ID: 906561052

View in Genome Browser
Species Human (GRCh38)
Location 1:46757240-46757262
Sequence GGCACCAAGGGACCAGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 21, 2: 30, 3: 53, 4: 283}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906561041_906561052 28 Left 906561041 1:46757189-46757211 CCCACCCTCACTAAACTTAATAA 0: 34
1: 121
2: 36
3: 26
4: 202
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561048_906561052 -10 Left 906561048 1:46757227-46757249 CCAGTGCATTGGTGGCACCAAGG 0: 1
1: 2
2: 33
3: 54
4: 150
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561042_906561052 27 Left 906561042 1:46757190-46757212 CCACCCTCACTAAACTTAATAAT 0: 81
1: 54
2: 74
3: 516
4: 942
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561044_906561052 23 Left 906561044 1:46757194-46757216 CCTCACTAAACTTAATAATAAAT 0: 129
1: 59
2: 12
3: 40
4: 607
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561040_906561052 29 Left 906561040 1:46757188-46757210 CCCCACCCTCACTAAACTTAATA 0: 33
1: 83
2: 60
3: 30
4: 207
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561043_906561052 24 Left 906561043 1:46757193-46757215 CCCTCACTAAACTTAATAATAAA 0: 128
1: 55
2: 11
3: 49
4: 1021
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283
906561039_906561052 30 Left 906561039 1:46757187-46757209 CCCCCACCCTCACTAAACTTAAT 0: 30
1: 72
2: 58
3: 40
4: 239
Right 906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG 0: 1
1: 21
2: 30
3: 53
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906561052 Original CRISPR GGCACCAAGGGACCAGAAGG CGG Intergenic
900368068 1:2319564-2319586 GGCTCCCAGGGACCAGAGGCTGG + Intergenic
900912638 1:5612458-5612480 GGCACCAAGGGAGATGAAAGAGG + Intergenic
900913055 1:5615800-5615822 GGCACCAAGAGAGCTGAAAGGGG + Intergenic
901519051 1:9768867-9768889 GGCACCAAAGCAACAGAAGAGGG + Intronic
901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG + Intergenic
901946180 1:12705961-12705983 GGCACCGCAGGACCAGAAGGTGG + Intergenic
903004877 1:20291939-20291961 GGCACCACAGCAGCAGAAGGAGG + Intronic
903190743 1:21654166-21654188 GTCACCAAAGGACCAGGAGCTGG - Intronic
903666710 1:25012360-25012382 GGCACCAAGGAAGCAGCAGGGGG + Intergenic
903831520 1:26178093-26178115 GGGCCCAAGGACCCAGAAGGGGG + Intronic
904259983 1:29282928-29282950 GGCAGCAAGCCACCTGAAGGGGG + Exonic
904697131 1:32336837-32336859 GCCACCAAGGGACTGAAAGGAGG - Intergenic
904711494 1:32433587-32433609 GGCTCTAAGGGAGAAGAAGGAGG - Intergenic
905393046 1:37650505-37650527 GGCCCCAAGGCACCAGCAGTGGG + Intergenic
905633129 1:39530194-39530216 GGGACCAAGGGACCAGCCAGAGG - Intergenic
905777844 1:40681410-40681432 GGGAGCCAGGGAGCAGAAGGAGG - Intergenic
906082313 1:43101439-43101461 GGCACCACAGGACCACAAAGAGG + Intergenic
906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG + Intergenic
906898200 1:49802711-49802733 GGCACCACGGGACCAGAAGGCGG + Intronic
907522836 1:55036050-55036072 CACACCAAGTGCCCAGAAGGAGG - Intergenic
907802990 1:57790014-57790036 GGCACCAACGGACCATAAGAGGG + Intronic
909049569 1:70752328-70752350 GGCATCACGGGACTAGAAGGCGG + Intergenic
910117012 1:83742625-83742647 GGCAGTAAGGGAACAGAAGCTGG + Intergenic
910167866 1:84346898-84346920 GGCAGAAAGGAAGCAGAAGGTGG + Intronic
910521494 1:88127110-88127132 GGCAGAAAGGGAGCAGAATGGGG - Intergenic
910831612 1:91467137-91467159 GGCACCATGGGACCAGAAGGCGG + Intergenic
910909545 1:92218690-92218712 GGGACCGGGGGACCAGAAGGTGG - Intronic
911755871 1:101556203-101556225 GGCATCACAGGACCAGAAGGTGG + Intergenic
913077487 1:115353320-115353342 GGCACCATGGGAGCAGAGTGTGG - Intergenic
