ID: 906563586

View in Genome Browser
Species Human (GRCh38)
Location 1:46779014-46779036
Sequence GGAGGCACAGAGAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1828
Summary {0: 2, 1: 19, 2: 106, 3: 396, 4: 1305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906563579_906563586 11 Left 906563579 1:46778980-46779002 CCTCAAGTGCTGCCAAAGTGGGA 0: 87
1: 528
2: 340
3: 287
4: 393
Right 906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG 0: 2
1: 19
2: 106
3: 396
4: 1305
906563581_906563586 -1 Left 906563581 1:46778992-46779014 CCAAAGTGGGAGCCCAGGCAGAG 0: 702
1: 439
2: 105
3: 59
4: 592
Right 906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG 0: 2
1: 19
2: 106
3: 396
4: 1305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906563586 Original CRISPR GGAGGCACAGAGAGTGAGCA AGG Intronic
900463600 1:2813125-2813147 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
900756682 1:4440280-4440302 GGAGGAGCACAGAGTGTGCAGGG - Intergenic
900908015 1:5574620-5574642 TGAGGCACAGAGAGGGGTCAAGG - Intergenic
900987343 1:6080793-6080815 GGAGGTATGGAGAGTGAGGACGG - Intronic
901067790 1:6502626-6502648 AGAGGAACCGAGAGTGACCAAGG + Intronic
901154179 1:7124324-7124346 GGAGGGACAGTGTGTGTGCAGGG - Intronic
901159038 1:7161042-7161064 GGAGGGCAAGAGAGGGAGCAAGG - Intronic
901531924 1:9859146-9859168 GTAGGCAGAGATAGGGAGCAGGG - Intronic
901868259 1:12122062-12122084 GGGGGCAGAGTGAGTGAGGAGGG + Intronic
902032065 1:13430414-13430436 GGAGGTGCTGAGAGCGAGCAAGG - Intergenic
902032176 1:13430884-13430906 GGAGGAGCTGAGAGTGAGCGAGG + Intergenic
902032700 1:13434357-13434379 GGAGGCCCTGAGAGTGAGCGAGG + Intergenic
902033368 1:13439136-13439158 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
902678730 1:18028323-18028345 GGAGGCAGAGAGTGAGAGCCTGG + Intergenic
902736550 1:18405184-18405206 GGAAGCACAGTGAGGGAGTAGGG - Intergenic
902838523 1:19061254-19061276 TGAAGCACAGAAAGTGAGCCTGG + Intergenic
902844460 1:19098982-19099004 GAAGGAACAGAGAGTAAGAAAGG + Intronic
902962844 1:19976991-19977013 GGATGGACAGAGAGGGAGAAGGG - Intronic
903569101 1:24291297-24291319 GAATGCACAGGGTGTGAGCAGGG - Intergenic
903593075 1:24471899-24471921 GGAGAAACAGAAGGTGAGCAGGG + Intronic
903595322 1:24489859-24489881 GGAGGCACTGAGAGCCAGCGAGG - Intergenic
903666040 1:25008329-25008351 GGAGGCACAGAGAGGTTGCCAGG + Intergenic
903923252 1:26816232-26816254 GGAGGGAGAGAGAGAGAGAAAGG + Intergenic
904255498 1:29251932-29251954 GCAAGTACAGAGAGAGAGCATGG - Intronic
904608592 1:31712780-31712802 GAAGGCTAAGGGAGTGAGCAGGG + Intergenic
905185903 1:36196817-36196839 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
905280218 1:36844276-36844298 AGAGGCACTGAGATTAAGCATGG - Intronic
905742811 1:40387706-40387728 GGAGGCACCGAGAGCGAGCGAGG - Intronic
905808604 1:40895252-40895274 AGAGAGACAGAGAGAGAGCAAGG + Intergenic
906056053 1:42917496-42917518 GGAGGTGCTGAGAGCGAGCAAGG + Intergenic
906289702 1:44611580-44611602 GGAGGCACGAGGAGTGAGTAAGG - Intronic
906537552 1:46560085-46560107 AGAGGAAAAGAGAGTGAGGAGGG + Intronic
906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG + Intronic
907303787 1:53502976-53502998 GGAGGGACAGGGAGAGAGGAGGG + Intergenic
907303804 1:53503046-53503068 GGAGGGACAGAGAGAGAGAGAGG + Intergenic
907371217 1:54004731-54004753 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
907410403 1:54279573-54279595 GGAGGCACACAGATGAAGCATGG + Intronic
907553793 1:55327208-55327230 GGAGGCACAGTTAGTAAGAAGGG + Intergenic
907605413 1:55812490-55812512 GGGGGCAAAGGGAGTGACCAAGG + Intergenic
907687065 1:56622625-56622647 GGAGAGAGAGAGAGTGTGCAGGG - Intronic
907759570 1:57343915-57343937 GGAGGCGCCCAGAGCGAGCAAGG + Intronic
907977965 1:59451562-59451584 AGAGACACACAGAGTGAGAAAGG + Intronic
907979982 1:59471983-59472005 GGAGGCGCGGAGAGCGAGCGAGG - Intronic
908156283 1:61357098-61357120 AGGGGCACAGCGAGTGAGAAGGG - Intronic
908299853 1:62753283-62753305 GGAGGCGCCGAGAGTGAGCAAGG - Intergenic
908301027 1:62761365-62761387 GGAGGTGCTGAGAGCGAGCAAGG - Intergenic
908335969 1:63123593-63123615 GGGGGGACAGAGAGTGACAAGGG + Intergenic
909085251 1:71162738-71162760 GGACGCACAGAGAGACACCAGGG - Intergenic
909335169 1:74465132-74465154 GGAGGCCCCGAGAGTGAGTGAGG - Intronic
