ID: 906558611

View in Genome Browser
Species Human (GRCh38)
Location 1:46736050-46736072
Sequence ATGGTTTTGGGATGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906558597_906558611 23 Left 906558597 1:46736004-46736026 CCCCACATATGGCCAGAGGCTCA No data
Right 906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG No data
906558603_906558611 11 Left 906558603 1:46736016-46736038 CCAGAGGCTCAGAGGCCTTGGGC No data
Right 906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG No data
906558598_906558611 22 Left 906558598 1:46736005-46736027 CCCACATATGGCCAGAGGCTCAG No data
Right 906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG No data
906558606_906558611 -4 Left 906558606 1:46736031-46736053 CCTTGGGCCTGGTGAAAGGATGG No data
Right 906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG No data
906558599_906558611 21 Left 906558599 1:46736006-46736028 CCACATATGGCCAGAGGCTCAGA No data
Right 906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906558611 Original CRISPR ATGGTTTTGGGATGTGTGTC TGG Intergenic
No off target data available for this crispr