ID: 906556623

View in Genome Browser
Species Human (GRCh38)
Location 1:46719116-46719138
Sequence GCGCAGGCGGCCGCTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906556623_906556633 19 Left 906556623 1:46719116-46719138 CCTTTGGCAGCGGCCGCCTGCGC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 906556633 1:46719158-46719180 CTCCCATTGGTCGCCCGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 49
906556623_906556629 6 Left 906556623 1:46719116-46719138 CCTTTGGCAGCGGCCGCCTGCGC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 906556629 1:46719145-46719167 CCAGTAAGCCGCACTCCCATTGG 0: 1
1: 0
2: 0
3: 5
4: 52
906556623_906556631 17 Left 906556623 1:46719116-46719138 CCTTTGGCAGCGGCCGCCTGCGC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 906556631 1:46719156-46719178 CACTCCCATTGGTCGCCCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 27
906556623_906556632 18 Left 906556623 1:46719116-46719138 CCTTTGGCAGCGGCCGCCTGCGC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 906556632 1:46719157-46719179 ACTCCCATTGGTCGCCCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906556623 Original CRISPR GCGCAGGCGGCCGCTGCCAA AGG (reversed) Intergenic
900287542 1:1908839-1908861 GCGCGGGCGGCTGCTGGCGAGGG + Intergenic
900691649 1:3984197-3984219 GCACAGGCGGCTGATGCCAAAGG - Intergenic
904756233 1:32770282-32770304 GCGCAGGCTGCAGCGGCCTAGGG - Exonic
904788375 1:32999203-32999225 GCTCTGGCTGCCCCTGCCAAAGG + Intergenic
905449756 1:38048413-38048435 GCTCAGGTGGCAGCTGCCATTGG + Intergenic
906556623 1:46719116-46719138 GCGCAGGCGGCCGCTGCCAAAGG - Intergenic
907136315 1:52142382-52142404 GCGGAGGCGGCCGCTGCTCGAGG + Exonic
907278143 1:53328129-53328151 GCGCTGGCGGCGGCCGCCCAGGG - Intergenic
908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG + Intergenic
908384060 1:63623737-63623759 GTGCAGATGGCAGCTGCCAATGG + Exonic
912568654 1:110606571-110606593 GCGCTAGCGGCCGCGGCCAGCGG - Intronic
914442648 1:147720771-147720793 GCGCTGGCAGCAGCTGCGAAGGG + Intergenic
916233303 1:162561496-162561518 GCGGAGGCGGCCGCGGCCCGGGG - Intronic
919907487 1:202087851-202087873 GCCCAGGAGGATGCTGCCAAGGG - Intergenic
1063529831 10:6820480-6820502 CCTCAGGCGGCCATTGCCAAGGG + Intergenic
1065265511 10:23971155-23971177 GTGCACGCGGCCCCTCCCAAGGG - Intronic
1067116060 10:43436574-43436596 GCGCAGGCAGCCTCTGCCGCCGG - Intergenic
1069019175 10:63466100-63466122 GCGGAGGCGGCAGCGGCCACTGG + Intergenic
1069819954 10:71221279-71221301 GCCCAGGCTGCCTCTGCCAGTGG - Intronic
1073063521 10:100745672-100745694 GCGCACGCCGCCGCGGCCGAAGG - Intronic
1076426354 10:130370116-130370138 GGGCAGGAGGCCTCTGCCCATGG + Intergenic
1076993786 11:288973-288995 ACCCACGCGGCCGCTGCCAGCGG + Intergenic
1084102334 11:66958032-66958054 CCGCAGGCGGACGCTGCGGAGGG + Intronic