909713203 1:78674941-78674963 GAAGTCACAGAGTGTGAGAAGGG - Intergenic
910034845 1:82777291-82777313 GGAGGCACCGAGAGCGAGAGAGG + Intergenic
910108964 1:83661581-83661603 GAGGGCAGAGAGAGTGAGGACGG - Intergenic
910112906 1:83701318-83701340 GGACACACAGAGAGACAGCAGGG + Intergenic
910478893 1:87636735-87636757 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
910622735 1:89273834-89273856 GGAGGCACCGAGAGCGAGGGAGG + Intergenic
910625636 1:89303307-89303329 GGAGGCACCGAGAGCTAGCGAGG + Intergenic
911001379 1:93170120-93170142 GGAGGCGCTGAGAGCGAGCCAGG - Intronic
911070722 1:93829994-93830016 GGAGGAAGAGAGAGTGAGTGGGG - Intronic
911259680 1:95670136-95670158 GGAGGCGCCGAGAGGGAGCGAGG + Intergenic
911305309 1:96224848-96224870 GGAGGCACCGAGAGCGAGGGAGG + Intergenic
911407695 1:97463310-97463332 GCAGGCAAAGAGAGAGTGCAGGG - Intronic
911643652 1:100315927-100315949 GGACAAACAGAGAGTAAGCAAGG + Intergenic
911808026 1:102235283-102235305 GGAGGCGCCAAGAGCGAGCAAGG + Intergenic
911839328 1:102660521-102660543 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
911969234 1:104408595-104408617 GGAGGAACCAAGAGCGAGCAAGG + Intergenic
912315854 1:108667328-108667350 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
912381027 1:109248460-109248482 TGAGGCACAGAATTTGAGCAAGG + Intergenic
912538840 1:110396846-110396868 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
912716325 1:111986565-111986587 TGAGGCCCAGAGGGTGATCATGG - Intronic
912761912 1:112375265-112375287 AGAGACAGAGAGAGTGAGAAGGG + Intergenic
912776260 1:112508212-112508234 CGAGGCACAGAGGGGGAGCGGGG + Intronic
912819450 1:112855023-112855045 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG + Intergenic
913468936 1:119171399-119171421 GGAGGCACTGAGAGCGAGCGAGG - Intergenic
913987028 1:143574946-143574968 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
914203507 1:145506361-145506383 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
914438515 1:147681275-147681297 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
914482629 1:148079515-148079537 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
914857567 1:151363659-151363681 GGAGCAAGAGAGAGAGAGCAAGG - Intergenic
914927988 1:151905988-151906010 GGAGGCGCCGAGAGGGAGCGAGG - Intronic
914959423 1:152193280-152193302 GGAGAAACAGACAGTGAGGAAGG - Intergenic
915014690 1:152721753-152721775 GGAGGAAAGGAGAGTGAGCAAGG - Intergenic
915242388 1:154532582-154532604 GGAGGCACCGAGAGCGAGCGAGG + Intronic
915631999 1:157159864-157159886 GGACGCACAGACAGTGGGCTGGG + Intergenic
915706668 1:157850595-157850617 GGAGGCACAGACTGGGAGTAGGG + Intronic
915764560 1:158349489-158349511 GGAGGCACCGAGAGCAAGCAAGG + Intergenic
916176940 1:162049838-162049860 GGAGGGAAAGAGAGAGAGGAAGG - Intergenic
916219789 1:162433007-162433029 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
916606120 1:166343540-166343562 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
916808540 1:168284088-168284110 GGAGGAAGAGAGAGAGAGAAAGG - Intronic
916938965 1:169661068-169661090 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
916960206 1:169881963-169881985 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
917406295 1:174711346-174711368 GGAGGCACTGAGAGTGAGTGAGG + Intronic
917476717 1:175375120-175375142 GGAGGGAAAGAGAGAGAGAAGGG - Intronic
917596246 1:176532143-176532165 GGAGGTAGAGAGAGGGAGCAGGG - Intronic
917823247 1:178788622-178788644 TGAGCTACAGTGAGTGAGCAAGG + Intronic
917860440 1:179138691-179138713 GGAGGCACCGAGAGCGAGCGAGG - Intronic
918207939 1:182325932-182325954 GGAGGAAGAGAGAGTGGGCCGGG - Intergenic
918284641 1:183040189-183040211 GGAGGCACAAAAAGACAGCAGGG - Intronic
918326632 1:183417267-183417289 GGAGTCAGAGAGAGCGAGCGGGG - Intronic
918512082 1:185322190-185322212 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
918708870 1:187703469-187703491 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
918792117 1:188841683-188841705 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
918853285 1:189718806-189718828 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
918943048 1:191026503-191026525 GGAGGTGCTGAGAGTGAGCGAGG + Intergenic
