCATCTGCGGCCCAGGTGCGGG + Intronic
1006033708 6:31195875-31195897 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1006226996 6:32547870-32547892 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1006394280 6:33776970-33776992 TCAAGCTGTCGCGCACGTGCAGG + Exonic
1006477905 6:34269440-34269462 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1006719154 6:36138872-36138894 TCCAGCAGGTCCGCAGCTGCAGG - Exonic
1007738798 6:43998470-43998492 TCCACCTGCAGCCCTGGTGCAGG + Intergenic
1008771070 6:54979650-54979672 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1009470340 6:64024148-64024170 TCCACCTGCAGCCCTGGTGCGGG + Intronic
1009587719 6:65627955-65627977 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1010199240 6:73268820-73268842 TCCACCTGCAGCCCTGGTGCAGG - Intronic
1010617457 6:78030216-78030238 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1011143764 6:84189782-84189804 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1011246592 6:85326382-85326404 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1011620030 6:89234435-89234457 TCCACCTGCAGCCCTGGTGCAGG - Intergenic
1011870012 6:91881840-91881862 TCCACCTGCAGCCCGGGTGCGGG - Intergenic
1011974832 6:93283019-93283041 TCCACCTGCGGCCCCGGTGCGGG + Intronic
1012578158 6:100829178-100829200 TCCACCTGCAGCCCAGGTGCGGG - Intronic
1012760429 6:103294350-103294372 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1013080299 6:106806170-106806192 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1013081411 6:106816708-106816730 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1013410713 6:109881092-109881114 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1013853305 6:114541796-114541818 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1013963378 6:115928028-115928050 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1014240816 6:119015738-119015760 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1014507834 6:122280994-122281016 TCCACCTGTAGCCCAGGTGCGGG + Intergenic
1014788546 6:125644867-125644889 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1014921000 6:127214536-127214558 TCCACCTGCAGCCCCGGTGCCGG - Intergenic
1015600420 6:134905144-134905166 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1016067297 6:139697870-139697892 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1016217275 6:141618628-141618650 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1016482241 6:144495096-144495118 TCCACCTGCAGCCCGGGTGCGGG - Intronic
1016648202 6:146434416-146434438 TGCAGGTGCTGCGGAGGTGGCGG - Exonic
1017299053 6:152834758-152834780 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1017581142 6:155866701-155866723 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1017839421 6:158209697-158209719 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1018174462 6:161166912-161166934 TCCCGCTGCCCTGCAGGTGCTGG - Intronic
1018545741 6:164933711-164933733 TCCACCTGCAGCCCGGGTGCGGG + Intergenic
1018696122 6:166393298-166393320 TCCACCTGCGGCCCCGGTGCAGG - Intergenic
1019000191 6:168743730-168743752 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1019106412 6:169671151-169671173 TGCAGCTGCTGCACATGTCCGGG - Intronic
1019281132 7:200827-200849 TCCAGGTCCAGAGCAGGTGCAGG + Intronic
1019776699 7:2915752-2915774 TCCCCCTGCTGGGCATGTGCTGG + Intronic
1020078416 7:5273779-5273801 ACCAGCTGCTTGGCAGGTCCTGG + Intergenic
1021324197 7:19245898-19245920 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
1022174076 7:27857002-27857024 TCCACCTGCGGCCCTGGTGCAGG - Intronic
1024269151 7:47628891-47628913 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1024335560 7:48202859-48202881 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1024726879 7:52207925-52207947 TCCAGCTGCTGGGGAGGCTCAGG + Intergenic