913369666 1:118083966-118083988 AGCACCAAGGGTCCAGGATGGGG + Intronic
913537422 1:119786344-119786366 GGCACCACAGGACCAGAAGGCGG - Intergenic
914379516 1:147103963-147103985 AGCATCATGGGACCAGAAGGTGG + Intergenic
914814912 1:151056213-151056235 GGTACCAAGGGAGAGGAAGGGGG + Intronic
914985116 1:152449844-152449866 AGGACCCAGGGAACAGAAGGGGG - Intergenic
915312442 1:155011335-155011357 AGCACCAAGAAACCAAAAGGTGG - Intronic
916531175 1:165658140-165658162 GGCACACAGGCACCTGAAGGTGG - Intronic
919205431 1:194416602-194416624 AGCACCGCAGGACCAGAAGGCGG + Intergenic
919318318 1:196002151-196002173 GGCACTATGGGACCAGAAGGTGG - Intergenic
919804336 1:201372258-201372280 GGCAACAAGGGAAAAGAAAGGGG - Intronic
920380432 1:205531797-205531819 GGCTCCAAGGGGCCAGAAAGGGG - Intronic
921080660 1:211736454-211736476 GGCAACAAGGGCCTAGAAAGTGG + Intergenic
921975345 1:221196689-221196711 GGCACCATGGGACCAGAAGGCGG - Intergenic
922424822 1:225482956-225482978 GTCAGCAAGGGTCCAGAAGCTGG - Intergenic
923052056 1:230396016-230396038 GGAAGCAAGGGAGCAGAAAGAGG - Intronic
923898807 1:238303422-238303444 GTCAGCAAGGGACTAGAAAGTGG - Intergenic
924308983 1:242720527-242720549 ACCACCAAGAGACCAGAAAGTGG + Intergenic
924950868 1:248882174-248882196 GGCTCCGTGGGACCAGAAGGCGG - Intergenic
1063138617 10:3237870-3237892 GGGACCCAGGGACCAGGTGGGGG + Intergenic
1064144807 10:12819185-12819207 GGCACAGAGGGCCCAGCAGGAGG + Intronic
1065175150 10:23068356-23068378 GGCATGAAGGGACCACTAGGGGG - Intergenic
1067316825 10:45175516-45175538 GGCATCACAGGACCAGAAGGTGG - Intergenic
1067720357 10:48723382-48723404 GGCAGCAAGGCAGCAGAAGCAGG - Intronic
1069868460 10:71518756-71518778 GGCACCTAAGAACCAGAAAGAGG - Intronic
1070827123 10:79397789-79397811 GGGGTCAAGGTACCAGAAGGAGG + Intronic
1072386828 10:94939285-94939307 GGCACCATGGGACCAGAAGGCGG - Intronic
1072781644 10:98255697-98255719 GACGCCAAGGGCCCAGGAGGTGG - Exonic
1072933365 10:99687781-99687803 AGCTCCAAGGAACCAGAAAGTGG - Intronic
1075135521 10:119782044-119782066 GGCACCCTGGAAACAGAAGGTGG - Intronic
1076586735 10:131553850-131553872 GACACCAAGGGACCAGCGTGGGG + Intergenic
1076683158 10:132185686-132185708 AGCACCCAGGGGCCAGAATGGGG + Intergenic
1077753241 11:4997486-4997508 GAGACTAAGGGTCCAGAAGGAGG + Intergenic
1078891030 11:15559507-15559529 TGCAGGAAGGGACAAGAAGGAGG + Intergenic
1079911510 11:26316242-26316264 GGCATCGCAGGACCAGAAGGCGG - Intronic
1080183261 11:29448687-29448709 TGCTCCAAAGGACCAGAAGACGG + Intergenic
1081323083 11:41715018-41715040 GGGACAAAGGGACCAGAGGTAGG + Intergenic
1081380346 11:42407329-42407351 GGCTCCAGGGAACCAGAGGGTGG - Intergenic
1081450028 11:43161862-43161884 AGCACCATGGGACCAGAAAGTGG - Intergenic
1081450622 11:43167877-43167899 AGCACCATGGGACCAGGAGGTGG - Intergenic
1083633105 11:64105779-64105801 GGCGCCAAGGCCCCAGGAGGTGG + Intronic
1084239026 11:67806022-67806044 GGGACCAAGGGACTGGGAGGCGG + Intergenic
1085145247 11:74190183-74190205 CCTATCAAGGGACCAGAAGGTGG - Intronic
1086084214 11:82938342-82938364 GGCACAAAAGGACAATAAGGAGG - Intronic
1086957572 11:92949357-92949379 GGCACTGCGGGACCAGAAGGCGG - Intergenic
1087579352 11:100031918-100031940 GGCACCACGGGACCAGAAGGTGG + Intronic
1089589966 11:119533756-119533778 GCCAGCATGGGAACAGAAGGCGG - Intergenic
1091344911 11:134846049-134846071 GGGACCAAGGGCCTGGAAGGAGG - Intergenic
1092245326 12:6860899-6860921 GGCAGCCAGGGAACAGAATGGGG - Intronic
1092762300 12:11821039-11821061 CTTACCAATGGACCAGAAGGGGG + Intronic
1092927518 12:13285095-13285117 GGCACCAAGAGAGCACAATGGGG + Intergenic
1094808254 12:34110973-34110995 AGCACCGCGGAACCAGAAGGCGG + Intergenic