918993815 1:191731666-191731688 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
919091824 1:192986763-192986785 GGAGGCGCAGAGAGCGAGTGAGG - Intergenic
919201428 1:194358778-194358800 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
919207064 1:194431484-194431506 GGAGGCACCTAGAGCGAGCGAGG + Intergenic
919236962 1:194858918-194858940 GGAGGCGCCGAGAGTGAGTGAGG - Intergenic
919474360 1:198016552-198016574 GGAGTGAGAGAGAGAGAGCAGGG + Intergenic
919630886 1:199959525-199959547 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
920150151 1:203900088-203900110 GAAGGCACCGAGAGCGAGCGAGG - Intergenic
920267417 1:204734444-204734466 GCAGGGACAGAGAGGGAGCTGGG + Intergenic
920604940 1:207371904-207371926 GGAGGCGCCGAGAGTGAACGAGG + Intergenic
920878533 1:209859159-209859181 GGAGGCGCCCAGAGTGAGTAAGG + Intergenic
920882102 1:209889448-209889470 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
921334484 1:214072639-214072661 GGAGGCAGAGGGAGGCAGCAGGG - Intergenic
921396463 1:214673655-214673677 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
921474510 1:215590452-215590474 GGAGGAAGAGGGAGCGAGCAAGG - Intronic
921621569 1:217331251-217331273 GGAGGAAGAGAGAGAGAGGAGGG + Intergenic
921738549 1:218656742-218656764 GGAGGACCAGAGAGTCAGGAAGG - Intergenic
921769920 1:219023697-219023719 GGAGGTAGAGAGAGAGATCAAGG + Intergenic
921897021 1:220412283-220412305 GGAGGCACCGAGAGCAAGCGAGG - Intergenic
921983758 1:221286163-221286185 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
922056754 1:222049599-222049621 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
922119515 1:222649934-222649956 GGAGCAAGAGAGAGTGAGCGGGG + Intronic
922166214 1:223117444-223117466 GGAGGCACCGAGAGTGAGCGAGG + Intronic
922416998 1:225431217-225431239 GGAGGTGCAGAGAGTGAGCGAGG - Intergenic
922485348 1:225969621-225969643 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
922541989 1:226426799-226426821 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
922985800 1:229865310-229865332 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
923033678 1:230269080-230269102 AGGGGGACAGAGAGTGAGCAGGG - Intronic
923046055 1:230356480-230356502 GGTGGCAGAGGGAGTGAGCCTGG - Intronic
923052851 1:230401062-230401084 GGAGGGACAGTGAATGAGGAAGG - Intronic
923083439 1:230682335-230682357 GGAGGCAGTGACACTGAGCACGG - Intronic
923161309 1:231317311-231317333 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
923235733 1:232031188-232031210 GGAGAGACAGAGAGAGAGGAAGG + Intronic
923353104 1:233128975-233128997 GGAGGCGCCAAGAGTGAGCGAGG - Intronic
923386001 1:233465884-233465906 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
923623299 1:235594890-235594912 GGAGGCGCCGAGAGCGAGCAAGG + Intronic
923810580 1:237310120-237310142 GGAGGTGCTGAGAGTGAGCGAGG + Intronic
923975339 1:239256014-239256036 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
924117440 1:240762342-240762364 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
924305871 1:242689276-242689298 GGAGGCACCCAGAGTAAGCAAGG - Intergenic
924515993 1:244766773-244766795 GGAGGCAGAGAGAGAGAGATGGG - Intergenic
924525495 1:244844140-244844162 GAAGGCACAGAAATCGAGCAAGG + Exonic
924617427 1:245624065-245624087 GGAGAGAGAGCGAGTGAGCAGGG - Intronic
924686871 1:246301880-246301902 AGAGGGACAGAAAGTAAGCAAGG + Intronic
924836375 1:247651821-247651843 GGAGCAACAGAGAGAGAGCGGGG - Intergenic
924860800 1:247919950-247919972 GGAGGCAAAGGGAATGCGCATGG + Intergenic
1063149033 10:3320336-3320358 AGAGGCACCGAGAGCGAGCGAGG + Intergenic
1063322245 10:5061150-5061172 GGAGGCACCGAGAGTGAGCGAGG + Intronic
1063368772 10:5507650-5507672 GGAGGCCCAGAGAGGGAGGCTGG - Intergenic
1063376646 10:5558185-5558207 GGAGGCACAGAGAGGCCGGAGGG + Intergenic
1063689543 10:8273273-8273295 GGAGTCTCAGAGAGGGAGGAGGG - Intergenic
1063848638 10:10160755-10160777 GGAGGTGCTGAGAGTGAGCGAGG - Intergenic
1063876393 10:10483962-10483984 GGAGGGACAGAGAGAGAGATGGG - Intergenic
1064155312 10:12898682-12898704 GGAGGCAGAGACAGCGTGCAAGG + Intronic
1064460950 10:15534821-15534843 GGAGGCGCCGAGAGCGAGCCAGG - Intronic
1064607194 10:17055441-17055463 AGAGGGACAGAGAGAGAGAAGGG + Intronic
