ID: 906553175

View in Genome Browser
Species Human (GRCh38)
Location 1:46683655-46683677
Sequence TGTACTGTAAGATCTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906553175_906553177 26 Left 906553175 1:46683655-46683677 CCATTAGAAGATCTTACAGTACA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 906553177 1:46683704-46683726 TAAGAGCTTAAGCTGTCAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 105
906553175_906553176 3 Left 906553175 1:46683655-46683677 CCATTAGAAGATCTTACAGTACA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 906553176 1:46683681-46683703 TAGCATTAAACATGTTTAGATGG 0: 1
1: 0
2: 0
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906553175 Original CRISPR TGTACTGTAAGATCTTCTAA TGG (reversed) Intronic
906553175 1:46683655-46683677 TGTACTGTAAGATCTTCTAATGG - Intronic
907366655 1:53966512-53966534 TATACTGTAAGCTATGCTAAGGG - Intronic
907488613 1:54794429-54794451 GGTAGTGAAAGATCTTCTATTGG - Intronic
907996528 1:59638346-59638368 TTTAGTGTCAGATCTGCTAAGGG - Exonic
910784931 1:90986256-90986278 TATACTCTATGATCTTCTATTGG - Intronic
911140461 1:94495814-94495836 TGAACTTTAGGACCTTCTAAGGG + Intronic
915990159 1:160506502-160506524 TGTACTGTAAGAAATACTAAAGG + Intronic
916956557 1:169842660-169842682 GGTACTTTAAGTTCTTATAAAGG - Intronic
919057989 1:192594733-192594755 TGGACTGTAATATCTTTGAAGGG + Intergenic
919874775 1:201856279-201856301 GGTCCTGTGAGATTTTCTAATGG - Intronic
920896304 1:210053448-210053470 TTTAGTTTAAAATCTTCTAATGG - Intronic
922635624 1:227167882-227167904 TGCACTGTAAGACATGCTAAAGG - Intronic
1064913436 10:20428504-20428526 TGCCCTGTAATTTCTTCTAAAGG - Intergenic
1066562272 10:36683054-36683076 TGTTCTATAAGATCATCTACAGG - Intergenic
1068547333 10:58362932-58362954 TGTAATGTTATATTTTCTAATGG + Intronic
1069397529 10:68006307-68006329 TGTACTATAAGAAATGCTAAAGG - Intronic
1069953502 10:72035723-72035745 TGTACTGTAAGAACATGTGACGG + Intergenic
1071765458 10:88659483-88659505 TGTGTGGCAAGATCTTCTAAAGG + Intergenic
1072204914 10:93195214-93195236 TGTACTGCAAAATATTCTGAGGG - Intergenic
1073692286 10:105822885-105822907 TGTACTCTCAGATCTGCCAAGGG - Intergenic
1073995370 10:109309767-109309789 TGTACTTTCAAAACTTCTAATGG + Intergenic
1075830384 10:125405768-125405790 TGTCCTATATGATATTCTAAAGG - Intergenic
1076415420 10:130283871-130283893 TGTACTGTAAGATCTGATTTTGG + Intergenic
1078591915 11:12648796-12648818 TGTACTGTAAGAAATACTTAAGG + Intergenic
1078935037 11:15942398-15942420 TCTACTGTATGAGCTTGTAAGGG + Intergenic
1079396063 11:20064629-20064651 TTTACTGTAAGGACTTCTAGTGG - Intronic
1080364523 11:31556219-31556241 TGTTCTATATGATTTTCTAAGGG - Intronic
1081258706 11:40930969-40930991 TGGACTGTAAGATCTCCCAAAGG + Intronic
1081465332 11:43311722-43311744 TCATATGTAAGATCTTCTAAGGG + Intergenic
