ID: 906561798

View in Genome Browser
Species Human (GRCh38)
Location 1:46763697-46763719
Sequence GGCTTTACACAGAGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906561798_906561805 21 Left 906561798 1:46763697-46763719 CCAGGCTCCCTCTGTGTAAAGCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 906561805 1:46763741-46763763 ATGGACAGCTCACAGACTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 150
906561798_906561807 30 Left 906561798 1:46763697-46763719 CCAGGCTCCCTCTGTGTAAAGCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 906561807 1:46763750-46763772 TCACAGACTCCTGGTTGCCAGGG 0: 1
1: 1
2: 2
3: 35
4: 288
906561798_906561806 29 Left 906561798 1:46763697-46763719 CCAGGCTCCCTCTGTGTAAAGCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 906561806 1:46763749-46763771 CTCACAGACTCCTGGTTGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 227
906561798_906561803 2 Left 906561798 1:46763697-46763719 CCAGGCTCCCTCTGTGTAAAGCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 906561803 1:46763722-46763744 GAGTAATGTATATCTCCACATGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906561798 Original CRISPR GGCTTTACACAGAGGGAGCC TGG (reversed) Intronic
900806098 1:4769359-4769381 GGCCTGACCCAGGGGGAGCCAGG - Intronic
901260385 1:7866440-7866462 AGCCTTGCACAGAGGGGGCCTGG - Intergenic
902905322 1:19552404-19552426 GGCTTTACTCTGAGTGAGACAGG - Intergenic
903384951 1:22920195-22920217 GGCTTTACTCAGCTGTAGCCTGG - Intergenic
903516659 1:23915840-23915862 GGCTTTGCGCTGAAGGAGCCAGG - Intergenic
904611568 1:31728692-31728714 GGCTTTAGAGACAGGAAGCCTGG + Intronic
906561798 1:46763697-46763719 GGCTTTACACAGAGGGAGCCTGG - Intronic
910677759 1:89831988-89832010 TGCTTCACACAAAGGGACCCTGG - Intronic
915877873 1:159631478-159631500 GGCTTTGGACAGTGGGAGACGGG - Intergenic
916484070 1:165242325-165242347 GGATTTTCCCAGAGGAAGCCTGG - Intronic
919773987 1:201181823-201181845 TGCTTTACACATAGGAAACCTGG - Intergenic
919821657 1:201476781-201476803 GGATTTCCACTGAGAGAGCCAGG - Intergenic
920261227 1:204689308-204689330 GGCTCTGCACATGGGGAGCCCGG - Intergenic
922180775 1:223231225-223231247 GGCTTTGTCCAGAGGGAGCCTGG - Intronic
922616408 1:226963539-226963561 GGCTTGACAGTGAGGGAGCCTGG - Intronic
923678516 1:236100472-236100494 GGTTTTAGACAGAGCGAGTCGGG - Intergenic
1066426032 10:35308581-35308603 GTCTGGACAGAGAGGGAGCCTGG + Intronic
1067242576 10:44508962-44508984 GGCGCCACCCAGAGGGAGCCTGG + Intergenic
1067451852 10:46386595-46386617 GGCTTTGCACGGAGGCAGCCTGG - Intronic
1067585386 10:47473160-47473182 GGCTTTGCACGGAGGCAGCCTGG + Intronic
1069728730 10:70597989-70598011 GGGTTCTCACAGTGGGAGCCAGG - Exonic
1070603125 10:77879392-77879414 GGCTTTATTCAGAGTGAGACGGG + Intronic
1071431641 10:85611508-85611530 GCCTTTGCACAGAGGAAACCAGG + Intronic
1071674761 10:87645015-87645037 GGCTGTCCTCAGAGGGAGCCAGG + Intergenic
1074851712 10:117444467-117444489 TGCTTTCCACAGAGGCAGCAGGG - Intergenic
1079654836 11:22974544-22974566 GGCTTTACCCAGAGAGAGTGAGG - Intergenic
1081999231 11:47384029-47384051 AATTTTACACAGAGGGGGCCGGG + Intergenic
1084747816 11:71184342-71184364 GGCTGCACACAGAGGCATCCTGG + Intronic
1085057273 11:73412608-73412630 GACTTTACACAAGGGGATCCTGG + Intronic
1089293980 11:117457233-117457255 GGTTATACACAGCAGGAGCCCGG - Intronic
1090652300 11:128817729-128817751 CTCTGTACACTGAGGGAGCCTGG - Intergenic