1095092907 12:38123567-38123589 GGCATCGCAGGACCAGAAGGCGG + Intergenic
1095093512 12:38129980-38130002 AGCACCACTGGACAAGAAGGCGG + Intergenic
1095750871 12:45709345-45709367 GGTACCAAGAGACCAGGAAGTGG + Intergenic
1096934528 12:55256714-55256736 GGCATCGCGGGACTAGAAGGCGG + Intergenic
1098747676 12:74260726-74260748 GGCACTGCGGGACCAGAAGGTGG + Intergenic
1099810702 12:87578926-87578948 GGCACCATGGGACCAGAAGGTGG - Intergenic
1100390463 12:94142330-94142352 GGGACTAAGGGTTCAGAAGGTGG - Intergenic
1101816663 12:108150988-108151010 GGCACCAAGGGGCCAGGGCGTGG - Intronic
1102213458 12:111143894-111143916 GGCACCAAGGAAACACAAAGAGG - Intronic
1102326989 12:111994448-111994470 GGCATCACAGGACCAGAAGGCGG - Intronic
1103199895 12:119079213-119079235 GGAACCAAGGATACAGAAGGAGG + Intronic
1103905019 12:124322666-124322688 GGCACCAAGGGACAAGGCCGAGG + Intergenic
1104089121 12:125500050-125500072 GGCACCATGGGACCAGAAGGCGG + Intronic
1104139626 12:125974884-125974906 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1104168665 12:126258480-126258502 GGCAGCAAGGGGCAGGAAGGTGG + Intergenic
1105429191 13:20321740-20321762 GGCTCCAGGGGCTCAGAAGGTGG + Intergenic
1105913210 13:24890545-24890567 GCCACCAAGTGAGCAGAGGGAGG - Intronic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1109105249 13:58241828-58241850 GGCACTGCAGGACCAGAAGGTGG + Intergenic
1110864009 13:80374727-80374749 GGGGCCAAAGGACCAGAAAGAGG + Intergenic
1112115470 13:96347363-96347385 GGCAGCAAAAGACCAGAATGAGG - Intronic
1112783420 13:102926469-102926491 GGCAGCAGGGGACCAGTAGCAGG + Intergenic
1113120561 13:106919772-106919794 AGCACAAAGGGCCCAGAAGTGGG - Intergenic
1113530460 13:111020703-111020725 GGCACTCAGGGACCAGCAGGTGG - Intergenic
1114599669 14:23944195-23944217 GGCACCACGGGACCAAAAGGCGG - Intergenic
1117815955 14:59597922-59597944 GGCAGGCAGGGACCAGATGGTGG + Intronic
1118961778 14:70539889-70539911 AGCACCATGGGACCAGAAGGCGG + Intergenic
1120268978 14:82286303-82286325 GGCATCACGGAACCAGAAGGCGG + Intergenic
1120780777 14:88483556-88483578 TGCATGAAGGGACCAGAAGGTGG - Intronic
1121758359 14:96422042-96422064 GGCACCACGGGACCAGAAGGCGG - Intronic
1122788143 14:104173353-104173375 GGCACCCACGGCCGAGAAGGCGG + Exonic
1123208142 14:106733577-106733599 GGCACCATGGGACCAGAAGGCGG + Intergenic
1124052844 15:26215096-26215118 TCCACCTAGGGAGCAGAAGGAGG + Intergenic
1124803258 15:32856045-32856067 TGCACCAAGGGAACAGCAGCTGG + Intronic
1129232144 15:74202841-74202863 GGCCCAAAGGGGCCAGAAAGGGG - Exonic
1130141162 15:81227582-81227604 GGCAGCCAGGGACCAGAACAAGG + Intronic
1130272609 15:82459893-82459915 GGCAGCAAGTGACCATAAGATGG - Intergenic
1130587251 15:85191860-85191882 GGCAGCAAGTGACCATAAGATGG - Intergenic
1132841660 16:1981067-1981089 GGCCCCAAGGGATAGGAAGGGGG - Exonic
1134849316 16:17468125-17468147 AGCTCCAGGAGACCAGAAGGGGG - Intronic
1135622963 16:23971545-23971567 GGCAGCAAGAGACGAGAAGGTGG + Intronic
1136474487 16:30504243-30504265 GACACCGAGGGACCAAAGGGCGG + Exonic
1136625155 16:31457853-31457875 AGCCCTAAGGGAGCAGAAGGGGG + Intergenic
1136871841 16:33814429-33814451 GGCACTGTGGGACCAGTAGGTGG + Intergenic
1137566708 16:49537908-49537930 AGCACACAGGGACCAGATGGGGG + Intronic
1137685940 16:50386847-50386869 GGTACCAAGCGGCCAGGAGGAGG - Intergenic
1137873132 16:51970107-51970129 GCCAACAAGGTTCCAGAAGGTGG - Intergenic
1138470642 16:57232944-57232966 GGCAGCAAGGTGCAAGAAGGAGG - Intronic
1138497528 16:57417207-57417229 GGCCACAAGGGAGCAGCAGGAGG - Intergenic
1139179219 16:64726125-64726147 AGCAGCAAGGGAGCATAAGGAGG - Intergenic