1084142234 11:67240275-67240297 TGTACTGGAAGTTCTCCTGAAGG - Intronic
1085599978 11:77846725-77846747 CTTACTGAAAGAACTTCTAAAGG - Intronic
1087223212 11:95568758-95568780 TGAACTGTTAGATTTGCTAAAGG - Intergenic
1088650909 11:111957747-111957769 TGCACTGTGAGATCTTGGAAGGG + Intronic
1088926131 11:114305128-114305150 TTCACTGTAAGATCTGCTAAGGG + Intronic
1090336124 11:125966962-125966984 TGTACTGTAAGAAATATTAAGGG + Intronic
1090901953 11:131039810-131039832 TGTATTGTAAGAGCATTTAAGGG - Intergenic
1093602029 12:21039021-21039043 TGTCCTGTAAGAAATGCTAAGGG - Intronic
1095685847 12:45032321-45032343 AGCACTGTAAGATCTTCAGAGGG - Intronic
1099231661 12:80033304-80033326 TTTAATGTCAGATGTTCTAATGG - Intergenic
1099634046 12:85190608-85190630 TGTACAGTTAGATATTCTGATGG + Intronic
1100465684 12:94842930-94842952 TGTGCTGTGAGTTTTTCTAAAGG + Intergenic
1101226862 12:102696332-102696354 TGTCCTGTAAGAAATGCTAAGGG + Intergenic
1101537878 12:105636364-105636386 GGTACTTTAAGAACTTCTGAAGG - Intergenic
1104102943 12:125632550-125632572 TGTCCTGTAAGAAATGCTAAAGG - Intronic
1105674385 13:22654663-22654685 TGTGCTTTAAGATCTTCCTAAGG + Intergenic
1107153223 13:37136689-37136711 TGTCCTGTAAAAGCTTTTAATGG + Intergenic
1108511940 13:51164239-51164261 TGGACTGTAAGCTCCACTAAGGG + Intergenic
1109661030 13:65460811-65460833 TGTAATGTAATTCCTTCTAAAGG + Intergenic
1112215022 13:97421287-97421309 TGCACTATAAGCTCTTCTTATGG + Intergenic
1112704668 13:102053870-102053892 TGAACTGTAAGTTCTGGTAAAGG + Intronic
1113826149 13:113255501-113255523 TGTCCTGTATGATCCTATAATGG - Intronic
1114379401 14:22185290-22185312 TGTGAAGTAAGATGTTCTAAGGG + Intergenic
1116006883 14:39302561-39302583 TGTACTGTAAGCTAATCAAATGG + Intronic
1116122567 14:40739026-40739048 TGTACTATAGGAGCTTTTAAAGG - Intergenic
1116244664 14:42394278-42394300 TGTGCTGGAGGATCTCCTAAAGG + Intergenic
1116438978 14:44929412-44929434 TGTACAGTAAGATATTTTGAGGG + Intronic
1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG + Intergenic
1119335004 14:73825885-73825907 TGTTCTGGAAGATCTTAAAATGG + Intergenic
1120036469 14:79704014-79704036 TGGATTGTGAGTTCTTCTAAGGG + Intronic
1122427044 14:101616572-101616594 TGTACTGCAAGAAATCCTAAAGG + Intergenic
1130634530 15:85604924-85604946 TTTACTGTAACATCTTCATAGGG + Intronic
1132071561 15:98781439-98781461 GGAACAGTAAAATCTTCTAATGG - Intronic
1133638445 16:7693631-7693653 TATACTGTAAGATTTTCTTGTGG - Intronic
1135504752 16:23026845-23026867 TGTACTGTATGCTTTCCTAATGG + Intergenic
1139618512 16:68116770-68116792 TAAACTGTAAAATCTTCTATGGG + Intronic
1141695691 16:85618023-85618045 TGTGCTTTGAGCTCTTCTAAAGG + Intronic
1143069756 17:4281063-4281085 TGTACTGTAAGAGGTTCTCTAGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147115769 17:38298204-38298226 TGTACTGTGGGAAGTTCTAAAGG + Intronic
