ID: 906552949

View in Genome Browser
Species Human (GRCh38)
Location 1:46681397-46681419
Sequence ACACCATACCTAGGTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906552944_906552949 8 Left 906552944 1:46681366-46681388 CCCAAACTCCTTTAATTTCATCA 0: 1
1: 0
2: 2
3: 22
4: 349
Right 906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG 0: 1
1: 0
2: 0
3: 6
4: 96
906552945_906552949 7 Left 906552945 1:46681367-46681389 CCAAACTCCTTTAATTTCATCAT 0: 1
1: 0
2: 3
3: 42
4: 446
Right 906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG 0: 1
1: 0
2: 0
3: 6
4: 96
906552946_906552949 0 Left 906552946 1:46681374-46681396 CCTTTAATTTCATCATTTATTCC 0: 1
1: 0
2: 3
3: 80
4: 753
Right 906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906552949 Original CRISPR ACACCATACCTAGGTAAAAT AGG Intronic
904188777 1:28726968-28726990 CCACCACACCCAGCTAAAATTGG + Intergenic
904506974 1:30965117-30965139 ACACCATAGGAAGGTAAATTTGG - Intronic
904749765 1:32734290-32734312 ACTCCTTCCCTAGGTAAAACTGG + Intergenic
905557565 1:38899410-38899432 TCACCTTACCTAGGGAAGATGGG + Intronic
906552949 1:46681397-46681419 ACACCATACCTAGGTAAAATAGG + Intronic
911731217 1:101294120-101294142 GCACCATGCCCAGCTAAAATAGG - Intergenic
919284660 1:195540272-195540294 ATACCATACCAATTTAAAATGGG - Intergenic
920005681 1:202832188-202832210 ACAACATAGCTGGGTAAAGTAGG + Intergenic
923080104 1:230645363-230645385 ACAGCATACCTAGGTTAAGTGGG - Intronic
924013079 1:239687840-239687862 ACTACATACCTAGGTTATATGGG - Intronic
1074463210 10:113657634-113657656 AAACAATTCCTAGCTAAAATTGG + Intronic
1082126919 11:48443828-48443850 AGATCAGAACTAGGTAAAATTGG - Intergenic
1085114780 11:73921145-73921167 CCACCATGCCTAGCTAATATTGG - Intronic
1093048542 12:14481746-14481768 ACACCTTACCTAGTTAGAGTGGG + Intronic
1093406586 12:18812210-18812232 AAACCCTCCCTAGGTAGAATGGG + Intergenic
1097122229 12:56743207-56743229 AGAACTTAACTAGGTAAAATGGG + Intronic
1099959475 12:89382881-89382903 AGAACAGACCTAGGTAGAATAGG - Intergenic
1101916076 12:108897076-108897098 ACATCATCCCAGGGTAAAATTGG + Exonic
1102498890 12:113337777-113337799 CCACCATGCCTAGCTGAAATAGG + Intronic
1106618635 13:31353196-31353218 ACATCTTACCTAGGTGAAATGGG - Intergenic
1106865870 13:33963290-33963312 ACAACATGCCAAGGTCAAATAGG + Intronic
1114156117 14:20105149-20105171 ACACCAAACCTACGTATGATAGG + Intergenic
1114638086 14:24200015-24200037 CCACCACACCTAGCTAATATTGG + Intronic
1114702180 14:24690378-24690400 ACACCATGCCTACAAAAAATAGG + Intergenic
1116001077 14:39243405-39243427 TCACGACACCTCGGTAAAATAGG + Intronic
1117761252 14:59031173-59031195 ACACAATACCCAGCTAAAATTGG + Intergenic
1119710735 14:76821363-76821385 CCACCACACCTAGCTAAGATAGG + Intronic
1119970485 14:78964832-78964854 TCACCACTTCTAGGTAAAATAGG + Intronic
1123838306 15:24219879-24219901 ACACCATGCAAAGGTAAAGTTGG - Intergenic
1124009606 15:25827178-25827200 ACAAAATACATAGGTGAAATTGG + Intronic
1142919925 17:3176047-3176069 ACAGCATCACAAGGTAAAATGGG + Intergenic
1145845855 17:28038506-28038528 GCACCATGCCTAGATATAATTGG + Intergenic
1146776821 17:35626470-35626492 GCTCCATGCTTAGGTAAAATTGG - Intronic
1156802801 18:41138389-41138411 AGAACATATATAGGTAAAATAGG - Intergenic
1158349168 18:56547412-56547434 ATACCTTACCTATGTACAATAGG + Intergenic
1159191082 18:65043384-65043406 ACAACAGAACTAGGAAAAATAGG - Intergenic
1161858350 19:6778753-6778775 CCACCACACCCAGGCAAAATTGG - Intronic
1161944914 19:7429448-7429470 CCACCACACCTAGGTAATTTTGG - Intronic
1167944456 19:52976911-52976933 AGACCATTCCAAGGTCAAATAGG - Intergenic
926607533 2:14912654-14912676 ACAACATACCTAGAGAAACTGGG - Intergenic
929060194 2:37915671-37915693 ACACCATAACCAGTTAAGATAGG - Intergenic
930597731 2:53408732-53408754 ACAGCAGACTAAGGTAAAATTGG + Intergenic
930889281 2:56364109-56364131 AAACAATACCTAGGAAACATAGG - Intronic
935854117 2:107256543-107256565 ACATACTACCTAGGTAAAAGTGG - Intergenic
937085338 2:119167963-119167985 AAAGCATCCCTGGGTAAAATTGG + Intergenic
