ID: 906552663

View in Genome Browser
Species Human (GRCh38)
Location 1:46678594-46678616
Sequence AAGACTGGCCAGGACGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906552663 Original CRISPR AAGACTGGCCAGGACGTGGA TGG (reversed) Exonic
900636752 1:3669699-3669721 AAGCCTGACCATGACGTGGACGG + Intronic
900860535 1:5226195-5226217 AAGACAGGACAGGAAGTGGTGGG + Intergenic
901068978 1:6507936-6507958 ATGGCTGGCCAGGCCATGGATGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
901800046 1:11703335-11703357 AAGGATGGGCAGGACGTGGACGG + Intronic
903874545 1:26464498-26464520 AAGCCTGGCCAGGACCTCCAAGG - Intronic
903878537 1:26492805-26492827 GAGACAGGCCAGGAAGTGGAGGG + Intergenic
905210056 1:36367756-36367778 AAGCCTGGCCAAGGCATGGAGGG + Intronic
905481483 1:38264961-38264983 TAGTAGGGCCAGGACGTGGATGG + Intergenic
906208840 1:44001112-44001134 CAGAGTTGCCAGGACGTGCAGGG - Intronic
906323522 1:44830726-44830748 AATAATGGCCAGGAAGTGGGGGG + Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
912419773 1:109535200-109535222 AATACTGTCCAGGACCTGGGTGG - Intergenic
913207495 1:116553893-116553915 AAGAAAGGCCAGGAGGGGGATGG + Intronic
920777988 1:208959078-208959100 TAGAGTGGCCAGGATGTGGGAGG - Intergenic
921293542 1:213681017-213681039 CAGACAGACCAGGATGTGGATGG + Intergenic
921603937 1:217135307-217135329 AAGACTGGCCTTTACGTGGGAGG - Intronic
921627515 1:217394051-217394073 AAGTCTGGCCAGCAAGTAGAGGG - Intergenic
922196567 1:223364452-223364474 GAGACTGGCGAGGGCGGGGACGG + Intergenic
1069709709 10:70480468-70480490 AACACTGGCCAGGAAAGGGAGGG - Intronic
1073153155 10:101325617-101325639 AAGACTGGACAGGATGGGGGAGG - Intergenic
1075063457 10:119272993-119273015 AGGACTGGGGAGGACTTGGAAGG - Intronic
1075239484 10:120765017-120765039 AAGACAGGCCAGGGGGAGGAGGG - Intergenic
1075584968 10:123650954-123650976 ATGACTGGACAGAACCTGGATGG + Intergenic
1076322154 10:129591158-129591180 GAGACTGGCCAGAACTGGGACGG + Intronic
1076909606 10:133380301-133380323 GAGATTGGCCAGCACGTGGCCGG + Exonic
1077408893 11:2394509-2394531 TGGACTGGCCAGGCCCTGGATGG - Intronic
1079029301 11:16973890-16973912 AAGACTGTCCAGGACTGGGCTGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1082989780 11:59197404-59197426 AAGACTCGCAAGGAAGTAGAGGG + Intronic
1083257202 11:61504013-61504035 AGGACTGGGCAGGCCGAGGAGGG - Intergenic
1083412209 11:62501882-62501904 AAGCCTGGCTGGGATGTGGAGGG - Intronic
1089571814 11:119416257-119416279 AGGACTGGCGAGGGAGTGGATGG + Intergenic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091587948 12:1826904-1826926 AAGACAGGCCCAGAGGTGGATGG - Intronic
1092190634 12:6517450-6517472 AAAACTGGCCAGCAGCTGGATGG - Exonic
1096215778 12:49796779-49796801 ATGACTGCCCAGGACCTGGGTGG + Exonic
1096755252 12:53794058-53794080 AGGACTGGCCAGGTGGTGGATGG - Intergenic
1097989120 12:65816258-65816280 AAAGCTGGCAAGGATGTGGATGG + Intergenic
1102484773 12:113248210-113248232 AAGGATGGCCAGGGCCTGGAGGG - Intronic
1104611012 12:130227905-130227927 AAGCCTGGGCAGGACATTGAAGG + Intergenic
1105696886 13:22897822-22897844 AAGTCTGACCAGGACGCGGAGGG - Intergenic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1110887357 13:80655897-80655919 AAAACTGGCCATAAAGTGGATGG + Intergenic
1111950147 13:94703435-94703457 GAGACTGGCCAGGTCAGGGAGGG - Intergenic