1139949042 16:70660396-70660418 GGGACCTGGGGACCTGAAGGTGG + Exonic
1141493292 16:84389584-84389606 GACACCAAGGGGCCCGAAGAGGG - Intronic
1142311352 16:89315942-89315964 GTGACCTGGGGACCAGAAGGCGG + Intronic
1203100331 16_KI270728v1_random:1301639-1301661 GGCACTGTGGGACCAGTAGGTGG - Intergenic
1143470264 17:7169608-7169630 GGCATCACAGGACCAAAAGGCGG + Intergenic
1143512759 17:7405268-7405290 GGCTTCGAGGGACCAGAAGGCGG - Intronic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1145901069 17:28490872-28490894 GGAACCAAGTCCCCAGAAGGAGG + Exonic
1146747165 17:35342106-35342128 GGCATCACAAGACCAGAAGGCGG + Intergenic
1147539097 17:41341949-41341971 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1148767196 17:50046309-50046331 AGCCCAAAGGGACCACAAGGTGG - Intergenic
1149165624 17:53748792-53748814 GGCATCACAGGACCAGAAGGCGG + Intergenic
1150624265 17:66831596-66831618 ACCCCCAAGGGACCAGAAGGAGG + Intergenic
1150925281 17:69526158-69526180 TTCACCAAGGGACCTGAAGGTGG + Intronic
1150993501 17:70288493-70288515 TGGACCAAGGGACCACAAGATGG + Intergenic
1152061848 17:78082197-78082219 GGCATCACAGGATCAGAAGGCGG - Intronic
1152197174 17:78924830-78924852 GGCGCCGAGGGACCAGGAGGCGG + Intronic
1152519361 17:80846267-80846289 TGCACGAAGGGACCAGAGGCAGG - Intronic
1152832198 17:82504283-82504305 CCCTCCAAGGGACCAGGAGGAGG - Intergenic
1153250999 18:3121448-3121470 GGCAACAATGGGCCAGAAGATGG + Intronic
1154478844 18:14796746-14796768 GGCACTACGGGACGACAAGGTGG - Intronic
1154478994 18:14798182-14798204 GGCACCACGGGACGACAAGGCGG - Intronic
1159118775 18:64145423-64145445 GGCACCATGGGACCAGAAGGCGG + Intergenic
1160914880 19:1491611-1491633 GGCACCCAGCGCCCGGAAGGAGG - Intronic
1162289003 19:9764607-9764629 GGCACTGTGGGACCAGAAGGCGG + Intronic
1162951521 19:14074243-14074265 GGCACCCAGGAACCCGAGGGAGG - Intronic
1164037510 19:21467548-21467570 TGCACAAAGGCAACAGAAGGAGG - Intronic
1165566819 19:36736750-36736772 GGCACCGCGGGACCAGAAGGTGG + Intronic
1166672436 19:44718979-44719001 GGCAAAAAGGGAGAAGAAGGAGG + Intergenic
1167735655 19:51293194-51293216 GCCAGCCAGGGACCAGCAGGTGG + Intergenic
1168687609 19:58358004-58358026 GGCCCCAAGTGTCAAGAAGGTGG + Intronic
926152238 2:10431836-10431858 GACACCAGGGGCCCTGAAGGAGG - Intergenic
927244400 2:20945406-20945428 ACCACCAAGGGATCAGATGGGGG - Intergenic
929005573 2:37389984-37390006 GGCACCGAGGGAACAGATGCAGG + Intergenic
929056482 2:37881338-37881360 GGCATCATGGGAGCAGGAGGAGG + Intergenic
934220396 2:90076899-90076921 GGCACCAAAGGAGAAGAAGATGG - Intergenic
934681932 2:96290262-96290284 GACACCAAGGCACCAGGAGTGGG - Intronic
935248314 2:101238560-101238582 GGCATTGCGGGACCAGAAGGCGG + Intronic
935248974 2:101244954-101244976 GGCATCGCGGGACCAGAAGGCGG + Intronic
937049761 2:118878921-118878943 GGCATCAAGGTCCCAGAATGAGG - Intergenic
937157248 2:119729965-119729987 GGCTCCCAGGGACCAGATGGGGG - Intergenic
939268924 2:139912766-139912788 GGCACCACAGGACCAGAAGGCGG - Intergenic
940490626 2:154354684-154354706 GGCACCAAGAGAACACAATGGGG - Intronic
941894817 2:170618654-170618676 GGCACCATGGGACCAGAAGGCGG - Intronic
944472257 2:200066569-200066591 TGCACCAAGGGCCCACAAAGTGG - Intergenic
944711592 2:202339680-202339702 TGCACCAGGGGACCAGAGGTTGG - Intergenic
945325929 2:208482341-208482363 GGCACTGTGGGACCAGAAGGCGG - Intronic
945488891 2:210431040-210431062 GGCACCGCAGAACCAGAAGGCGG + Intergenic
947303307 2:228714712-228714734 GGCACCATAGGACCAGAAGGTGG - Intergenic
947355392 2:229289456-229289478 AGCACCGCGGGACCAGAAGGTGG + Intergenic
948374572 2:237512912-237512934 ACCACCAAGGGGCCAGGAGGTGG + Intronic