1064612924 10:17122516-17122538 ATTGGCACAGAGAGTAAGCATGG - Intronic
1065284857 10:24177206-24177228 GGAGGCACCGAAAGCGAGCGAGG + Intronic
1065554830 10:26905398-26905420 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1065590238 10:27256317-27256339 GGAGGCACGGAGAGCGAGCAAGG - Intergenic
1065802531 10:29366046-29366068 GGAGGCGCAGAGAGTGAGAGAGG - Intergenic
1065965909 10:30769929-30769951 GGAGGTGCCGAGAGTGAGCAAGG + Intergenic
1065981643 10:30903306-30903328 GGAGGCACCGAGAGCGAGTGAGG + Intronic
1066409155 10:35149308-35149330 AGAGGCACAGAGCCAGAGCATGG + Intronic
1066544318 10:36482505-36482527 GGAGGCACCGAGAGCTAGCGAGG + Intergenic
1066613668 10:37275833-37275855 GGAGGTGCTAAGAGTGAGCAAGG + Intronic
1066660831 10:37737227-37737249 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1066747126 10:38611887-38611909 GGAGGCACTGCCAGTGGGCAGGG - Intergenic
1067051192 10:43022337-43022359 GGAGCCAGAGAGAGAAAGCATGG + Intergenic
1067178942 10:43970615-43970637 GGTGGGGCAGAGAGTGTGCAGGG - Intergenic
1067363115 10:45600598-45600620 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1067470594 10:46535180-46535202 GGAGGCACAGGCAGGGAGGATGG - Intergenic
1067720441 10:48723882-48723904 TGAGGCATGGTGAGTGAGCATGG + Intronic
1067772235 10:49135093-49135115 GGAGTCACAGGAACTGAGCAAGG - Intergenic
1068536062 10:58242933-58242955 GGAGGGAGAGAGAGAGAGAAGGG - Intronic
1068792458 10:61041915-61041937 GGATGCACAGAGAGACACCAGGG + Intergenic
1068978058 10:63033440-63033462 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
1069186600 10:65429925-65429947 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1069280911 10:66651947-66651969 GGAGGCACCGAGAGCGAGCAAGG + Intronic
1069766070 10:70861495-70861517 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1069992895 10:72325807-72325829 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1070824519 10:79382974-79382996 AGAGGGACAGGGAGTGGGCAAGG - Exonic
1070968236 10:80543116-80543138 GGAGGCACCGAGAGCGAGAGAGG - Intronic
1071055225 10:81502695-81502717 GGAGGCGCTGAGAGCGAGCAAGG - Intergenic
1071055630 10:81505678-81505700 GGAGGCACCGAGAGCAAGCAAGG - Intergenic
1071078650 10:81784070-81784092 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1071332112 10:84571052-84571074 GGAGGCACCAAGAGCGAGCAAGG - Intergenic
1071387930 10:85141251-85141273 AGAGGCAGCGAGAGTGAGCGAGG - Intergenic
1071681480 10:87710349-87710371 GCAAGGACAGACAGTGAGCAAGG + Intronic
1071797135 10:89019084-89019106 GGAGGTGCTGAGAGCGAGCAAGG + Intergenic
1071883324 10:89923102-89923124 GGTGGGAGAGAGAGTGAGCTGGG - Intergenic
1071963851 10:90832684-90832706 GGAGGCACCGAGAGTGAGCGAGG + Intronic
1072341914 10:94460006-94460028 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1072750971 10:97978514-97978536 GGAAGAACAGAGAGCAAGCAAGG - Intronic
1072759306 10:98042698-98042720 GTAGGCACTGAGACTCAGCATGG - Intergenic
1073001809 10:100291291-100291313 GGAGGAAGAGAGGGTGAGCTGGG - Exonic
1073113152 10:101074557-101074579 GGGGACACAGAGAGTGAGACAGG + Intergenic
1073721697 10:106180040-106180062 GGAAGCACAGAAAAGGAGCATGG + Intergenic
1073878242 10:107950434-107950456 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1074417701 10:113281821-113281843 GGAGGCAGAGAGAGGGAAAAAGG + Intergenic
1074450272 10:113553748-113553770 TGAGGCAGAGAAGGTGAGCAGGG + Intronic
1074498913 10:114004694-114004716 GGAGACAGATACAGTGAGCACGG - Intergenic
1074732403 10:116393256-116393278 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1074827546 10:117225275-117225297 GAAGGCTGAGGGAGTGAGCAGGG - Intergenic
1075062165 10:119264797-119264819 GGAGGAAAAGGGAGTGGGCAGGG - Intronic
1075139762 10:119821697-119821719 GGAGGGAGAGAGAGAGAGGAGGG - Intronic
1075151110 10:119932863-119932885 GGAGGAACGGGGAGTGAGCCTGG + Intronic
1075243971 10:120803812-120803834 GGAAGCAGAGAGAGGGAGAAAGG - Intergenic
1075255544 10:120923676-120923698 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1076485917 10:130816869-130816891 AGATGCACAGAGAGTGGTCAAGG - Intergenic
1076559691 10:131353285-131353307 GGAGGGACAGAGTGGCAGCATGG + Intergenic
1076692053 10:132228852-132228874 GGAGACACACAGAGTGAGCGTGG + Intronic
1076988469 11:256612-256634 GGAGGTACAGACAATGACCATGG - Intergenic