1148413906 17:47491415-47491437 TGTACTGTGGGAAGTTCTAAAGG - Intergenic
1152849213 17:82622230-82622252 TGGACTGTAACATCTTGCAAAGG + Intronic
1155748957 18:29396365-29396387 ACTAGTGTAAGTTCTTCTAAAGG - Intergenic
1156708618 18:39914208-39914230 TGAACTTTAAGATCTTTTAGTGG + Intergenic
1156734595 18:40238993-40239015 TGTATTATAAAATATTCTAAAGG - Intergenic
1158171706 18:54607052-54607074 TGCAGTGTAAGAGCTGCTAAGGG + Intergenic
1167146434 19:47683131-47683153 TGTAGGGTAAGTTCTTCAAAAGG + Intronic
1167770603 19:51513319-51513341 TAGAATGTAAGATCTTCTCAAGG - Intergenic
926392562 2:12408553-12408575 TGGACTATAAGATGCTCTAAGGG - Intergenic
927834685 2:26384613-26384635 TGTTCTATGAGATATTCTAATGG - Intronic
928589761 2:32802229-32802251 TGTACTGTAACAAGTTATAAAGG - Intronic
928736886 2:34301418-34301440 TCTTCTGTAATACCTTCTAAAGG + Intergenic
933024569 2:77238930-77238952 TGCACTGTAAGAAATGCTAAAGG + Intronic
934918889 2:98325510-98325532 TGCACTGTAAGAAATGCTAAAGG + Intergenic
935517507 2:104059505-104059527 TGCTCTGTAAGAAATTCTAAAGG + Intergenic
935613988 2:105057198-105057220 CCTCCTGTTAGATCTTCTAAAGG - Intronic
938667828 2:133557579-133557601 TGTTTTGTATGATCTTATAAGGG - Intronic
939609539 2:144293432-144293454 TGTACTGAAAGATATTATATGGG + Intronic
939818431 2:146925345-146925367 TGTACTATAAGAAATGCTAAAGG + Intergenic
940351728 2:152697741-152697763 AGTACTGTAACATGTTATAAAGG - Intronic
940677125 2:156737883-156737905 TTTATTTTAAGATTTTCTAAAGG + Intergenic
941018213 2:160380904-160380926 TGTGATGGAAGTTCTTCTAAAGG - Intronic
942842218 2:180376524-180376546 TGTTCCGTAAGATCTTGAAAAGG + Intergenic
943312986 2:186350703-186350725 TGGACTGACAGATCTCCTAAAGG + Intergenic
943577607 2:189649184-189649206 TGTACTGTAAGATGTTTGTAAGG + Intergenic
944816539 2:203382834-203382856 TAAACTGTAAGAGCTTTTAAAGG + Intronic
944965984 2:204934227-204934249 TTTACTGCAAGATTTGCTAAAGG + Intronic
946977674 2:225171235-225171257 TGTACTGCAAGACATGCTAAAGG - Intergenic
1169317575 20:4605953-4605975 TGTACTGTTTAATATTCTAAAGG - Intergenic
1175580851 20:60097972-60097994 TGTTCTGTAGGATCTTGTAATGG - Intergenic
1179682213 21:43031055-43031077 TGTACGGTGAGAGCTCCTAACGG - Exonic
1180238920 21:46485567-46485589 CTTCCTGTAAGATTTTCTAAAGG - Intronic
1184369090 22:44071139-44071161 TGTACTGTGAGATTCTCCAAGGG - Intronic
949147133 3:715446-715468 TCAACTGAAAGAGCTTCTAATGG - Intergenic
949499307 3:4663747-4663769 TATTCTGTAAGATATTTTAATGG - Intronic
951293060 3:20898420-20898442 TGTACTGTAATATCTCATTATGG - Intergenic
951765884 3:26198427-26198449 TGTAATGAAAGATGTTTTAATGG + Intergenic
953100199 3:39817493-39817515 TGTAATTTAAAATCTTCTCATGG + Intronic
954889292 3:53909741-53909763 TGTACTGGAAGATCTATTCAGGG + Intergenic
955386606 3:58485835-58485857 TGTTCTGGAAAACCTTCTAAAGG + Intergenic