1093718758 12:22413790-22413812 GGCTTTACACATAGGAAGAAAGG - Intronic
1094293321 12:28876222-28876244 GGCTTTACATAGAGAGTGTCTGG + Intergenic
1095053905 12:37578320-37578342 AGTTTTACAAAGATGGAGCCTGG - Intergenic
1096683142 12:53270169-53270191 AGCTTAACAAGGAGGGAGCCAGG - Intronic
1096688989 12:53307906-53307928 GGCATTATCCAGGGGGAGCCAGG - Exonic
1101600063 12:106201636-106201658 GGCTTTACACTGAAGCCGCCTGG - Intergenic
1102015112 12:109643128-109643150 GGCTTTTCACAGAGGGAGCTGGG - Intergenic
1102634506 12:114311423-114311445 GGCATTACCCAGTGGGAGCTGGG + Intergenic
1103510008 12:121467497-121467519 GGCCGCACACAAAGGGAGCCCGG + Intronic
1104611962 12:130236203-130236225 GGCTTAACAGAAAGGAAGCCGGG - Intergenic
1111962724 13:94829055-94829077 GCCTTTCCACAGACGGAACCAGG - Intergenic
1112146338 13:96704658-96704680 GGCTTAGCAGAGAGGAAGCCAGG + Intronic
1112519910 13:100086121-100086143 GGCACTACACAGAAGCAGCCTGG - Intergenic
1114731153 14:24993997-24994019 GGCTATACATAGAGAGAGACTGG - Intronic
1115305275 14:31927590-31927612 GGCTTTACACTGAGTGAGATGGG - Intergenic
1117268880 14:54120707-54120729 GGATTCATACAGAGGGAGGCTGG + Intergenic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1120026929 14:79596894-79596916 GGATTGACACAGCGGGAGCATGG - Intronic
1121489394 14:94347039-94347061 TGATTAACTCAGAGGGAGCCGGG - Intergenic
1124585724 15:31004659-31004681 GGCTTTAAAAAAAGGAAGCCAGG - Intronic
1125482447 15:40089884-40089906 TGCTTTGCAGAGAAGGAGCCGGG - Exonic
1126036004 15:44546652-44546674 GGCTTTAATCATAGGTAGCCTGG - Intronic
1128609068 15:69059400-69059422 GACTTCACAGAGATGGAGCCTGG - Intronic
1133203780 16:4220607-4220629 GGATATCCAGAGAGGGAGCCAGG - Intronic
1133883866 16:9807744-9807766 GGCCTTGCACTGGGGGAGCCCGG - Intronic
1134047709 16:11113273-11113295 AGCTTTACACAAAGGGACTCAGG - Intronic
1136419199 16:30122037-30122059 GGCCTTACAAAGGGGGAGTCCGG + Intronic
1137709293 16:50555303-50555325 GGCTTTCCACAGACAGTGCCAGG - Intronic
1137742985 16:50798978-50799000 GGGGCTACCCAGAGGGAGCCAGG - Exonic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1140743725 16:77963281-77963303 GGTTTTTCAAAGAGGGAGGCAGG + Intronic
1142109477 16:88323602-88323624 GGCTTTGCCAAGAGGAAGCCTGG - Intergenic
1146629032 17:34456977-34456999 GGCTTTAAACAGAGGGGTCTTGG - Intergenic
1147652358 17:42069745-42069767 GTCTTTAAAGAGAGGGGGCCAGG + Intergenic
1148480549 17:47957162-47957184 GGCTTTGCCCAGACTGAGCCAGG + Intronic
1150245636 17:63672768-63672790 GGCATTACACAGAACCAGCCAGG + Intronic
1203163352 17_GL000205v2_random:71772-71794 GGCTTTACCCACAGGGAGTGTGG - Intergenic
1156940159 18:42757592-42757614 GGCCTTACACACACGGAGACAGG + Intronic
1160228908 18:77031868-77031890 GGCTGTGCCCAGTGGGAGCCAGG + Intronic
1162116209 19:8430964-8430986 GGCCATAGACAGAGGCAGCCAGG - Intronic
1163683291 19:18696100-18696122 GGGTTTACAGAGTGGGAGACAGG + Intronic
1167467349 19:49657359-49657381 GGCTTTTCACCGCGGGAGCGGGG - Intronic
1168483430 19:56740663-56740685 AGCTGTCCACAGAGGGACCCTGG - Intergenic
925014091 2:508619-508641 GGGTTCACACAGAGAGACCCAGG + Intergenic
926006139 2:9374680-9374702 GGCCTTAGACAAAGGGAGGCCGG + Intronic
930580836 2:53209907-53209929 GACAGTTCACAGAGGGAGCCAGG - Intergenic
932178646 2:69625534-69625556 CATTTTACACATAGGGAGCCTGG + Intronic
932689765 2:73902297-73902319 GGCTCCACACAGAGGGATTCAGG - Intronic
937380196 2:121369618-121369640 GGCTTTACGCAGCAGGAACCCGG + Intronic