1077048937 11:558131-558153 AGGGGCACAGGGAGTGGGCAGGG - Intronic
1077178338 11:1200648-1200670 GGAGGCAGAGAGTGGGAGCTGGG + Intronic
1077228939 11:1450192-1450214 GGAGGCGCAGGGAGCGAGCGGGG - Intronic
1077355793 11:2116170-2116192 GGAGGCACAGACAGCCAACAAGG - Intergenic
1077434327 11:2531522-2531544 GGATGCGCAGACAGTGGGCAGGG - Intronic
1077502811 11:2916957-2916979 GGAGGCCCAGAGAGGCAGGAAGG + Intronic
1077603173 11:3588579-3588601 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1077614404 11:3664728-3664750 GGAGGCACAGAGATGGTGCCAGG + Intergenic
1077769502 11:5200133-5200155 GCAGGCAGAAAGAGTGAGAAAGG + Exonic
1077805684 11:5589731-5589753 GGAGGCACCGAGAGCGAGGGAGG - Intronic
1077966735 11:7142083-7142105 GGAAACCCAGAGACTGAGCATGG + Intergenic
1078137149 11:8661051-8661073 GGAGTCAGAGGGAGTGATCAGGG + Intronic
1078891253 11:15560775-15560797 GGAGGCACCGAGAGGGAGCGAGG - Intergenic
1079009553 11:16816963-16816985 GGAGGCACAGAGATGGAGCGGGG + Exonic
1079110989 11:17605128-17605150 GCAGGCACAGGGAGTGAGCATGG - Intronic
1079191055 11:18276601-18276623 GGAGGCACGGAGAGTGAGCGAGG + Intergenic
1079314757 11:19398237-19398259 GGAGCAAGAGAGAGAGAGCAAGG + Intronic
1079378244 11:19913640-19913662 CGAGGCACAGAGAGAAAGGAGGG + Intronic
1079555501 11:21753626-21753648 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1079689043 11:23400047-23400069 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1079726292 11:23883941-23883963 GGAGGCGCAGAGAGCGAGCGAGG + Intergenic
1079756873 11:24274748-24274770 GGAGGCCCCAAGAGTGAGCAAGG + Intergenic
1079769856 11:24445339-24445361 GGAGACAGAGAGAGTGAGGTGGG - Intergenic
1079776195 11:24531850-24531872 TGAGGCAAAGAGAGTTACCAAGG - Intronic
1080106097 11:28512840-28512862 GGAGGCACTGAGAACGAGCAAGG + Intergenic
1080134325 11:28836710-28836732 GGATGCACAGAGTGGGAACAAGG + Intergenic
1080138787 11:28890594-28890616 GGAGGCACCCAGAGCGAGCGAGG - Intergenic
1080223453 11:29934055-29934077 GGAGGCACTGAGAGTGAGGGAGG - Intergenic
1080963639 11:37189134-37189156 GGAGGGAGAGAGAGAGAGGAAGG - Intergenic
1081046478 11:38279110-38279132 GGAGGCGCCTAGAGTGAGCGAGG + Intergenic
1081127012 11:39333576-39333598 GGAGGCACCGAGAGTGAGTGAGG + Intergenic
1081136231 11:39442571-39442593 GGAGGTGCTGAGAGCGAGCAAGG + Intergenic
1081315131 11:41622728-41622750 GGAGGCACGGAGAGCGAGCCAGG - Intergenic
1081324533 11:41728592-41728614 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
1081374778 11:42344842-42344864 GGAGGCACTGAGAGCCAGCGAGG + Intergenic
1081428303 11:42949728-42949750 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
1082270491 11:50164510-50164532 GGAGGCACTGAGAGCAAGCGAGG + Intergenic
1082912401 11:58391080-58391102 GGAGGTGCCGAGAGCGAGCAAGG + Intergenic
1083140704 11:60718854-60718876 GGACAACCAGAGAGTGAGCAAGG + Intergenic
1083188119 11:61029706-61029728 GGAGACACAGAGAGAGAGATTGG + Intergenic
1083546035 11:63550057-63550079 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1084186575 11:67475944-67475966 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1084259063 11:67963121-67963143 GGAGGCACTGAGAGTGAGCGAGG - Intergenic
1084406152 11:68974749-68974771 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1084476265 11:69391401-69391423 GGAGGCTCAGAGAGGGTGCATGG + Intergenic
1084533801 11:69745371-69745393 GGAGCCTGAGAGAGTGACCACGG - Intergenic
1084620552 11:70267539-70267561 GGAGGGAGAGAGAGAGAGGAAGG + Intergenic
1084638554 11:70410192-70410214 GGAGGCCCAGAGAGGGAGATTGG + Intronic
1084742886 11:71150399-71150421 GGAGGGACAGGGAGGGAGGAAGG + Intronic
1084785898 11:71441525-71441547 AGAGGCCCAGAAAGTGACCAGGG - Intronic
1084940815 11:72612022-72612044 GGAGGCACAGATGGGGAGCAAGG + Intronic
1085172927 11:74464079-74464101 GCAGGAACAGAGAGTGAACCTGG - Intronic
1085245527 11:75098059-75098081 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1085294070 11:75420908-75420930 GGAGGCACGAACAGTCAGCATGG + Intronic
1085315434 11:75542098-75542120 GGAATCAGAGAGAGAGAGCAGGG - Intergenic
1085315444 11:75542152-75542174 GGAATCAGAGAGAGAGAGCAGGG - Intergenic
1085447323 11:76609538-76609560 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1085478285 11:76801548-76801570 GTAAGCACATAAAGTGAGCAAGG - Intergenic
