ID: 906561636

View in Genome Browser
Species Human (GRCh38)
Location 1:46762460-46762482
Sequence GCTACGTTGTGAGCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906561629_906561636 27 Left 906561629 1:46762410-46762432 CCTGTGCTTTCTCTCTGTCTTGA 0: 1
1: 1
2: 2
3: 42
4: 512
Right 906561636 1:46762460-46762482 GCTACGTTGTGAGCAGCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906561636 Original CRISPR GCTACGTTGTGAGCAGCCCC AGG Intronic
904421834 1:30399082-30399104 GCTATGGTGTGAGCAGCACTGGG - Intergenic
905124622 1:35708077-35708099 CCTGCTTTGTGCGCAGCCCCCGG + Intergenic
906561636 1:46762460-46762482 GCTACGTTGTGAGCAGCCCCAGG + Intronic
912385419 1:109268944-109268966 CCTGCGTGGGGAGCAGCCCCCGG + Exonic
923752849 1:236762481-236762503 GCTGCGTCGGGAGCTGCCCCCGG + Exonic
924680055 1:246221671-246221693 GCTATGGTGTGGGCAGCTCCAGG - Intronic
1063626756 10:7697654-7697676 ACTAACTTGTCAGCAGCCCCAGG - Intergenic
1069961322 10:72080993-72081015 GCTATGTTCTGAGCTGCCTCAGG + Intronic
1070381374 10:75883310-75883332 GTGACCTTGTGAGCAGTCCCTGG + Intronic
1074890782 10:117735246-117735268 GCTATGCTCTGCGCAGCCCCGGG + Intergenic
1076474134 10:130740663-130740685 TCCAGGTTGTGAGCAGCCACAGG + Intergenic
1081747637 11:45484146-45484168 GGTAGGCTGTGAGTAGCCCCCGG - Intergenic
1082839304 11:57676007-57676029 GCTACATTATTAGAAGCCCCAGG + Intronic
1092194079 12:6538648-6538670 GCTATTCTGTGGGCAGCCCCAGG + Intronic
1100189165 12:92172366-92172388 GATACCTTATGAGCAGCCTCTGG + Intergenic
1101532833 12:105590101-105590123 GAGAGGTTGTGAGCTGCCCCAGG - Intergenic
1103589235 12:121979474-121979496 GCTCCGCAGTGAGCACCCCCAGG - Intronic
1103935692 12:124475291-124475313 GCTGAGCTGTGAGCGGCCCCAGG - Intronic
1109633598 13:65085161-65085183 GCTACGGGGTGGGCAGCTCCAGG + Intergenic
1113858160 13:113460828-113460850 GCCACGTTCTGAGGAGGCCCCGG + Intronic
1115880428 14:37911006-37911028 GCCACGTTGTGTGCAGCCATGGG - Intronic
1122257126 14:100486635-100486657 GATAAGAAGTGAGCAGCCCCAGG - Intronic
1124107413 15:26753105-26753127 GCTAACTTCTGAGCTGCCCCAGG + Intronic
1125657110 15:41367143-41367165 GCAGCGTTGTAAGCAGCCTCTGG - Intronic
1125766498 15:42139976-42139998 GCTATGTGATCAGCAGCCCCAGG - Exonic
1128694377 15:69749436-69749458 GGGAAGATGTGAGCAGCCCCAGG + Intergenic
1129271431 15:74421296-74421318 GATACTTTGTGGGCAGCCCTGGG - Intronic
1131073393 15:89479816-89479838 ACTACGCTGTGAGGAGCTCCTGG + Intronic
1132376237 15:101330011-101330033 GCTGAGTTGAGAGCAGACCCTGG - Intronic
1132625349 16:888954-888976 GCACCGTTGTGAGGACCCCCAGG - Intronic
1132676468 16:1123246-1123268 CCCAAGTTCTGAGCAGCCCCCGG + Intergenic
1137291142 16:47052811-47052833 AGAACTTTGTGAGCAGCCCCAGG + Intergenic
1141098109 16:81177285-81177307 GCTGCTTTGCAAGCAGCCCCAGG - Intergenic
1141701125 16:85642616-85642638 GCTAAGCTCTGGGCAGCCCCCGG + Intronic
1141764976 16:86052195-86052217 CCTAGGCTGGGAGCAGCCCCTGG - Intergenic
1142231528 16:88902347-88902369 GCTGCGCTGGGCGCAGCCCCCGG + Intronic
1143911379 17:10252581-10252603 ACCACGTTGTGAACAGCCCTAGG - Intergenic
1145068009 17:19776649-19776671 GCTACATTTTGAGTAGCCACAGG - Intronic
1150656465 17:67042943-67042965 ACTACCTGGTGAACAGCCCCAGG - Intergenic
1150958739 17:69891425-69891447 TCTACGTTGTGAGTGGCCCCTGG - Intergenic
1151432676 17:74074732-74074754 GCCATGTTGTGAGGAACCCCAGG + Intergenic
1152793933 17:82297635-82297657 GCTATTTTGTGACCAGCCCCTGG + Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1159560093 18:69984339-69984361 GCTTTGTTCTCAGCAGCCCCAGG - Intergenic
1163706109 19:18814324-18814346 CCTACGTTGAGAGCAGACACAGG + Intergenic
925423168 2:3727891-3727913 GCTACGCTGTGACAAGCCCTGGG - Intronic
925678296 2:6389663-6389685 GCTACGTTGTGTCCAGTCTCAGG + Intergenic