1024741840 7:52363021-52363043 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
1024825356 7:53385107-53385129 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1025091604 7:56068816-56068838 TCCAGCTGCTCGGCAGGCGAAGG - Intronic
1025977238 7:66378761-66378783 ACCAGGTGCTGGGCAGGAGCTGG + Intronic
1026062250 7:67036907-67036929 TGCAGCTGCTGGGCAGGGACTGG + Intronic
1026335965 7:69394240-69394262 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1026512414 7:71038009-71038031 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1026716095 7:72790541-72790563 TGCAGCTGCTGGGCAGGGACTGG - Intronic
1027361765 7:77416507-77416529 TCCGGCTCCGGCTCAGGTGCGGG - Intergenic
1027561747 7:79739715-79739737 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1027667464 7:81057429-81057451 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1027674550 7:81142152-81142174 TCCACCTGCGGCCCCGGTGCGGG + Intergenic
1028511144 7:91627339-91627361 TCCACCTGCAGCTCTGGTGCGGG - Intergenic
1028778395 7:94705907-94705929 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1030733561 7:113017760-113017782 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1032410658 7:131691488-131691510 TCTAGCTGCTACGCTGGGGCGGG + Intergenic
1033758544 7:144417916-144417938 TCCACCTGCGGCCCTGGTGCGGG - Intergenic
1033801433 7:144906916-144906938 TCCAGCTGCTGCGGAGGCTGAGG + Intergenic
1033866575 7:145697359-145697381 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1034155090 7:148949495-148949517 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1034225112 7:149475549-149475571 GGCAGCTGCTGAGCAGGTGATGG - Intronic
1034632070 7:152538834-152538856 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1034655966 7:152730222-152730244 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1035184195 7:157112922-157112944 CCCTGCTGCTGCACAGGTTCTGG - Intergenic
1035685353 8:1519986-1520008 CCCAGCTGCTTCGCAGGAGCAGG + Intronic
1035754767 8:2022985-2023007 TCCTGTTGCTGCGCAGCAGCCGG + Intergenic
1035768143 8:2125200-2125222 TCCAGCGGCTTCGCAGTTTCAGG + Intronic
1036440957 8:8781338-8781360 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1036554593 8:9847746-9847768 TCCATCTGCGGCCCTGGTGCGGG - Intergenic
1036915048 8:12796677-12796699 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1037263773 8:17036764-17036786 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1037425539 8:18750990-18751012 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1037811055 8:22086982-22087004 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1038174138 8:25164909-25164931 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1038644549 8:29351122-29351144 TGCAGCGGCGGCACAGGTGCCGG - Intergenic
1039068806 8:33632094-33632116 TCCACCTGCGGCCCCGGTGCAGG + Intergenic
1039637376 8:39180541-39180563 TCCACCTGCAGCCCTGGTGCGGG + Intronic
1040026614 8:42787169-42787191 TCCACCTGCGGCCCTGGTGCGGG + Intronic
1040952639 8:52952803-52952825 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1041758286 8:61337464-61337486 TTCAGCTGCTGCGCAAGTCAGGG - Intronic
1041902690 8:62999251-62999273 TCCAAAAGCTGAGCAGGTGCCGG - Exonic
1041914592 8:63126488-63126510 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1041918999 8:63162403-63162425 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1042169420 8:65977743-65977765 TCCACCTGCGGCTCTGGTGCAGG - Intergenic
1042611881 8:70608589-70608611 TCAGGCTGCTGAGCAGGCGCAGG - Exonic
1043002146 8:74772040-74772062 GCCCGCTGCTGCGCTGGTGGGGG - Intronic
1043073271 8:75665412-75665434 TCCACCTGCGGCCCCGGTGCGGG - Intergenic
1043352421 8:79377150-79377172 TCCACCTGCTGCCCCGGTGCGGG - Intergenic
1043546440 8:81320872-81320894 GCCAGCAGCTGAGCAGATGCCGG + Intergenic