1085687621 11:78638699-78638721 GGAGTCACTGAGAGCGAGCGAGG - Intergenic
1085982874 11:81745035-81745057 GGAGGCACTGAGAGTGAGTGAGG + Intergenic
1086210194 11:84309044-84309066 GGAGGCACCGAGAGCAAGCAAGG + Intronic
1086397826 11:86434030-86434052 GGAGGCGCTGAGAGTGAGCAGGG + Intergenic
1086724571 11:90167043-90167065 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1086807940 11:91268608-91268630 GGAGGCGCTGAGAGAGAGCCAGG - Intergenic
1086819794 11:91421707-91421729 GGAGGCACAGTGTGGAAGCAAGG + Intergenic
1087318788 11:96635679-96635701 GGAGGTGCTGAGAGTGAGCGAGG - Intergenic
1087404953 11:97718245-97718267 GGAGGCCCTGACAGTGAGCGAGG + Intergenic
1087407387 11:97746124-97746146 GGAGGCACCGAGAGCGAGCCAGG + Intergenic
1087682413 11:101231844-101231866 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1087683870 11:101241758-101241780 GGAGGCTCCGAGAGTGAGTGAGG + Intergenic
1087886842 11:103491827-103491849 GGTGGCACAGAAAGAGGGCAGGG - Intergenic
1087968884 11:104454530-104454552 GGAAGCAGAGAGAGTGAGAGGGG + Intergenic
1087977338 11:104565443-104565465 AGAGGTGCTGAGAGTGAGCAAGG + Intergenic
1088570801 11:111221830-111221852 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1089244812 11:117110959-117110981 GGAGGCTCGGAGAGCGAGCGAGG + Intergenic
1089860246 11:121583598-121583620 GGAGGCTCAGGGAGGGAGCTGGG - Intronic
1090133631 11:124171206-124171228 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1090229147 11:125089348-125089370 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1090393799 11:126406258-126406280 GGAGGGACAGACAGGGAGCCAGG + Intronic
1090782648 11:130021524-130021546 GGAGGCCCCGAGAGTGAGCGAGG - Intergenic
1090820598 11:130337868-130337890 GGAGGCATGGAGAGTGAGCGAGG + Intergenic
1091081428 11:132672520-132672542 GGAGCCACACACAGAGAGCAAGG - Intronic
1091201140 11:133782201-133782223 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1091976096 12:4827033-4827055 GGAAGCAAAGAGAGGGAGGAGGG - Intronic
1092137354 12:6159331-6159353 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1092142183 12:6191379-6191401 GGAGGCCCCCAGAGTGAGCGAGG + Intergenic
1092226394 12:6750958-6750980 GCAGTCACAGAGACTGAGGAAGG - Intronic
1092350597 12:7752569-7752591 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1092572504 12:9740086-9740108 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1092732392 12:11547144-11547166 GGAGGCGCCGAGAGCGAGCAGGG - Intergenic
1093172285 12:15874481-15874503 GGAGGCACCGAGAGCGAGTGAGG - Intronic
1093189321 12:16057234-16057256 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1093266199 12:17007476-17007498 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1093381486 12:18499999-18500021 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1093527165 12:20115737-20115759 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1093580230 12:20777920-20777942 GGAGGCGCCGAGAGTGAGGGAGG + Intergenic
1093581085 12:20784289-20784311 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
1093793643 12:23285797-23285819 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1093921590 12:24865928-24865950 GGAGGCACCGAGAGCGAGTGAGG - Intronic
1093970140 12:25369225-25369247 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1093972883 12:25391280-25391302 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1094409757 12:30156723-30156745 GGAGGCGCGGAGAGAGAGCGAGG - Intergenic
1094652480 12:32391209-32391231 GGAGGCGCTGAGAGCGAGCAAGG + Intergenic
1094721992 12:33075199-33075221 GGAGGCGCCGAGAGTGAGTGAGG - Intergenic
1095123022 12:38441804-38441826 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1095226591 12:39685401-39685423 GGAGCAAGAGAGAGTGAGTAGGG + Intronic
1095304085 12:40620533-40620555 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1095354516 12:41255812-41255834 GGGAGCAAAGAGAGAGAGCAAGG + Intronic
1095382386 12:41611329-41611351 GGAGGAACAGAGAGAGTGAAGGG - Intergenic
1095389781 12:41692148-41692170 GGAGAGAAAGAGAGTGAGCGAGG - Intergenic
1095478679 12:42611286-42611308 GGAGGCCCCGAGAGTGAGCAAGG + Intergenic
1095533898 12:43224174-43224196 GGAGGCGCTGAGAGTGAGCAAGG - Intergenic
