ID: 906559137

View in Genome Browser
Species Human (GRCh38)
Location 1:46742157-46742179
Sequence CTGGCCAATCATACAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906559137_906559141 6 Left 906559137 1:46742157-46742179 CCAGCAATTGTATGATTGGCCAG No data
Right 906559141 1:46742186-46742208 CAGCCATGGTTAAGTGAAGCTGG No data
906559137_906559144 27 Left 906559137 1:46742157-46742179 CCAGCAATTGTATGATTGGCCAG No data
Right 906559144 1:46742207-46742229 GGAGAACCCACGCTGGATTGTGG No data
906559137_906559143 20 Left 906559137 1:46742157-46742179 CCAGCAATTGTATGATTGGCCAG No data
Right 906559143 1:46742200-46742222 TGAAGCTGGAGAACCCACGCTGG No data
906559137_906559138 -8 Left 906559137 1:46742157-46742179 CCAGCAATTGTATGATTGGCCAG No data
Right 906559138 1:46742172-46742194 TTGGCCAGCCTGCACAGCCATGG No data
906559137_906559145 30 Left 906559137 1:46742157-46742179 CCAGCAATTGTATGATTGGCCAG No data
Right 906559145 1:46742210-46742232 GAACCCACGCTGGATTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906559137 Original CRISPR CTGGCCAATCATACAATTGC TGG (reversed) Intergenic
No off target data available for this crispr