948555805 2:238810133-238810155 GGCACCCAGGTCCCAAAAGGAGG - Intergenic
1169149972 20:3281883-3281905 GACACCAAGGGACCAGATTGCGG - Intronic
1173096190 20:40030862-40030884 GGCGACGAGGGACCAGATGGTGG + Intergenic
1173144504 20:40513042-40513064 GCCACCCAGGGACCAGTTGGTGG - Intergenic
1174501881 20:50991181-50991203 GGCACCAGGGCCCCAGAAGCTGG + Intergenic
1174881425 20:54283340-54283362 TGGACCAATGGGCCAGAAGGTGG + Intergenic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1175330276 20:58158794-58158816 GGCTCCAGGGGTCCAGAGGGAGG - Intronic
1178227093 21:30733233-30733255 TGAACAAAGTGACCAGAAGGTGG - Intergenic
1178833124 21:36072766-36072788 GCCACCAAGAGCCCAGAAGAAGG + Exonic
1181510473 22:23386621-23386643 GGCTCCAAGGCCCCAGGAGGTGG - Intergenic
1183330789 22:37220152-37220174 GGCACCAAGAGAGAAGCAGGAGG + Intergenic
1183357314 22:37366703-37366725 TGCACCAAGGGAGGAGGAGGAGG - Intergenic
1183750843 22:39719489-39719511 GGGACCAAGGCCCCAGAATGTGG - Intergenic
1184309789 22:43633833-43633855 GGCAGTAAGGAACCAGAGGGAGG - Intronic
1184365310 22:44047386-44047408 GGCACCAAGGCACCAGACACTGG + Intronic
1184691419 22:46119097-46119119 GACAGCAAGGGAAGAGAAGGGGG + Intergenic
1184950909 22:47842099-47842121 GGCCCCAAGGGACCAGCCTGTGG + Intergenic
1185166865 22:49266784-49266806 AGCACCAGGGGAACAGAAGGAGG + Intergenic
1185401499 22:50620570-50620592 TCCCCCAAGTGACCAGAAGGGGG - Intergenic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
951294875 3:20921552-20921574 GGCACCGCGGGACCAGAAGGCGG - Intergenic
954325602 3:49861690-49861712 GACGCCAAGGGTCCAGAAAGGGG + Intronic
954371637 3:50172086-50172108 GGCCCCAAGGCACCTGGAGGGGG - Intronic
954421839 3:50423012-50423034 GGGAACAGGGGACCAGAAAGGGG - Intronic
955228762 3:57081054-57081076 GGCAGCAAGGGATCAGGATGTGG + Intergenic
955370529 3:58347393-58347415 AGTTCCCAGGGACCAGAAGGAGG - Intronic
959439752 3:106360763-106360785 GGCATCGCGGGACCAGAATGTGG - Intergenic
959598690 3:108154980-108155002 GGCATCAAGGGATCAGGTGGTGG - Intergenic
961299885 3:125915893-125915915 GGGACCAAGGGACTGGGAGGCGG - Intergenic
961483169 3:127196959-127196981 GGCACCAAGGCAGCTGGAGGGGG - Exonic
961775251 3:129279367-129279389 GGCACCAAGTCACCCGGAGGAGG + Intronic
962932566 3:140051543-140051565 GGCTGCAAGGGGCCAGGAGGAGG + Intronic
963166315 3:142207698-142207720 GGCACCGCAGGACCAGAAGGCGG + Intronic
963402035 3:144810526-144810548 GGCATAAAGGGACCAGAAAATGG + Intergenic
964004035 3:151808743-151808765 GGCACTGCAGGACCAGAAGGCGG - Intergenic
964620694 3:158717624-158717646 GAAAGCCAGGGACCAGAAGGAGG + Intronic
964996747 3:162891658-162891680 GGCACCCAAAGTCCAGAAGGGGG - Intergenic
965192419 3:165548750-165548772 GGCATCGCAGGACCAGAAGGCGG + Intergenic
967590446 3:191267585-191267607 GGCACCATGGGACCAGAAGGTGG - Exonic
968084080 3:195866902-195866924 GGCCCCAGGAGCCCAGAAGGTGG + Exonic
968372989 4:12114-12136 TGCCCCAAGCGGCCAGAAGGGGG - Intergenic
968654964 4:1774505-1774527 GGAACCCAGGCCCCAGAAGGAGG + Intergenic
968863761 4:3194441-3194463 GGCACCAGAGGCCCAGGAGGTGG + Intronic
968997770 4:3956087-3956109 GGGACCAAGGGACTGGGAGGAGG + Intergenic
969295674 4:6269653-6269675 GGGCCCGAGGGGCCAGAAGGCGG - Intergenic
969463581 4:7341859-7341881 GGCTGCCAGGGACTAGAAGGAGG - Intronic
969597200 4:8156233-8156255 GTCACAAGGGGACCAGTAGGGGG - Intronic
970455920 4:16224424-16224446 GACACCAGGGGAAAAGAAGGAGG + Intronic
971219428 4:24691536-24691558 TGGACCAAGGGACCAGATGTGGG + Intergenic
972851558 4:43057102-43057124 GGGAGCAAGGGCCCAGAATGGGG - Intergenic
973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG + Intronic