1095587335 12:43863751-43863773 GGAGGCACCGAGAGTGAGTGAGG - Intronic
1095642756 12:44503004-44503026 AGAGGCACAGAGAGCAAGCAAGG + Intergenic
1095898730 12:47306176-47306198 GGAGGCCCCGAGAGCTAGCAAGG - Intergenic
1095901468 12:47333236-47333258 GGAGGCACAGAGAGCGAGCGAGG - Intergenic
1096043760 12:48543860-48543882 GGAGGCCCAGAAGGTTAGCAGGG + Intergenic
1096442852 12:51660411-51660433 GTAGGAACAGAGAGTGACCTAGG + Intronic
1096518261 12:52170253-52170275 GGAGGCAGGGGGAGTGGGCATGG + Exonic
1096558012 12:52415644-52415666 GGAGGAACAGAGAGGGAGGGTGG - Intergenic
1096836084 12:54352192-54352214 GGAGGTGCAGGAAGTGAGCAAGG - Intergenic
1096977386 12:55707403-55707425 GGAGGCCCACAGAGTGGGGAGGG + Intronic
1097018001 12:56000652-56000674 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1097664263 12:62461742-62461764 GGAGGCGCTGAGAGTCAGCGAGG + Intergenic
1097981937 12:65744211-65744233 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1098168293 12:67719740-67719762 GGAGGCGCCGAGAGCGAGCCAGG + Intergenic
1098515910 12:71376709-71376731 GGAGGCAACGAGAGCGAGCGAGG - Intronic
1098582909 12:72121941-72121963 GGAGGCACAGAGAGCTGGCCTGG - Intronic
1099190889 12:79561392-79561414 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1099191319 12:79564820-79564842 GGAGGCACTGAGAGCGAGTGAGG - Intergenic
1099204266 12:79710768-79710790 GGAGGCACCAAGAGTCAGCGAGG - Intergenic
1099228242 12:79993744-79993766 GGAGGCACCGAGAGCGAGGGAGG + Intergenic
1099352445 12:81590711-81590733 GCAGGCAAAGAGAGAGAGCTTGG - Intronic
1099430254 12:82574920-82574942 GGAGGCAAAGAGCTTGTGCAGGG + Intergenic
1099450634 12:82802455-82802477 GGAGGTGCTGAGAGTGAGCGAGG + Intronic
1099518172 12:83624710-83624732 AGAGGCACAGAGAGGGAAAAAGG - Intergenic
1099559694 12:84155629-84155651 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
1099928966 12:89052055-89052077 GGAGGCAAAGAGAGAGAGAGAGG + Intergenic
1100078837 12:90823905-90823927 GGAGGTGCGGAGAGCGAGCAAGG - Intergenic
1100211963 12:92407027-92407049 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1100600564 12:96108756-96108778 GGAGGCGCCGAGATTGAGCGAGG - Intergenic
1100905074 12:99287963-99287985 GGAGGTAAAGAGAGAGATCAGGG + Intronic
1101008908 12:100430153-100430175 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1101851158 12:108403484-108403506 GGAGACAGAGAGAGAGAGAAAGG - Intergenic
1101925637 12:108969283-108969305 GTAGGGAGAGAGAGTGAGGAAGG - Intronic
1102047097 12:109836095-109836117 TGAGGCACAGAGAGAGAGGGAGG - Intergenic
1102309682 12:111835506-111835528 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
1102863554 12:116356845-116356867 GGAGACAGAGAAAGTGAGGAGGG + Intergenic
1102875191 12:116443707-116443729 GGAGGCATAGAGACAGAGAAAGG + Intergenic
1102903949 12:116660577-116660599 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1103146225 12:118597684-118597706 GGAGGCGCCGAGAGTGGGCGAGG + Intergenic
1103459732 12:121094016-121094038 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1103668466 12:122591876-122591898 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1103678791 12:122677106-122677128 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1103783477 12:123414622-123414644 GGAGGCGCCGAGAGCGAGCGAGG + Exonic
1103860715 12:124010962-124010984 GGAAGCACAGGGAGTGAGGTGGG + Intronic
1103933647 12:124463790-124463812 GGAGGCTCAGAGACTCAGCCCGG + Intronic
1104013182 12:124946594-124946616 GGAGGAACATAGAGTGAGAAGGG + Intergenic
1104198693 12:126566912-126566934 GGAGGCGCTGAGAGAGAGCGAGG - Intergenic
1104443041 12:128810850-128810872 CGGGGCACAGAGAGTGTGAAGGG + Intronic
1104493054 12:129210935-129210957 GGAGTCACTGAGGATGAGCATGG - Intronic
1104509726 12:129366396-129366418 GGAGCAAGAGAGAGGGAGCAGGG - Intronic
1104649765 12:130523128-130523150 GGAGGCAGAGAGAGAGAGAGAGG - Intronic
1104749157 12:131227663-131227685 GGAGGCGTGGAGAGCGAGCAAGG - Intergenic
1104993073 12:132637324-132637346 GGAGGCACAGAGAGTCTGCATGG - Intronic
1105607446 13:21938085-21938107 GGAGCCACAGAAGGTGAGCGTGG + Intergenic
1105624320 13:22098493-22098515 GGAGGCACTGAGTGTGAATACGG + Intergenic
1105697295 13:22900913-22900935 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