1084518376 11:69648421-69648443 CCCCAGGCGGCCCCAGCCAATGG + Intronic
1090285400 11:125495521-125495543 GCGTCTGCGGCCGCTGCCAGCGG + Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1094018055 12:25884890-25884912 GCCCAGGCTGCCTGTGCCAAGGG - Intergenic
1096590438 12:52655438-52655460 GGCCAGGCAGCCGCTGCCCATGG - Intergenic
1097164864 12:57078591-57078613 GCCCGGGCAGCAGCTGCCAAGGG - Intronic
1097641812 12:62191640-62191662 GCGACCGCGGGCGCTGCCAAGGG - Exonic
1098161213 12:67649246-67649268 GCGCGGGCGGCCGCTGCCTGCGG + Intronic
1101493959 12:105236156-105236178 GGGCAGGCGGCGGCGGCCACTGG - Intronic
1102613964 12:114136828-114136850 ATGCAGGCGGCCTCTGACAAAGG + Intergenic
1103562689 12:121800537-121800559 GCGCGGGCGCCCGCAGCCGAGGG - Intronic
1104069366 12:125331071-125331093 GCGCTGGCGGCGGCGGCCACTGG + Intronic
1105768013 13:23579646-23579668 GCGCAGGCGGGGGCTGCTCACGG + Intronic
1112055324 13:95685156-95685178 GCCCACGCGGCTGCTGTCAAGGG - Intronic
1112505435 13:99971908-99971930 GCGCAGGCGGCCGCAAGCACGGG - Exonic
1112603866 13:100884211-100884233 GCTCAGGCAGCCGTTGCCATAGG + Intergenic
1118740767 14:68737816-68737838 ACACAGGGGGCAGCTGCCAAGGG + Intergenic
1122152008 14:99730560-99730582 GTGCAGGCTGCTGCTGCCACCGG + Intergenic
1125752344 15:42037136-42037158 GCCCAGGCTGCTGGTGCCAAGGG - Intronic
1125815616 15:42581456-42581478 GGGCTGGTGGCCGCTGCCAGCGG + Intronic
1126348361 15:47718835-47718857 GCGCCGGCAGCCGCTGGCAGGGG + Exonic
1126996739 15:54452800-54452822 CCCCAGGTGGCAGCTGCCAATGG + Intronic
1128972241 15:72117951-72117973 GCAGAGGCGGCCGCTGGCAGCGG - Exonic
1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG + Intergenic
1132663029 16:1069970-1069992 ATGCAGGCTGCAGCTGCCAAGGG - Intergenic
1134521813 16:14922264-14922286 GCCCAGGCAGCCGCAGCCCAGGG - Intronic
1134709483 16:16320915-16320937 GCCCAGGCAGCCGCAGCCCAGGG - Intergenic
1134716696 16:16360944-16360966 GCCCAGGCAGCCGCAGCCCAGGG - Intergenic
1134950120 16:18347730-18347752 GCCCAGGCAGCCGCAGCCCAGGG + Intergenic
1134958054 16:18391215-18391237 GCCCAGGCAGCCGCAGCCCAGGG + Intergenic
1142855079 17:2724622-2724644 GCCCACGAGGCCGCCGCCAAGGG - Intergenic
1146052884 17:29567048-29567070 CCGCCGGCGGCGGCTGCCCAGGG + Exonic
1146301219 17:31691391-31691413 GGGCAGGCGACTGCAGCCAAGGG - Intergenic
1147389527 17:40100641-40100663 GCGCAGGCGCCAGCAGCCCAGGG + Exonic
1148759816 17:49993828-49993850 GCGCAGGCGGCGGCTGGCGCCGG - Intronic
1149436660 17:56639245-56639267 GGGCAGGTGGCAGCTTCCAAGGG + Intergenic
1151666842 17:75549999-75550021 GCTCAGGTGACCTCTGCCAAGGG - Intronic
1152137192 17:78511479-78511501 GTGAATGCGGCAGCTGCCAAAGG - Intronic
1152714454 17:81891803-81891825 GCGGACGCCGGCGCTGCCAACGG + Exonic
1152903239 17:82957080-82957102 GCCCAGGTGGACTCTGCCAAGGG + Intronic