939753137 2:146074074-146074096 ACACCATACCTAGTTTAGAAAGG - Intergenic
941923970 2:170877903-170877925 CCACCATACCCAGGTAATTTTGG + Intergenic
943011855 2:182459879-182459901 GCACCATACCTAGCACAAATAGG + Intronic
945131789 2:206581735-206581757 ACACCATACCTTGGAACAAATGG - Intronic
946624740 2:221599122-221599144 ACACTATACCTAGGTAAGACGGG + Intergenic
948286582 2:236790625-236790647 ATACCATGAATAGGTAAAATGGG + Intergenic
1172733589 20:37109223-37109245 ACACCATACATACATAAAAATGG + Intronic
1178303134 21:31469242-31469264 ACACCATACCTGGCTAATCTGGG + Intronic
1182227974 22:28814706-28814728 ACATCCTAGCTAGGTAAACTTGG - Intergenic
949139573 3:615975-615997 ACACTATAACTAGGCCAAATTGG + Intergenic
951789302 3:26462071-26462093 AGGCCATATCAAGGTAAAATTGG + Intergenic
954841245 3:53513922-53513944 ACTACATACCTAGGTTATATGGG - Intronic
955840417 3:63106922-63106944 AAACCATAGGTAGATAAAATGGG - Intergenic
956551447 3:70464516-70464538 AGACCAAACCATGGTAAAATTGG + Intergenic
957802824 3:85107101-85107123 ATGCCATACCTTTGTAAAATGGG - Intronic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
964841490 3:160998229-160998251 GCACCATACTTAGGTATAACAGG + Intronic
967130531 3:186466363-186466385 TCACCATGCCCAGATAAAATTGG + Intergenic
971034041 4:22674019-22674041 ACATGATACACAGGTAAAATTGG - Intergenic
971248994 4:24956441-24956463 AAACCAGACCTAGGTAATTTCGG + Intronic
974571534 4:63655734-63655756 TCACCAAACCAAGGGAAAATTGG - Intergenic
976517056 4:85980968-85980990 AGAACATTCCTAAGTAAAATTGG - Intronic
977822161 4:101485827-101485849 CCACCATGCCTAGCTAAGATGGG + Intronic
980541802 4:134205063-134205085 ACACCATAACTAGAACAAATAGG - Intergenic
981498061 4:145415942-145415964 AGACCATACATAGGAAGAATTGG + Intergenic
981626207 4:146758466-146758488 AAACCATACCTTGGTATAAATGG + Intronic
982943616 4:161590066-161590088 ACAACATACCAAAGAAAAATAGG + Intronic
985052227 4:186002446-186002468 ACACCATATGAAGGTAAATTTGG + Intergenic
988725099 5:33919149-33919171 GCCCCATCCCTAGGGAAAATGGG - Intergenic
990768061 5:59209798-59209820 ACACCATATCTTTGCAAAATTGG - Intronic
993195650 5:84741711-84741733 AGAAAATACCTAGGTAAATTTGG + Intergenic
998343919 5:141443814-141443836 AAAACATAATTAGGTAAAATGGG + Intronic
1002361854 5:178678444-178678466 ACAATATAACTAGATAAAATTGG - Intergenic
1008235311 6:49039545-49039567 ACACTAGACATAGATAAAATGGG - Intergenic
1009843707 6:69109408-69109430 ACCACATACCTAGGTACAAAGGG - Intronic
1013135044 6:107274019-107274041 ACAGAACACCAAGGTAAAATTGG - Exonic
1015608301 6:134984862-134984884 ATACCATACATAGGTGAAATGGG - Intronic
1025258273 7:57399751-57399773 CCACCATTCAGAGGTAAAATGGG - Intergenic
1026149371 7:67774985-67775007 ACACCACACATAGGGCAAATAGG - Intergenic
1028310848 7:89333801-89333823 ACACCTTACCAAGGAAAAAGAGG + Exonic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033797241 7:144861177-144861199 AAAACATATCTAGGAAAAATTGG + Intergenic
1036804681 8:11822188-11822210 ACACCATTCCTATGAAAAATAGG - Intronic
1037578446 8:20230097-20230119 ACACACTACCTATGTGAAATTGG - Intergenic
1042891044 8:73610383-73610405 CCACCATACCTAGCTAATTTTGG - Intronic
1044409210 8:91866775-91866797 ATACCATACCAAGGTATAAATGG - Intergenic
1045865352 8:106859128-106859150 ACACCATTTATAGATAAAATAGG + Intergenic
1045958604 8:107939844-107939866 AAACCACACTTAGCTAAAATAGG - Intronic
1046753584 8:117950463-117950485 ACCCCATTTCTAGGAAAAATGGG - Intronic
1047550440 8:125866531-125866553 ACAACCTACCAAGGTTAAATCGG + Intergenic
1058111824 9:101038936-101038958 ACACTCTCCCTAGGTAACATGGG - Intronic
1059370433 9:113827465-113827487 ACACCATAGATAAGTAAAAATGG + Intergenic
1059518645 9:114919152-114919174 ACACCATACATAATTAAATTGGG + Intronic
1186503822 X:10074157-10074179 CCACCATACCTAGCTAATTTTGG + Intronic
1192170756 X:68853049-68853071 AATTCATACCTAGGTAAACTGGG + Intergenic
1195255193 X:103082995-103083017 CAGCCATACCTGGGTAAAATGGG + Exonic
1197192342 X:123661791-123661813 ACAACCTACCTAGGCAACATAGG + Intronic
1198122730 X:133610160-133610182 AAACTATACCTAGCCAAAATAGG - Intronic