956838278 3:73113585-73113607 TGTACTGTGAGATTTTCTCAGGG - Intergenic
959760771 3:109961479-109961501 AGTGCAGTAAAATCTTCTAAAGG - Intergenic
960080035 3:113531965-113531987 TGTTCTGCAAGGTCTTCTGATGG + Intergenic
960828928 3:121823694-121823716 TGCACTGTAAGATATGCTAAAGG + Intronic
962071512 3:132038014-132038036 TTTTCTGTAAGAACTACTAAAGG + Intronic
962500431 3:135985693-135985715 TGTACTCTTAGATGTTCTAAAGG + Intronic
964280980 3:155064815-155064837 TGTGCTCTAAGATTTTCTAGGGG + Intronic
964804282 3:160589531-160589553 TGTCCTATAAGAACTGCTAAAGG + Intergenic
966315285 3:178637809-178637831 TGTCCAGTAAGATGTTGTAAAGG - Intronic
966475914 3:180346330-180346352 ACTACTGTAATATCTTCTCAGGG + Intergenic
967509194 3:190290290-190290312 TGTGCTGAAAGATTCTCTAAAGG + Intergenic
970149430 4:13073252-13073274 TGTACTGCCAGCTATTCTAAAGG + Intergenic
971616560 4:28797891-28797913 AGTAATCTTAGATCTTCTAAGGG - Intergenic
971617793 4:28814754-28814776 TGTAATGCAAGAAATTCTAAAGG + Intergenic
971845609 4:31914642-31914664 TATTCTGTAGGATATTCTAAAGG + Intergenic
971845615 4:31914701-31914723 TATTCTGTAGGATATTCTAAAGG - Intergenic
972468466 4:39381623-39381645 TGTTCTGTAAGAAATGCTAAAGG - Intergenic
973021762 4:45211486-45211508 GGTCCTGTAAGTTCTTCTGAAGG + Intergenic
974535949 4:63175290-63175312 TATACTGTAAGATATGCCAAAGG + Intergenic
975695908 4:77012854-77012876 TTTACAGAAAAATCTTCTAATGG + Intronic
977651779 4:99478358-99478380 TGTACTGAAAGATGCTCTAAGGG - Intergenic
979078664 4:116306253-116306275 TGTGCTGTCAGAGCTGCTAAGGG + Intergenic
979413653 4:120408732-120408754 TGTCCTGTAAGAAATGCTAAAGG + Intergenic
986542321 5:8858786-8858808 TGTACTGCAAGATTTTCTAATGG - Intergenic
989501302 5:42171248-42171270 TAGACTGTAAGAAATTCTAAAGG + Intergenic
991395520 5:66200763-66200785 TGCACTGTAAGAAATGCTAAAGG - Intergenic
992309754 5:75483810-75483832 TGTCTTGTAAGAGCTGCTAAAGG + Intronic
992657676 5:78926830-78926852 TGTAATTTAAAATCTTCTAGTGG + Intronic
994025843 5:95082250-95082272 TGTTCTGTGAGCCCTTCTAAAGG + Intronic
994801691 5:104385270-104385292 TGTACTAAAAGATATTCTAAAGG - Intergenic
995190795 5:109317498-109317520 TGAACTGTAAGATCTTTTTCAGG - Intergenic
997847342 5:137299558-137299580 TATACTGTATGATATGCTAAAGG - Intronic
1000816183 5:165924971-165924993 TGTAATGTAATATCTACTACTGG + Intergenic
1002802710 6:540698-540720 TGTCCTTTAAGATCTCCTATTGG - Intronic
1004307031 6:14510319-14510341 TGCACTGTAAGATGTTGTCAGGG + Intergenic
1004964921 6:20837622-20837644 TGTACTTTCAGATATTCTAAAGG - Intronic
1006109901 6:31738219-31738241 TGAACTGTAACATCCTGTAAGGG + Intronic
1008981177 6:57485862-57485884 TGGACTGTAAGCTCCTTTAAGGG - Intronic
1009169267 6:60378824-60378846 TGGACTGTAAGCTCCTTTAAGGG - Intergenic
1009563752 6:65281788-65281810 GGTTCTGTAAGTTCTTCTGAAGG + Intronic