1114344204 14:21778609-21778631 AATACTGGCCAGCACATGCATGG - Intergenic
1118377727 14:65191599-65191621 AGGAGTTGCCAGGACCTGGAGGG + Intergenic
1119784490 14:77302273-77302295 AGAACTGACCAGGACCTGGAAGG + Intronic
1123107093 14:105846730-105846752 AATACTGCCTAGGATGTGGAGGG - Intergenic
1202839455 14_GL000009v2_random:108138-108160 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1202908830 14_GL000194v1_random:98294-98316 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1127844523 15:62857504-62857526 AAGGCTGGCCAGGAGCTGGCGGG - Intergenic
1128892086 15:71340541-71340563 AAGACAGCCTAGGAAGTGGAAGG - Intronic
1130025670 15:80268622-80268644 AAGATGGGCCTGGACTTGGATGG + Intergenic
1130138086 15:81198208-81198230 AAGAGTGGCCAGGAAATGGTTGG - Intronic
1130644625 15:85713407-85713429 AAGAATTGCAAGGATGTGGATGG - Intronic
1132529990 16:442226-442248 AGGACTGCCCAGGAGCTGGAGGG - Intronic
1132613016 16:826999-827021 AAGACTCACCAGGCCGAGGAGGG + Intergenic
1135292727 16:21254064-21254086 AAGAGGGGCCAGGAGGTGGTAGG - Intronic
1136065385 16:27754999-27755021 AAGATTCCCCAGGACGGGGAGGG - Intronic
1139507542 16:67406653-67406675 TAGACTGGCCAGGACAAGGTAGG + Intronic
1139518669 16:67466939-67466961 AAGGCTGAAGAGGACGTGGAGGG + Intronic
1141430704 16:83969008-83969030 GAGACCGGCCTGGACGTGGCGGG - Intronic
1142067407 16:88070664-88070686 ATGACAGGCCAGCACGTGGGGGG + Intronic
1142714015 17:1738211-1738233 CACACTGGCCAGGGCCTGGATGG - Exonic
1143755480 17:9064233-9064255 AAGGCTGGCCAGGAAGTGGGTGG - Intronic
1143790579 17:9292137-9292159 AGGACTGGCCCAGAGGTGGATGG + Intronic
1144089437 17:11841078-11841100 AAGGTTGGCCAGGATGTGGGAGG - Intronic
1150493237 17:65588700-65588722 AAGGCTGGCCTGGCCCTGGAGGG - Intronic
1151857252 17:76730549-76730571 AAGACTGCCACGGCCGTGGAAGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153464715 18:5376613-5376635 GAGACAGGCCAAGATGTGGATGG + Intergenic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1154196850 18:12273156-12273178 AAGGCTGGCCACGGCGAGGAGGG + Intronic
1154316944 18:13311663-13311685 AAGGCGGGCCTGGATGTGGAGGG + Intronic
1156465625 18:37346541-37346563 AAGACACGCCAGGAGGTGGGGGG + Intronic
1156553666 18:38043906-38043928 AAGGCTGGGCAGGGCTTGGAAGG + Intergenic
1156931504 18:42650218-42650240 AATAAGGGCCAGGTCGTGGAAGG + Intergenic
1157527337 18:48393970-48393992 GAGACTGGCCAGGCCTGGGAAGG - Intronic
1160038196 18:75320557-75320579 ATGACTGGGCAGGGCGGGGAAGG + Intergenic
1162495031 19:11018771-11018793 GAGACTGGCGAGGACGTGAAGGG - Intronic
1163297443 19:16421394-16421416 AAGACCGACCTGGACCTGGATGG - Exonic
1163489639 19:17609635-17609657 AAGTCTGGGCAGGAAGTGCATGG - Intronic
1163595979 19:18221164-18221186 CAGACTGGCCAGGACCTGTTGGG + Exonic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165074527 19:33273519-33273541 AAGGCTGGGCCGGACGTGGGCGG + Intergenic
1165471356 19:36006597-36006619 CGGACTGGCCAGGACCTGGTGGG - Exonic
1167122147 19:47523907-47523929 AAGACTGCCCAGCACATGCATGG + Intronic
1168484551 19:56749807-56749829 AAGACTGTTCTGGGCGTGGAAGG - Intergenic
1202633586 1_KI270706v1_random:22420-22442 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1202652297 1_KI270707v1_random:17647-17669 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