1153805548 18:8706114-8706136 CCGCCGTCTGCCGCTGCCAAGGG + Intronic
1160922320 19:1526770-1526792 GGCCAGGGGGCCGCTGCCACAGG + Exonic
1162378874 19:10320700-10320722 GGGCAGGCGGGCGCTGCTGAGGG + Exonic
1162386710 19:10364573-10364595 GCGCTGGGGGCCACCGCCAAGGG - Intronic
1162831416 19:13286808-13286830 GCGGAGTCGGCCGCTCCCCACGG - Exonic
1163148765 19:15399181-15399203 GAGCAGGTGGCGGCTCCCAAGGG + Intronic
1168153794 19:54462454-54462476 GGGGAGGAGGCCGCTGCCATTGG - Exonic
927708298 2:25310478-25310500 GGGCAGGCGGCAGGTGCCAGGGG + Intronic
935059240 2:99593517-99593539 CTGAAGGAGGCCGCTGCCAACGG - Exonic
936532101 2:113283496-113283518 GCCCAGGCAACTGCTGCCAAAGG - Intergenic
936533244 2:113291345-113291367 CCGCAGGCGGCGGCTGTCACGGG + Intergenic
936559104 2:113520946-113520968 GAGGCGGCGGCCGCGGCCAAGGG + Intergenic
938385992 2:130867846-130867868 GCGCAGGGGGCGGCTGCCTGAGG - Intronic
948454963 2:238100639-238100661 GCGCATGACGCCGCTGCCACGGG + Exonic
1168806859 20:676632-676654 GCTCAGGCGGGCGCTGCAAGAGG + Intergenic
1169249093 20:4046538-4046560 GCACAGGCGGAGGCTGCAAATGG - Intergenic
1170475995 20:16715058-16715080 GCCCAGAAGGCCGCTGACAAGGG + Intergenic
1171123190 20:22582859-22582881 GGGCAGGCGGCCGGGGCCATGGG - Exonic
1172915712 20:38441987-38442009 GCGCGGGAGGCAGATGCCAACGG - Intergenic
1173454279 20:43190424-43190446 GGGCAGGCGGCTGCTGGCCAGGG + Intergenic
1177225256 21:18245167-18245189 GCGAGGGCGGCCTCTGCCCAGGG - Exonic
1179775252 21:43658092-43658114 GCGGAGGCGGCAGCGGCCATGGG - Exonic
1180616541 22:17131945-17131967 GAGCAGGCGGCTGCCGCCAAGGG + Exonic
1180695106 22:17746929-17746951 ACGCAGGCAGCCGCTGCCCAAGG + Intronic
1181935294 22:26433892-26433914 ATGCAGGCTGCCGATGCCAACGG + Exonic
1184520690 22:44992265-44992287 GCAGAGGCTGCCGCTGCCCAGGG + Intronic
1184757577 22:46525730-46525752 GCTAAGGTGGCCGCTGCCAGGGG + Intronic
1185131921 22:49044183-49044205 TCACAGGCGGCTGCTGCCACCGG + Intergenic
1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG + Intergenic
1185400499 22:50613140-50613162 GCACAGGGGGCGGCTGCCAGGGG - Intronic
952867293 3:37862289-37862311 GCGCAGGCGGCCGCGGGCTGGGG + Intronic
955079840 3:55648529-55648551 TCGCAGGCGGCTGCCTCCAAGGG + Intronic
956867574 3:73384709-73384731 GGGCAGGTCGCCGCTGCCCAAGG + Exonic
961360733 3:126365573-126365595 GCTCAGGAGGCCTCTGCAAAGGG - Intergenic
968610708 4:1555709-1555731 GCGGAGGCAGCCACTGCCTACGG + Intergenic
970194657 4:13542512-13542534 CCGCAGGCGACCGCAGCCCAAGG - Exonic
974385917 4:61201812-61201834 GCGCAGGCGGCGGCATCCACCGG + Intronic
975779057 4:77819920-77819942 GCGCCGGCGGCCGCGGCCGCGGG - Intergenic
978515040 4:109560409-109560431 GCGGAGGCGGCAGCGGCCACGGG - Exonic
982255990 4:153452235-153452257 GCCCTGGCGGCTGCTGCCAGAGG - Intergenic