1010568267 6:77445079-77445101 TGTACTTTAAATTTTTCTAATGG - Intergenic
1012789080 6:103669794-103669816 TGTACTGGAAGATCTAGTCAGGG - Intergenic
1013241979 6:108254638-108254660 TGTCCTCTAAGAGCTTATAATGG + Intronic
1013581672 6:111541163-111541185 TGTACTGAAGGATCTTGTTAGGG - Intergenic
1016290197 6:142520093-142520115 TGTCGTGTAAAATCTTCTATAGG + Intergenic
1020991630 7:15204091-15204113 TCTACTGAAATATTTTCTAATGG - Intronic
1021148481 7:17119583-17119605 TATACTTTAAGGTATTCTAATGG + Intergenic
1024500887 7:50104406-50104428 TGTACAGTAAGATTTTCTTCTGG + Exonic
1024841199 7:53589665-53589687 AGTTCTGTAAGATGTTCTTAGGG + Intergenic
1025968538 7:66299250-66299272 TTTACTATAAGAACTGCTAAAGG - Intronic
1026259036 7:68738179-68738201 TGAACTTTAAGAGCTTCCAAAGG + Intergenic
1028314070 7:89377784-89377806 TGTCCTGTAAGAAATGCTAAAGG - Intergenic
1028903494 7:96127015-96127037 TGTACTGGAACAGCTTTTAAAGG + Intronic
1029355532 7:100049076-100049098 TGAACTCAAGGATCTTCTAATGG - Intergenic
1029926105 7:104319322-104319344 TGTACTGTATCATTTTCAAATGG - Intergenic
1030552146 7:110975249-110975271 GGTACTGTAAGAGATTCAAATGG - Intronic
1033904515 7:146185543-146185565 TGTACTGTGAGCTCCTCCAAGGG + Intronic
1034229504 7:149510565-149510587 TGTCCTGTAAGAAATGCTAAAGG + Intergenic
1035698365 8:1618827-1618849 TGCACTGTAGGATCTTTTCATGG + Intronic
1042280691 8:67052947-67052969 TCTCCTGTAATATCTCCTAATGG - Intronic
1045777443 8:105822335-105822357 CAAACTGAAAGATCTTCTAAGGG - Intergenic
1046716128 8:117569464-117569486 TATTCTTTAAGATCTTCTACTGG - Intergenic
1046903359 8:119545786-119545808 TGTGCTGTGTGATCTTCTAAGGG - Intergenic
1048843708 8:138586933-138586955 TCTTCTGTATGATCTTATAATGG + Intergenic
1051132901 9:13882624-13882646 TGAACTGTAACATCTTCCCAAGG + Intergenic
1051883767 9:21868505-21868527 TGTTCTGTAAGCTTTTGTAAAGG + Intronic
1052455140 9:28686916-28686938 TGAAATGAAAGATCTTTTAAAGG - Intergenic
1059347928 9:113644956-113644978 AGTACTATACTATCTTCTAAAGG - Intergenic
1059810399 9:117850482-117850504 TTTACTGTAAGTTCTTCAAGAGG - Intergenic
1185479770 X:437674-437696 TGTAGTTTCAGATCTTCTAAAGG - Intergenic
1188454251 X:30344537-30344559 TGTTCTGGAAGACTTTCTAAAGG + Intergenic
1192824703 X:74682999-74683021 AGTACTAAGAGATCTTCTAATGG - Intergenic
1194495409 X:94611452-94611474 TGTATTATAAGAAATTCTAAAGG - Intergenic
1195541197 X:106065375-106065397 AGTTCTGAAAGATCTTCAAAGGG - Intergenic
1197429623 X:126344377-126344399 TGTCCTGTAAGAAATGCTAAAGG + Intergenic
1199433965 X:147792256-147792278 TGTACTATAAGATTTTCTCAAGG - Intergenic
1201199485 Y:11526410-11526432 TGTAATGTAATAGCCTCTAATGG + Intergenic
1201378713 Y:13349091-13349113 TTTACTGTAAGATCCTATTAGGG - Intronic
1201485408 Y:14488919-14488941 TGTACTGTTAGCTATTCTCAAGG - Intergenic