927291150 2:21406157-21406179 TAGACTTGGCAGGACGTGGCCGG + Intergenic
929856714 2:45643700-45643722 TAGACCGGCCAGGACGTAGAAGG + Intergenic
930580167 2:53201464-53201486 AAGACTGGGCAGGCCTTGCATGG + Intergenic
931806619 2:65813482-65813504 TATGCTGGCCAGGAGGTGGATGG + Intergenic
934524304 2:95042181-95042203 GAGGCTGGGCAGGACCTGGAGGG + Intronic
934620344 2:95799666-95799688 AAGACTTGCCAGATCATGGAGGG + Intergenic
935620566 2:105126096-105126118 AAGGCGGGCCAGGATGTGGAGGG - Intergenic
935624692 2:105162376-105162398 GAGACTGGCCTGGACGCGGGAGG + Intergenic
938411622 2:131069581-131069603 GAGAATGGCCAGAACCTGGAAGG - Intronic
942050462 2:172135263-172135285 AAGATTGGCCATGAAGTGGCTGG - Intergenic
946154915 2:217801013-217801035 GAGACTGGCCAGGAGAGGGATGG - Exonic
948976670 2:241467747-241467769 AAGACTGGGCAGGACTCGGGTGG + Intronic
1171121655 20:22573600-22573622 AAGAGAGGGCAGGACGTGGATGG + Intergenic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1172357103 20:34287889-34287911 AAGACTGTCAAGGATGTTGAGGG + Intronic
1172777248 20:37414830-37414852 AAGACAGCTCAGGATGTGGAGGG - Intergenic
1172848613 20:37944827-37944849 AGGACTCGCCAGGAGGTGGTGGG - Exonic
1173267597 20:41499287-41499309 AAGACTGTCCAGGAGGTTGGTGG - Exonic
1175252383 20:57617213-57617235 CAGACAGGCCAGCACTTGGAGGG - Intronic
1176069953 20:63221029-63221051 AAGACGGCTCAGCACGTGGAAGG + Intergenic
1176254712 20:64145949-64145971 AGGCCTGGGCAGGACATGGAGGG - Intergenic
1176599852 21:8782006-8782028 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1176628190 21:9112999-9113021 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1176645801 21:9348283-9348305 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1176676650 21:9784767-9784789 AAGAGTGGTGAGGAGGTGGAGGG + Intergenic
1179185799 21:39084429-39084451 GACACTGGCCAGAAGGTGGAGGG - Intergenic
1180213890 21:46312658-46312680 AAGACTGACCAGGCCGGGCATGG - Intronic
1180367127 22:11950870-11950892 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1180378953 22:12120469-12120491 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1180418573 22:12792848-12792870 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1181026682 22:20131308-20131330 AGCTCGGGCCAGGACGTGGAGGG + Intronic
1182487234 22:30646826-30646848 GAGGTTGCCCAGGACGTGGACGG - Exonic
1183573925 22:38674997-38675019 GGGACTGGCCAGGACCTGGCAGG + Intergenic
1184148800 22:42626961-42626983 AATGCTGGCCTGGACATGGAGGG - Intronic
1184598606 22:45529176-45529198 GGCACTGGCCAGGAGGTGGAAGG - Intronic
1185089111 22:48756002-48756024 AAGACAGGCCAGTGCGCGGAAGG - Intronic
950884182 3:16348457-16348479 AAGTCAAGCCAGGACTTGGATGG - Intronic
952241304 3:31533222-31533244 AAGCCAGGCCAGGAAGAGGATGG - Exonic
957094399 3:75765205-75765227 AGTACTTGCCAGGAGGTGGAAGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
1202741084 3_GL000221v1_random:56782-56804 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
970423897 4:15929215-15929237 AAGACTGTCCAGGGAGTGTAAGG - Intergenic
973363216 4:49184429-49184451 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
973397878 4:49612431-49612453 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
976775996 4:88706779-88706801 CAGACTGGCCATGCCGTAGATGG - Exonic