927902319 2:26829426-26829448 GCTACTTTGGGGGCAGCTCCTGG - Intergenic
928368503 2:30721813-30721835 GGTCAGTGGTGAGCAGCCCCAGG - Intergenic
929224655 2:39500561-39500583 ACAACTTTATGAGCAGCCCCAGG - Intergenic
933591613 2:84239298-84239320 ACAAAGTTGTGAGCTGCCCCAGG + Intergenic
938812149 2:134863450-134863472 GCACCGTTGTGAGCTACCCCAGG + Exonic
939965153 2:148603201-148603223 GCTATGTTGTAAGCTGCCCTTGG - Intergenic
941388530 2:164882663-164882685 ACTACGTTGCGAACAGCACCAGG + Intergenic
942314870 2:174688973-174688995 GCCATGTTGTGAGCTGCCCCAGG - Intergenic
942812771 2:180017915-180017937 GCTATGTTGTGAGCTGTCCTAGG - Intergenic
948075174 2:235160338-235160360 GCAATGCTGTGAGCAGTCCCAGG + Intergenic
948980735 2:241493327-241493349 GCTACAGCGTGAGCATCCCCAGG + Exonic
1175969598 20:62677794-62677816 GCCACGCTGTGAGCAAGCCCAGG + Intronic
1176079764 20:63266599-63266621 GCACCGTCGTGGGCAGCCCCGGG + Intronic
1176079797 20:63266713-63266735 GCACCGTCGTGGGCAGCCCCGGG + Intronic
1176079815 20:63266770-63266792 GCACCGTCGTGGGCAGCCCCGGG + Intronic
1176079833 20:63266827-63266849 GCACCGTCGTGGGCAGCCCCGGG + Intronic
1176079851 20:63266884-63266906 GCACCGTCGTGGGCAGCCCCGGG + Intronic
1176079869 20:63266941-63266963 GCACCGTCGTGGGCAGCCCCGGG + Intronic
952538955 3:34345863-34345885 GCTACCTGGTTAGCAGGCCCTGG - Intergenic
954201162 3:49024142-49024164 GCTGTTTTGTGAGCAGCCTCAGG + Intergenic
962526986 3:136245931-136245953 GCTATGCTGGGAGCAGCCCGTGG - Intergenic
984748336 4:183245753-183245775 GCTTCGTTGTAAGCAGCCTTTGG + Intronic
985166386 4:187099459-187099481 GCCATGTTGAGAGCTGCCCCAGG + Intergenic
985676750 5:1235383-1235405 GCAGTGTTGTGAGCAGCCCAGGG + Intronic
985840959 5:2305394-2305416 ACAACCTGGTGAGCAGCCCCGGG - Intergenic
987172115 5:15269831-15269853 GCTATGTTGTGAGCTGACCTAGG - Intergenic
992158203 5:73975319-73975341 GCTATGTTGTGAGAAGGCCCAGG - Intergenic
997443802 5:133926856-133926878 GCTGCCTTGTGAGCAGGCACTGG - Intergenic
998424731 5:142016818-142016840 GCTATGTTGTGAGGAAGCCCAGG - Intergenic
999018320 5:148133917-148133939 GTTACGTTGTGAGGAGCACTGGG + Intronic
1004527234 6:16420300-16420322 GCTATCTTGTGAACAGTCCCAGG + Intronic
1005889702 6:30127185-30127207 GCTACTCTGTGAGAAGCCCGAGG + Intergenic
1006418744 6:33920450-33920472 GCTTCATTGTGAGCAGACTCTGG + Intergenic
1007903214 6:45431369-45431391 TCTATGTAGTGAGGAGCCCCAGG + Intronic
1015886558 6:137924069-137924091 GGGCCCTTGTGAGCAGCCCCAGG + Intergenic
1016009986 6:139129425-139129447 GCCCTGTTGTGAGCTGCCCCAGG + Intergenic
1016498241 6:144689243-144689265 GCTCCTGTGGGAGCAGCCCCAGG + Intronic
1017777226 6:157689687-157689709 TCTACTGTGTGAGCAGCACCTGG + Intergenic
1018730532 6:166646667-166646689 GCTCTGGTGTGAGGAGCCCCTGG - Intronic
1019739158 7:2664221-2664243 GCCTGGTTGGGAGCAGCCCCTGG + Exonic
1019934400 7:4244903-4244925 AGTATGTTGTGAACAGCCCCTGG - Intronic
1029120897 7:98267520-98267542 ACTATGTTGTGATCAGCCCCTGG - Intronic
1034877253 7:154735962-154735984 GCTACGTTGAGAGCAGACGATGG - Intronic
1043847305 8:85177582-85177604 ACTTGGTAGTGAGCAGCCCCAGG - Exonic
1049776415 8:144407911-144407933 GCCATGTTGTGAGCTGCCCCAGG + Intronic
1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG + Intronic
1051032131 9:12694044-12694066 GCTACTTTTTCAGCAGGCCCGGG + Exonic
1051410386 9:16784195-16784217 GCTACATTGTGAGCAACTCCAGG - Intronic
1057226316 9:93295121-93295143 GCTCTGTGGTGAGCAGCCCAGGG + Intronic
1058166904 9:101630020-101630042 GCTACTATGAGAACAGCCCCGGG - Intronic
1186105081 X:6196846-6196868 GCTGTGTTGTGAGTACCCCCAGG - Intronic
1189323666 X:40100537-40100559 GCCTCTTTGTCAGCAGCCCCGGG - Intronic
1198320908 X:135518315-135518337 GCTATGTTGTGAACAGCCAATGG + Intergenic
1198951796 X:142080412-142080434 GGTATGTTTTCAGCAGCCCCCGG + Intergenic