974644946 4:64677356-64677378 GGCAGCATGGGTCAAGAAGGAGG + Intergenic
975374431 4:73627159-73627181 GGCACCAAGAGAACACAATGGGG - Intergenic
975619509 4:76281886-76281908 GGCACCGTGGGACCAGAAGGCGG - Intronic
975936868 4:79592042-79592064 GGCACCGCAGGACCAGAAGGCGG - Intergenic
976636445 4:87291133-87291155 GGCACCGCGGGACCAGAAGGCGG - Intergenic
977058080 4:92218480-92218502 GGCACCACGGGACCAGAAGACGG + Intergenic
977555060 4:98480024-98480046 GGCACTGCGTGACCAGAAGGCGG + Intronic
977630038 4:99232338-99232360 GGCACCACGGGACCAGATGGCGG + Intergenic
978544777 4:109859193-109859215 GGCACCGTGGGACCAGAAGGTGG - Intronic
979675279 4:123402655-123402677 GGCAACAGGGGAAGAGAAGGTGG - Exonic
980661435 4:135864078-135864100 GGCACCATGGGACCAGAAGGCGG - Intergenic
981420407 4:144543283-144543305 GACATCACGGGACCAGAAGGCGG + Intergenic
981638758 4:146911657-146911679 ACCAGTAAGGGACCAGAAGGAGG - Intronic
982494479 4:156073737-156073759 AGCAAGAGGGGACCAGAAGGAGG + Intergenic
982846206 4:160255952-160255974 AGCATCGCGGGACCAGAAGGTGG - Intergenic
983520684 4:168705486-168705508 TGCAGCAAGAGAGCAGAAGGTGG - Intronic
985462406 4:190120453-190120475 TGCCCCAAGCGGCCAGAAGGGGG + Intergenic
986129233 5:4911696-4911718 GGCTCCAAGGGAACAGAATCAGG - Intergenic
986356813 5:6936784-6936806 AGGTCTAAGGGACCAGAAGGAGG + Intergenic
987066594 5:14296044-14296066 GGCAGCAAGAGACAGGAAGGAGG + Intronic
988440382 5:31226631-31226653 GGCAAAAAGGGACAAGAAGTAGG - Intronic
988519073 5:31930038-31930060 GGCAAAAAGGGAGCAGAAGCAGG - Intronic
988769850 5:34421487-34421509 GGCACCGTGGGACCAGAAGGTGG - Intergenic
989482310 5:41946129-41946151 GGCACCATGGGACCAAAAGGTGG + Intergenic
989559434 5:42834394-42834416 GGCATCACAGGACCAGAAGGCGG - Intronic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
992818692 5:80471578-80471600 GGCACCACGGGACCAGAAGGCGG + Intronic
994901168 5:105771471-105771493 GGGAGCAAGGGACCACAAGTAGG - Intergenic
994909206 5:105880791-105880813 GGCACTAAGTGACTAGCAGGTGG - Intergenic
995631891 5:114143078-114143100 AGCATCTTGGGACCAGAAGGCGG - Intergenic
997383820 5:133456901-133456923 GGCACAAATGGACCAGAGGTAGG - Intronic
997400768 5:133599958-133599980 GGAACCAAGGAACCAGGAAGGGG - Intronic
997401694 5:133608436-133608458 GACACCAGAAGACCAGAAGGTGG + Intronic
998729424 5:145057592-145057614 AGCACCAAAGGACAAGAGGGAGG - Intergenic
999107001 5:149081896-149081918 GGCACCAAGAGGACACAAGGAGG + Intergenic
999682498 5:154073116-154073138 GGCACCGCGGGACCAAAAGGCGG - Intronic
999718547 5:154381302-154381324 GGGACTAAGGCTCCAGAAGGAGG + Intronic
1001012283 5:168109207-168109229 GGCAGCAAAGGCCCAGAAGCAGG + Intronic
1001944948 5:175770983-175771005 GGTCTCAAGGGACCAGAAGAAGG - Intergenic
1002170828 5:177373285-177373307 GGCACCAAAGGTCTATAAGGGGG + Intergenic
1003645344 6:7910032-7910054 GGCACCGAGGGAGGGGAAGGTGG - Intronic
1005773318 6:29099930-29099952 GGCAGGAGGGGAGCAGAAGGGGG + Intergenic
1005779368 6:29172404-29172426 GGCAGGAGGGGAGCAGAAGGGGG + Intergenic
1006573497 6:35025445-35025467 GGCAGCAAGGGACCAGCAAGCGG - Intronic
1006646054 6:35515010-35515032 GGCTCCACGAGACCAGCAGGTGG + Intergenic
1007597880 6:43062799-43062821 GGCACAGAGGAGCCAGAAGGTGG - Intronic
1007722345 6:43892481-43892503 GGCCCCAGCAGACCAGAAGGTGG + Intergenic
1008272647 6:49507807-49507829 GGCACTGCAGGACCAGAAGGTGG - Intronic
1008535195 6:52502121-52502143 AACACCAAGGGACCAGCATGGGG + Exonic
1011851590 6:91636020-91636042 GGAAGCTTGGGACCAGAAGGTGG + Intergenic
1012953954 6:105548493-105548515 GGCAGGACGGGACCAGAAGTCGG - Intergenic
1013174940 6:107668955-107668977 GGCTTCCAGGGAGCAGAAGGAGG + Intergenic