938732239 2:134155718-134155740 GGCTAGAAACAGAGGGAGGCAGG - Intronic
944038767 2:195330808-195330830 ACCCTTACACAGAGGAAGCCAGG + Intergenic
944476250 2:200109901-200109923 GGCTTTCATCAGACGGAGCCTGG + Intergenic
947643089 2:231718042-231718064 AGCTTCACACAGAGGACGCCAGG - Intergenic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1169195468 20:3680209-3680231 AGCATTACTCAGAGGGCGCCTGG + Intronic
1172481615 20:35274969-35274991 GGCTTCCCACAGAGGGTGCTGGG - Exonic
1174261349 20:49297705-49297727 GGCCTTAGACAGAGGCAGCCAGG - Intergenic
1176172255 20:63701303-63701325 GGCTTTGCACAGAAGCAGCCCGG - Intronic
1178374408 21:32055114-32055136 TGCTTTACAGAGGAGGAGCCTGG - Intergenic
1178807911 21:35854719-35854741 AGCTTCACACAGACGGTGCCGGG + Intronic
1179367384 21:40771137-40771159 GGCTTCACGCAGTGGGAGACAGG + Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1180031413 21:45211027-45211049 GGCTTTACACAGAGGACCTCTGG - Intronic
1181788320 22:25243586-25243608 GGCTTTAAAAATAGGAAGCCTGG + Intergenic
1182662331 22:31933804-31933826 GGCTTAACTCAGAAAGAGCCGGG - Exonic
1182965078 22:34513782-34513804 GGGTTTACACTGAGGAAGTCTGG + Intergenic
1183494326 22:38133814-38133836 AGCTGCACACACAGGGAGCCTGG - Intronic
1184863636 22:47190799-47190821 GGCTTTGCACCGAGGGAGGCCGG + Intergenic
949108197 3:225814-225836 GGGTTTTCACAGAGTTAGCCAGG - Intronic
949402014 3:3674916-3674938 GAATTTACACAAAGGCAGCCTGG - Intergenic
956694619 3:71907913-71907935 GGCTTGACCCAGAGCAAGCCAGG + Intergenic
961444939 3:126975956-126975978 GGCCTTAAAAAGAGGGTGCCAGG + Intergenic
961556768 3:127701482-127701504 GGTTCTTCACAGAGGGAGACAGG - Intronic
962775740 3:138657947-138657969 GGCTATAAACAGAGGGAGAAGGG - Intronic
963433340 3:145236923-145236945 GGCTGGACTCTGAGGGAGCCAGG + Intergenic
967120318 3:186376963-186376985 TGCTTTACTCAGAGTCAGCCAGG + Intergenic
969638258 4:8381942-8381964 CGCTTCACACAGACCGAGCCTGG - Intronic
971157033 4:24094132-24094154 GCCTTAACACAGAGGCAGACAGG + Intergenic
972308797 4:37859429-37859451 GGCTGTCCAGAAAGGGAGCCTGG + Intronic
977697465 4:99982132-99982154 GCCCCCACACAGAGGGAGCCTGG - Intergenic
979771847 4:124535403-124535425 GGCCTTACAGAGAGAGAGGCTGG - Intergenic
980888260 4:138786336-138786358 TGCTCCACACAGAGGCAGCCAGG + Intergenic
981193250 4:141887936-141887958 GGCCTTGCATGGAGGGAGCCAGG - Intergenic
983426112 4:167584947-167584969 GGTTTTACAAATAGGGAACCTGG - Intergenic
985025062 4:185732502-185732524 GGCTTTACTCAGAAATAGCCTGG + Intronic
986030738 5:3890462-3890484 GGATTTACTCAGAGCGTGCCAGG - Intergenic
986452051 5:7875738-7875760 CTCTTTACATGGAGGGAGCCTGG + Intronic
988588428 5:32527898-32527920 AGCTCTACAAAGAGGGAGCGGGG - Intergenic
990886113 5:60595213-60595235 GGCTTTCCTCAGAGCAAGCCAGG + Intergenic
990894695 5:60686116-60686138 GGCTTTGCACAGAGACAACCTGG - Intronic
997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG + Intronic
1002299631 5:178249894-178249916 GGGTTTGCACACAGGCAGCCTGG + Intronic
1002576092 5:180175013-180175035 GTCTCCACACAGAGGGACCCTGG + Intronic
1003642275 6:7886201-7886223 GGCTACACACAAAGGGAGGCTGG + Intronic
1004765614 6:18723013-18723035 GCCTTTTCACAGTGGTAGCCCGG + Intergenic
1007182715 6:39941965-39941987 GGCTTCTCCCAGAGGGAGCAAGG - Intergenic
1007281444 6:40715245-40715267 GGCTCTGCACACAGGGACCCAGG - Intergenic
1007358119 6:41335482-41335504 GGCAGCACACAGAGGGAGCAAGG + Intergenic