1043701190 8:83290764-83290786 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1043737881 8:83769423-83769445 AGCAGCTGCTGTGCAGATGCTGG - Intergenic
1044075893 8:87821248-87821270 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1044404955 8:91816735-91816757 TCCACCTGCAGCCCAGGTGCGGG + Intergenic
1044515770 8:93136707-93136729 TCCAGAAGCTGAGCAGATGCTGG - Intronic
1044633403 8:94300280-94300302 TCCACCTGCTGCCCCGGTGTGGG - Intergenic
1044880599 8:96719033-96719055 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1045131874 8:99163346-99163368 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1045232258 8:100316719-100316741 TCCAACTGCAGCCCTGGTGCGGG - Intronic
1045467690 8:102485460-102485482 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1046445411 8:114311764-114311786 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1046450780 8:114386569-114386591 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1047251507 8:123184717-123184739 TCCTGCTGCTGCAGAGGGGCAGG + Intronic
1048265010 8:132978129-132978151 TCCAGAAGCTGGGCAGATGCTGG - Intronic
1048373385 8:133800094-133800116 CCCTGCTGCTGCTGAGGTGCAGG - Intergenic
1049157762 8:141077054-141077076 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1049612118 8:143560632-143560654 TGCAGCAGCTGCGCAGCCGCGGG + Exonic
1049740806 8:144240020-144240042 CCCAGCTCCAGGGCAGGTGCTGG + Intronic
1051305016 9:15699991-15700013 TCCACCTGCAGCCCGGGTGCGGG - Intronic
1051449330 9:17178359-17178381 TCCACCTGCGGCCCGGGTGCGGG - Intronic
1051463870 9:17354349-17354371 TCCACCTGCAGCCCCGGTGCGGG + Intronic
1051892763 9:21959664-21959686 TCCACCTGCAGCCCTGGTGCAGG + Intronic
1052075517 9:24135480-24135502 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1052979622 9:34438359-34438381 TCCACCTGCAGCACCGGTGCGGG + Intronic
1053122413 9:35556851-35556873 TCCAGGTGCTGGGAAGGTGTTGG + Intronic
1053427200 9:38017933-38017955 TTCAGATGCTGGTCAGGTGCAGG + Intronic
1054722525 9:68617437-68617459 TCCACCTGCAGCCCTGGTGCCGG + Intergenic
1054922055 9:70552886-70552908 TCCATCGGCAGCACAGGTGCTGG + Exonic
1055102499 9:72480186-72480208 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1055814084 9:80185238-80185260 TCCACCTGCGGCCCTGGTGCTGG - Intergenic
1056301298 9:85244524-85244546 TCCAGCTCTTGTTCAGGTGCTGG + Intergenic
1056771324 9:89480365-89480387 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1057146218 9:92761026-92761048 TCCTGCAGCTGCCCAGGTGCTGG + Intronic
1057302305 9:93893992-93894014 TCCTGCAGCTGCGCATCTGCGGG + Intergenic
1057383854 9:94591091-94591113 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1057543791 9:96001666-96001688 TCCACCTGCAGCCCCGGTGCGGG - Intronic
1057684801 9:97222149-97222171 TGCAGCAGCTGCACAGGGGCGGG - Intergenic
1057726980 9:97574587-97574609 TCCACCTGCGGCCCCGGTGCAGG + Intronic
1057907121 9:98992066-98992088 TCCACCTGCTGCCCTCGTGCGGG - Intronic
1058174799 9:101724062-101724084 TCCACCTGCAGCCCCGGTGCAGG - Intronic
1058786568 9:108393926-108393948 TCCACCTGCAGCCCCGGTGCAGG + Intergenic
1059791087 9:117642712-117642734 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1059891381 9:118809206-118809228 TCCACCTGCCGCCCAGGTGCGGG - Intergenic
1059991492 9:119870229-119870251 TCCAACTGCAGCCCCGGTGCGGG - Intergenic
1060091413 9:120746758-120746780 TCCACCTGCAGCCCGGGTGCGGG + Intergenic
1060234677 9:121853866-121853888 GCCAGCTGCTCTGCAGGTGCTGG - Intronic
1060594160 9:124838680-124838702 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1061798632 9:133102626-133102648 TCCAGCTTCTGGGCAGGTGCTGG - Intronic
1061903222 9:133683630-133683652 TCCAGAGGCTGCACAGGGGCAGG - Intronic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062275568 9:135728738-135728760 ACCAGCTGCTGAGCACATGCCGG - Intronic