979648386 4:123100076-123100098 AAGACTGGAGAGGACATAGAAGG + Intronic
982979435 4:162113426-162113448 AAGACTAGCGAGGATGTGGTTGG - Intronic
985398887 4:189574001-189574023 AAGAGTGGTGAGGAGGTGGAGGG - Intergenic
1202760573 4_GL000008v2_random:105948-105970 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
985647992 5:1094034-1094056 AGGACTGGACACCACGTGGAAGG - Intronic
985850047 5:2382175-2382197 CAGACTGGCCAGGCTGTGGGTGG - Intergenic
986062264 5:4202781-4202803 AAGACTTGCCAGGAAGCGAAGGG - Intergenic
986399173 5:7362803-7362825 AATCCTGGCCAGGAATTGGATGG - Intergenic
989772905 5:45166216-45166238 GTGACTGGCCAGGATGTGGAAGG - Intergenic
991761872 5:69924951-69924973 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991785457 5:70193149-70193171 AAGACTGGGTAGGGCGGGGAGGG + Intergenic
991841100 5:70800000-70800022 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
992150447 5:73897136-73897158 AAAACTGAGCAGGACCTGGAAGG - Intronic
995945105 5:117635603-117635625 AAGACTGGGAAGGAGGTGGGAGG - Intergenic
999248147 5:150166585-150166607 TGGACTGGCCAGGGCCTGGAGGG - Intergenic
999460292 5:151751878-151751900 GAGACTGGGCAGGACCTGGTTGG + Intronic
1002134322 5:177098578-177098600 GAGACTGGCCAGGGCGGGGCGGG - Intergenic
1004727590 6:18326190-18326212 AAGACTGGAGAGGAGATGGAAGG + Intergenic
1005589298 6:27308804-27308826 AAGAGTGGACAGGAAGGGGAAGG + Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006837551 6:37008132-37008154 AAGACAGGCCAGGAAATGGAAGG - Intronic
1009508905 6:64522625-64522647 AAGACTGAGCAGGAGGTGTATGG + Intronic
1010075661 6:71794203-71794225 AGGACTGGCCAGGATGTAGATGG - Intergenic
1013979175 6:116109566-116109588 AAGGTTAGCCAGGACTTGGATGG - Intronic
1019597300 7:1864091-1864113 GAAACTGGCCAGGATGGGGACGG + Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1026234247 7:68512174-68512196 AAGACTGGCGAGGACGGGCATGG + Intergenic
1031966209 7:128030266-128030288 GAGGCTGGCCAGGCCGTTGAAGG + Exonic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1036213921 8:6863609-6863631 AAGGCTGGCGGGGACGTGGGAGG + Intergenic
1037590802 8:20310550-20310572 AAGGAGGGCCAGGACATGGACGG - Intergenic
1038602231 8:28957042-28957064 AACAATGGCCTGGGCGTGGAGGG + Intronic
1049101844 8:140585414-140585436 AATATTGGCCTGGACGTGAATGG - Intronic
1053258702 9:36641983-36642005 TAGCCTGGCCTGGACCTGGAAGG - Intronic
1056928396 9:90854154-90854176 CAGACTGGCCGGGTGGTGGAGGG + Intronic
1058425435 9:104871492-104871514 CACACTGGCCAGGGCGTGGAAGG + Intronic
1060198198 9:121636601-121636623 AAGTCTGGGCAGGAGGTGGCTGG + Intronic
1203482949 Un_GL000224v1:23676-23698 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1203709723 Un_KI270742v1:86712-86734 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1203541342 Un_KI270743v1:90833-90855 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1185791135 X:2928900-2928922 AAGGCTGGCCGGGACCCGGAGGG - Intronic
1188263809 X:28045562-28045584 AATGCTGGCGAGGATGTGGAGGG - Intergenic
1188978998 X:36709428-36709450 ATGACTGGTCAGGAAGTGCATGG + Intergenic
1196720511 X:118849327-118849349 AAGACTGGCCAGAAGGTAGAAGG + Intergenic
1197895102 X:131304406-131304428 AAGACATGCCAGAACATGGAGGG - Intronic
1201164688 Y:11198284-11198306 AGTACTTGCCAGGAGGTGGAAGG + Intergenic