1007694170 6:43721381-43721403 GGATTTAGCTAGAGGGAGCCTGG - Intergenic
1011026664 6:82877071-82877093 GTCTTTAAAAAGAGGAAGCCTGG + Intergenic
1011558044 6:88589169-88589191 GGCGTGACACAGTGGCAGCCAGG + Intergenic
1012819432 6:104066619-104066641 GGCTTTACTCAGAGTGAGCTGGG - Intergenic
1013462266 6:110386562-110386584 AGGTTTACACAGTGGAAGCCAGG - Intergenic
1015112017 6:129603475-129603497 GGCTTTTCAGAGAGTGAACCCGG - Intronic
1015700691 6:136033105-136033127 GGCTATAGTCAGAGGGTGCCAGG + Intronic
1018487040 6:164251291-164251313 GGCTTTACACAGAGACAGCTCGG - Intergenic
1020429723 7:8106620-8106642 GACTTTACACAGAAGGATGCTGG + Intergenic
1020643802 7:10788992-10789014 GGCTGTGCACAGATGGAGTCAGG + Intergenic
1020644654 7:10800174-10800196 GGCCCTACTCAGGGGGAGCCTGG - Intergenic
1022103097 7:27180752-27180774 GGCTTCAACAAGAGGGAGCCTGG - Intergenic
1027559217 7:79706219-79706241 GGGTTTACACAGTGTTAGCCAGG + Intergenic
1028335626 7:89651078-89651100 GACTTTGCACAGAGGTATCCAGG - Intergenic
1028838094 7:95396586-95396608 GGCTCAACGGAGAGGGAGCCCGG + Intergenic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1031380795 7:121083642-121083664 GGATTTACACATACGCAGCCTGG - Intronic
1032062913 7:128739588-128739610 GGCTGCACACAGAGGGTCCCGGG - Intronic
1032498724 7:132383132-132383154 GGCTTCAGAGAGAGGGAGCATGG - Intronic
1033256154 7:139803659-139803681 GGCTGCACACAGTGGGGGCCTGG - Intronic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1035038222 7:155909031-155909053 GGCATTGCACACAGGGGGCCAGG + Intergenic
1035637868 8:1160746-1160768 GGCTTTGCATGGAAGGAGCCAGG - Intergenic
1038026351 8:23594420-23594442 GGCCTTGCACAGAGGGACACAGG - Intergenic
1038259890 8:25983685-25983707 GGCTATACACAGCTAGAGCCCGG - Intronic
1047276305 8:123408281-123408303 GGATTTCCACAGAAGGAGGCTGG - Intronic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1049942832 9:564978-565000 GGCTTCACTGAGAAGGAGCCTGG + Intronic
1053350480 9:37410598-37410620 GGCCTTACCCGGAGGGAGACAGG + Intergenic
1057038075 9:91826094-91826116 GGCTTTGAACCCAGGGAGCCTGG - Intronic
1060396476 9:123320078-123320100 GGTTTTAGACAGAGGGACCCAGG - Intergenic
1060935171 9:127510332-127510354 GGCTGTGCCCCGAGGGAGCCGGG + Exonic
1061151403 9:128830226-128830248 GGCTTTATACATGGGGACCCTGG + Intergenic
1061412410 9:130428742-130428764 TGCTTGATAAAGAGGGAGCCAGG + Intronic
1061571163 9:131478176-131478198 GGCTTTAAAGAGAGGAAGCCTGG + Intronic
1061890792 9:133618047-133618069 GGCCCCACAGAGAGGGAGCCAGG - Intergenic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062262300 9:135668941-135668963 GGCCCTAAACAGAGAGAGCCTGG - Intergenic
1185787755 X:2905068-2905090 GGATTTGGACACAGGGAGCCAGG + Exonic
1187521526 X:20018827-20018849 GGTTTCACACAGGGGAAGCCAGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187532205 X:20107178-20107200 GGTTTCACACAGGGGAAGCCAGG + Intronic
1192117722 X:68427493-68427515 GGCTTTACAAAGATGGGGCTGGG - Intronic
1193828765 X:86261497-86261519 GGCTTTCCAAAGAGTGAGGCAGG + Intronic
1193871380 X:86802997-86803019 CCTTTTACACAGAGGTAGCCAGG + Intronic
1194239297 X:91423895-91423917 GGCTTTAATCAAATGGAGCCTGG + Intergenic
1197200903 X:123747687-123747709 GTTTTTACACAGGGGAAGCCTGG + Intergenic
1198231778 X:134696833-134696855 GGGTTTTCACAGAGTTAGCCAGG - Intronic
1198986292 X:142457947-142457969 AGATTTACACATAGGAAGCCTGG - Intergenic
1201291180 Y:12421562-12421584 GGCTTTGGGCAGAGGCAGCCAGG - Intergenic