1062320414 9:135988076-135988098 TCCAGCAGATGCTCAGGTCCTGG - Intergenic
1062499337 9:136845590-136845612 CCGGGCTGCTGCGCGGGTGCGGG - Exonic
1062564985 9:137160275-137160297 CCCAGGTCCTGTGCAGGTGCAGG + Intronic
1203697085 Un_GL000214v1:109035-109057 TGCAGCAGCTGCACAGGGGCGGG - Intergenic
1203458195 Un_GL000220v1:10453-10475 TCCAGCTGCTGGGGAGGAACTGG - Intergenic
1203552124 Un_KI270743v1:171994-172016 TGCAGCAGCTGCACAGGGGCGGG + Intergenic
1203662808 Un_KI270753v1:61351-61373 TCCACCTGCGGCCCTGGTGCAGG - Intergenic
1203670558 Un_KI270755v1:7345-7367 TCCACCTGCGGCCCTGGTGCAGG + Intergenic
1186152527 X:6690455-6690477 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1186298673 X:8175976-8175998 TCCAACTGGTTCGCAGGTGTAGG + Intergenic
1186323184 X:8452438-8452460 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1186386587 X:9116214-9116236 TCCACCTGCTGCCCAAGTACTGG + Intronic
1187568297 X:20474818-20474840 CCCAGAAGCTGAGCAGGTGCTGG + Intergenic
1187904081 X:24050105-24050127 TCCACCTGCAGCCCCGGTGCCGG + Intergenic
1190045800 X:47110951-47110973 TCCACCTGCAGCCCAGGTGCGGG - Intergenic
1190360715 X:49645593-49645615 AGCAGCTGCTGCCAAGGTGCTGG - Intergenic
1190413898 X:50163279-50163301 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1190737553 X:53265713-53265735 ACCAGCCTCTGCCCAGGTGCAGG + Intronic
1191868458 X:65725092-65725114 ACCAGAGGCTGAGCAGGTGCTGG - Intronic
1192223262 X:69211693-69211715 TCAAGCTGATCCTCAGGTGCTGG + Intergenic
1192737672 X:73864123-73864145 TACAGGGGCTGGGCAGGTGCTGG - Intergenic
1193282352 X:79668500-79668522 TCCAGAAGCTGAGCAGGTGCTGG - Intergenic
1193538091 X:82738151-82738173 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1193646166 X:84071057-84071079 TCTAGCTGCTGTGCAGGTAAGGG + Intronic
1193803970 X:85972306-85972328 TCCACCTGCAGCCCTGGTGCGGG - Intronic
1194102524 X:89723650-89723672 TCCATCTGCTGAGCTGGTGGTGG + Intergenic
1194650753 X:96512199-96512221 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1196319466 X:114270508-114270530 TCCACCTGCAGCCCCGGTGCCGG - Intergenic
1196762280 X:119210827-119210849 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1196771568 X:119300094-119300116 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1196775270 X:119332287-119332309 TCCACCTGCAGCCCTGGTGCGGG + Intergenic
1196860791 X:120025716-120025738 TCCACCTGCCGCCCAGGTGCGGG - Intergenic
1197344764 X:125319010-125319032 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1198300053 X:135325867-135325889 TCCACCTGCAGCCCCGGTGCAGG + Intronic
1198468171 X:136921776-136921798 TCCACCTGCGGCCCCGGTGCAGG + Intergenic
1198664248 X:139003973-139003995 TCCACCTGCAGCCCCGGTGCAGG - Intronic
1199175607 X:144784031-144784053 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1199490103 X:148388050-148388072 TGCACCTGCTGCCCAGGAGCTGG + Intergenic
1199831213 X:151551134-151551156 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1199831730 X:151555139-151555161 TCCACCTGCAGCCCCGGTGCAGG - Intergenic
1200274752 X:154721358-154721380 ACCAGATGCTGAGCAGATGCTGG - Intronic
1200423496 Y:2998323-2998345 TCCACCTGCAGCCCCGGTGCGGG - Intergenic
1200455111 Y:3380927-3380949 TCCATCTGCTGAGCTGGTGGTGG + Intergenic
1200512681 Y:4099529-4099551 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1200888737 Y:8299029-8299051 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1201416277 Y:13751882-13751904 AGCAGCTGCTGCTCAGCTGCTGG + Intergenic
1201480002 Y:14428503-14428525 TCCACCTGCAGCCCCGGTGCGGG + Intergenic
1201487133 Y:14506063-14506085 TCCACCTGCAGCCCTGGTGCTGG + Intergenic
1201488223 Y:14513226-14513248 TCCACCTGCAGCCCCGGTGCTGG + Intergenic
1201982555 Y:19923665-19923687 TCCACCTGCAGCCCTGGTGCGGG - Intergenic
1202137024 Y:21676611-21676633 TCCACCTGCAGCCCCGGTGCGGG - Intergenic