1014405199 6:121042804-121042826 GGCATCATGGGACCAGAAGGCGG + Intergenic
1014405837 6:121049202-121049224 GGCATCACGGGACCAGAAGGCGG + Intergenic
1014912684 6:127113164-127113186 GGCACCAAGGAACTAAAAAGAGG + Intergenic
1015270859 6:131337467-131337489 GGCAGAAATGAACCAGAAGGTGG + Intergenic
1018763968 6:166915253-166915275 GGCACTGCAGGACCAGAAGGCGG - Intronic
1019693133 7:2428511-2428533 GGCATCGCAGGACCAGAAGGCGG - Intronic
1021751790 7:23808414-23808436 AGCAACAAGGCACAAGAAGGTGG - Intronic
1022387904 7:29918617-29918639 GCCAGCAAGCCACCAGAAGGTGG + Intergenic
1022450471 7:30509158-30509180 GGCACCACGGGACCAGAAGATGG - Intronic
1023623637 7:42096002-42096024 GCCTCCAAGGGGCCAGAGGGAGG + Intronic
1025735608 7:64144068-64144090 GGCACTGCAGGACCAGAAGGCGG - Intronic
1026015763 7:66669477-66669499 GGCAGCAAAAGACAAGAAGGTGG + Intronic
1026131087 7:67621520-67621542 CGCACCAAGGGAACTGCAGGTGG - Intergenic
1027197689 7:76042359-76042381 GGCACCCAGGGAGCAGTTGGTGG - Intronic
1027217625 7:76194188-76194210 GGCACAAAGAGAAGAGAAGGAGG + Intergenic
1028327504 7:89545247-89545269 GGCACCATGTGACCAGAAGGCGG - Intergenic
1028707736 7:93869987-93870009 GGCACCGTGGGACCAGAAGGCGG - Intronic
1029171015 7:98628971-98628993 GACACCAAGGAACTGGAAGGCGG - Exonic
1029206203 7:98870433-98870455 AGCCCCAAGGGACCTGCAGGCGG - Intronic
1029464823 7:100718900-100718922 GACACCACGGGACCAGAAGGCGG + Intergenic
1029866896 7:103641786-103641808 TGCACCAAGGAACAAGAAAGGGG + Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1032470810 7:132177617-132177639 GGCCCACAGGGAGCAGAAGGAGG + Intronic
1032470928 7:132178382-132178404 GGCCCACAGGGAGCAGAAGGAGG + Intronic
1032541845 7:132709528-132709550 GGCACAAAGAGATCAGAAGAGGG + Intronic
1032974452 7:137206314-137206336 GGCACCATGGGACCAGAAGGCGG + Intergenic
1033197740 7:139341700-139341722 GGGACCAAAGGACCAGCGGGGGG + Intronic
1033502192 7:141963107-141963129 GGCACCGCGGGAGCAGAAAGCGG + Intronic
1034342258 7:150365404-150365426 GGCACCAAGCGAGGAGAAGTGGG + Intergenic
1035068895 7:156126697-156126719 TGCTCCAAGGGCCCAGAAGTTGG - Intergenic
1035249979 7:157590768-157590790 GGGCCCATGGGTCCAGAAGGGGG - Intronic
1035491319 7:159281381-159281403 GGCATCCAGGGACCAGCAGGGGG - Intergenic
1036011738 8:4732930-4732952 GGCAGCAAGGGCGGAGAAGGAGG + Intronic
1036083946 8:5592153-5592175 GGCACCATAGGACGAGAAGGCGG + Intergenic
1037005000 8:13767438-13767460 GGCATCGCAGGACCAGAAGGCGG - Intergenic
1038666564 8:29542742-29542764 GGCACCACAGGACCAGAAGGCGG + Intergenic
1038863725 8:31415739-31415761 GGAAACAATGGAGCAGAAGGAGG - Intergenic
1038937467 8:32268084-32268106 GGCACCAAGGGGCCATATTGGGG + Intronic
1039672551 8:39618262-39618284 GGCACCACAGGACCAGAAGGCGG - Intronic
1040071377 8:43191569-43191591 GGCACCCAGGGACTGGCAGGAGG - Exonic
1040277247 8:46020327-46020349 GGCATCACGGGACCAGAAGGTGG + Intergenic
1041296357 8:56361295-56361317 GGCACCTTGGGACCAGAAGCTGG + Intergenic
1042779565 8:72475895-72475917 TGGACCAAGGGAGCAGATGGGGG - Intergenic
1043270711 8:78329733-78329755 GGGTCCCAGGGACCACAAGGAGG - Intergenic
1044941578 8:97349099-97349121 GGCACCATGACCCCAGAAGGTGG - Intergenic
1045245043 8:100435394-100435416 GGTACCAAGGGGCCAGAGGATGG + Intergenic
1048422267 8:134288865-134288887 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1048431939 8:134378627-134378649 GGCACCATGGGACCAGAAGGCGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049658349 8:143808743-143808765 GGCTCCTCGGGCCCAGAAGGAGG - Exonic
1049792064 8:144476700-144476722 GGCAGCAAGTGTCCAGGAGGAGG + Intergenic
1050198164 9:3110447-3110469 GGCACCGTGGAACCAGAAGGCGG - Intergenic