987805350 5:22758108-22758130 GTGCAGGCGGCCGATACCCATGG + Intronic
992269825 5:75053161-75053183 CCGCAGGCGGCGGCTGCCGCGGG + Intergenic
995918186 5:117276615-117276637 GCGCATGCAGCCCCTCCCAAGGG + Intergenic
996379111 5:122845761-122845783 GCCAAGGCGGCGGCGGCCAAGGG - Intronic
997013524 5:129905132-129905154 GCGGAGGTGGCTGCTGCCAGGGG - Exonic
1002700172 5:181118564-181118586 GCCCAGGCGGCCCCTGCAGAGGG - Intergenic
1004291821 6:14374402-14374424 GTGCATGCGGCCCCTCCCAAGGG - Intergenic
1013116572 6:107108004-107108026 GGGCAGGATGCCACTGCCAAGGG - Intronic
1013793595 6:113860130-113860152 GCTGAGGCGCCCGCTGCCGAAGG + Exonic
1016990168 6:149922991-149923013 GGGCTGGCGGCCGCTGCCATTGG + Exonic
1017002335 6:150005138-150005160 GGGCAAGCGGCCGCTGCCATTGG + Intergenic
1019213274 6:170423211-170423233 GCTCAGGCCGCAGCTACCAAGGG + Intergenic
1020059235 7:5140149-5140171 GCGCAGGCGGCTGATGAAAAAGG + Intergenic
1023908043 7:44536137-44536159 GAGCAGGCAGCCACTGCCCAGGG + Intronic
1031369800 7:120950936-120950958 GCGCTGGCGGCGGCCGCCAGTGG + Intronic
1034678809 7:152912100-152912122 GGGCAGGAGGCCGCTGCAGAGGG + Intergenic
1036803240 8:11808515-11808537 CCGCAGGCGGCTGCGGCCATGGG - Intronic
1037273725 8:17156495-17156517 GCGGAGGCGGCGGCTGCGAGCGG - Exonic
1039554329 8:38466204-38466226 GCGTGGGCGGCTGCTGCCAGAGG - Intronic
1049455652 8:142685125-142685147 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049455663 8:142685201-142685223 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049455673 8:142685277-142685299 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049455684 8:142685353-142685375 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049455694 8:142685429-142685451 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049455705 8:142685505-142685527 GCTCAGGAGGCTGCTTCCAATGG + Intergenic
1049893748 9:95235-95257 GAGGAGGCGGCCGCGGCCAAGGG - Intergenic
1051641844 9:19230853-19230875 GCGCAGGCTTCCTCCGCCAAAGG - Intronic
1051896694 9:21995424-21995446 GTGGAGGCGGCAGCGGCCAACGG - Intronic
1053732715 9:41074189-41074211 GTGCAGATGGCCGCGGCCAACGG - Intergenic
1054693409 9:68336078-68336100 GAGGAGGCGGCTGCGGCCAAGGG + Intronic
1054695712 9:68357365-68357387 GTGCAGATGGCCGCGGCCAACGG + Exonic
1059027393 9:110649747-110649769 GAGCAGGCAGCCTCTGCCAAAGG + Intergenic
1059235870 9:112760301-112760323 GGGGAGGCAGCCGCTGCCAGTGG + Intronic
1059717236 9:116924463-116924485 GCCCATGCCACCGCTGCCAATGG - Intronic
1060793267 9:126499638-126499660 GGGAAGGCGGCCGCAGCCAGAGG + Intronic
1061624218 9:131831620-131831642 GCGGGGGCAGCGGCTGCCAATGG + Intergenic
1061867430 9:133500067-133500089 GCGCCGGCAGCAGCAGCCAAGGG - Intergenic
1062582986 9:137236572-137236594 GCGCAGGCGGCCCCTGTCTAGGG - Intergenic
1189075009 X:37905807-37905829 AGGCAGCCGCCCGCTGCCAAGGG - Intronic