1053562087 9:39207176-39207198 AGCAACAAGGGACCAATAGGAGG - Intronic
1053827896 9:42045179-42045201 AGCAACAAGGGACCAATAGGAGG - Intronic
1054135031 9:61411782-61411804 AGCAACAAGGGACCAATAGGAGG + Intergenic
1054602664 9:67142267-67142289 AGCAACAAGGGACCAATAGGAGG + Intergenic
1056454397 9:86746121-86746143 GGCATGCAGGGACCAGGAGGTGG + Intergenic
1056710952 9:88991504-88991526 GGGACTCAGGGACCAGAAGGCGG + Exonic
1057388309 9:94623321-94623343 AGCACCGATGGACCAGAAGAAGG + Intronic
1057480822 9:95444444-95444466 GGCACCAAGACAGCAGCAGGGGG + Exonic
1058258248 9:102796752-102796774 AGCATCACAGGACCAGAAGGCGG + Intergenic
1059114908 9:111592512-111592534 GGCACCACGGAACCAGAAGGCGG + Intronic
1060345195 9:122809799-122809821 GGCACCACGGGACCAGAAGGCGG + Intronic
1060435235 9:123587073-123587095 GGCACCGCAGGACCAGAAGCTGG - Intronic
1060545736 9:124458074-124458096 GGCACCAAGGCACCACCCGGTGG - Intronic
1060555959 9:124507291-124507313 GGCACCAGGGGTCCAGGGGGAGG + Exonic
1061422027 9:130477777-130477799 GGCACCCAAGGACCAGGCGGGGG + Intronic
1062516541 9:136939807-136939829 GGGACCAGGGGCCCAGAAGTGGG - Intronic
1186120433 X:6355342-6355364 GGCACCGTGGGAGCAGAAGATGG - Intergenic
1186367738 X:8913055-8913077 TGCACGAAGGGACCAGGAGGAGG + Intergenic
1187182736 X:16958484-16958506 GGCACGAAGGGACTAGCAGCAGG + Intronic
1188224491 X:27580404-27580426 GGGACAAAAGGAGCAGAAGGGGG - Intergenic
1188975036 X:36662776-36662798 GGCATCGTGGAACCAGAAGGCGG + Intergenic
1189017282 X:37297320-37297342 GGCACCGCAGGACCAGAAGGCGG - Intergenic
1189172843 X:38926048-38926070 GGCACCAAGGCCCCAGACTGTGG - Intergenic
1189637622 X:43028162-43028184 GGCACCATGGAACCAGAAGGTGG - Intergenic
1190583582 X:51913926-51913948 GGCACCAAGAGAACACAATGGGG - Intergenic
1191087848 X:56588182-56588204 GCCATCAGGGGACCAGCAGGTGG - Intergenic
1191238058 X:58152273-58152295 GACACCACGGGACCAGAAGGCGG - Intergenic
1192279176 X:69665568-69665590 GGCACCAAGAGAACACAATGGGG - Intronic
1192908055 X:75572706-75572728 AGCATCGTGGGACCAGAAGGCGG + Intergenic
1192950503 X:76011368-76011390 AGCATCATGGGACCAGAAGGTGG + Intergenic
1193442594 X:81561408-81561430 GGCATCATAGGACCAGAAGGCGG + Intergenic
1193565497 X:83071155-83071177 GGCACCACGGGACCAGAAGGCGG + Intergenic
1194192508 X:90855215-90855237 GGCACCACGGGACCAGAAGGTGG + Intergenic
1194352209 X:92834598-92834620 GGGAACAAGGGCCCAGAATGGGG - Intergenic
1195393805 X:104389894-104389916 GGCAGCAGGGGACCAGCAGAGGG - Intergenic
1196609526 X:117695580-117695602 GGGACCTAGGGACTAGAATGGGG - Intergenic
1198267689 X:135024578-135024600 GGCACCGCGGGACCAGAAGGCGG + Intergenic
1198309226 X:135413518-135413540 GGCACCAAGAAAACTGAAGGAGG + Intergenic
1199248939 X:145637674-145637696 GGCACCAAGCTCCCAGAGGGAGG + Intergenic
1199602796 X:149552626-149552648 GGCACCGTGGGAGCAGAAGGCGG - Intergenic
1199615503 X:149652180-149652202 GGCCTCAGGGGAGCAGAAGGTGG - Intergenic
1199647593 X:149926849-149926871 GGCACCGTGGGAGCAGAAGGCGG + Intergenic
1199980199 X:152916592-152916614 GGCCCCGAGGGACAGGAAGGGGG + Intronic
1200539140 Y:4437659-4437681 GGCACCACGGGACCAGAAGGTGG + Intergenic
1200660518 Y:5951336-5951358 GGGAACAAGGGCCCAGAATGGGG - Intergenic
1201622290 Y:15973467-15973489 GGCACCATGGGACCAGAAGGCGG - Intergenic
1201623125 Y:15981915-15981937 GGCACTGTGGGACCAGAAGGCGG - Intergenic
1202177411 Y:22110461-22110483 GGCACCACAGGACCAGAAAGCGG - Intergenic
1202213950 Y:22475923-22475945 GGCACCACAGGACCAGAAAGCGG + Intergenic
1202370278 Y:24191443-24191465 GGCAGCAAGTGACCATAAGATGG + Intergenic
1202500506 Y:25478674-25478696 GGCAGCAAGTGACCATAAGATGG - Intergenic