1105723849 13:23142000-23142022 GGCGGCACCGAGAGTGAGCGAGG - Intergenic
1105763074 13:23531405-23531427 GGAGGCACTGAGAGTGAGCGAGG - Intergenic
1105777704 13:23678312-23678334 GGAGGCGCTGAGAGCGAGCAAGG + Intergenic
1105923772 13:24988069-24988091 GGAGGGACAGGGAGAGAGAAGGG - Intergenic
1106162223 13:27212016-27212038 GGAGGTGCCAAGAGTGAGCAAGG - Intergenic
1106163303 13:27219614-27219636 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1106221407 13:27748823-27748845 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1107337927 13:39375383-39375405 GAAAGCATAGAGAGTGAACAGGG + Intronic
1107483774 13:40807265-40807287 GGAGACACAGAGAGATAGCACGG - Intronic
1107914337 13:45133924-45133946 GGAGGACCAGAGAGAGACCATGG - Intronic
1108099258 13:46936563-46936585 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1108107279 13:47024791-47024813 TGGGACACAGAGAGGGAGCAGGG - Intergenic
1108362369 13:49678787-49678809 GGAGGCACCGAGAGCGAGTGAGG + Intronic
1108435265 13:50396446-50396468 GGAGGCGCCGAGAGTGAGCAAGG - Intronic
1108512478 13:51168859-51168881 GGAGGAAGAGAGAGAGAGCAGGG - Intergenic
1108686664 13:52826125-52826147 GGAGGTGCTGAGAGTGAGCAAGG - Intergenic
1108859037 13:54830009-54830031 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1108942891 13:55979799-55979821 AAAGGCACAGAGAGTTATCATGG - Intergenic
1108958159 13:56187371-56187393 GGAGGCACCAAGAGGGAGCAAGG - Intergenic
1109111098 13:58319044-58319066 GGAGGCGCCGAGAGCGAGCCAGG + Intergenic
1109124772 13:58504735-58504757 AGAGGCACAGAGAGCGAGCGAGG + Intergenic
1109201793 13:59439762-59439784 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
1109429442 13:62212568-62212590 GGAGGCACTGAGAGGGAGCCAGG + Intergenic
1109638166 13:65150066-65150088 GGAGGCGCAGAGAGCGAGCGAGG + Intergenic
1109741457 13:66560917-66560939 GGAGGCGCAGAGAGGGAGCCAGG - Intronic
1109745739 13:66621800-66621822 GGAGGCGCTGAGAGCGAGCCAGG - Intronic
1109884314 13:68523794-68523816 GGAGGTGCTGAGAGTGAGCGAGG - Intergenic
1110024143 13:70512414-70512436 GGAGGCGCTGAGAGCGAGCAAGG + Intergenic
1110368788 13:74718244-74718266 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1110440122 13:75518405-75518427 GCAGGCGCAGAGAGTGAGCGAGG - Intergenic
1110609892 13:77475963-77475985 GGAGGCGCCAAGAGCGAGCAAGG + Intergenic
1110792473 13:79600667-79600689 GGAGGCACAGAGAGCGAGCGTGG + Intergenic
1110862054 13:80355398-80355420 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
1110874448 13:80491070-80491092 GGAGGCCCCGAGAGCGAGCGAGG + Intergenic
1110887754 13:80659183-80659205 GGAGGCACTGAGAGTGAGCGAGG + Intergenic
1111006571 13:82257831-82257853 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1111085462 13:83371219-83371241 GGAGAGACAGAGAGTGAACAGGG + Intergenic
1111095997 13:83516793-83516815 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1111138861 13:84086885-84086907 GGAGGCCCCGAGAGCGAGCGAGG + Intergenic
1111232511 13:85362980-85363002 GGAAGCGCCCAGAGTGAGCAAGG - Intergenic
1111333495 13:86792116-86792138 GGAAGCGCTGAGAGTGAGCGAGG - Intergenic
1111396211 13:87672389-87672411 GGAGGCACGGAGCGGGAGGAGGG - Intergenic
1111441830 13:88291672-88291694 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1111568920 13:90052635-90052657 GGAGGGTCAGAGAGTGAACTTGG + Intergenic
1111590946 13:90348452-90348474 GGAGGCGCCGAGAGCAAGCAAGG - Intergenic
1112077836 13:95931945-95931967 GGAGGTGCTGAGAGTGAGCAAGG + Intronic
1112226424 13:97545128-97545150 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1112352775 13:98650417-98650439 AAGGGCACAGAGAGTGAGCAGGG + Intergenic
1112477667 13:99747227-99747249 GGAGGAAAAGAAAGGGAGCATGG - Intronic
1112538203 13:100282299-100282321 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1112705781 13:102068326-102068348 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1112738111 13:102443598-102443620 AGAGGCACAGATGGTGGGCAGGG - Intergenic
1113330250 13:109319569-109319591 GGAGGCACTGAGAGTGAGCAAGG + Intergenic
1113351366 13:109532575-109532597 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1113372035 13:109733163-109733185 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1113576843 13:111401016-111401038 TGAGGCAGAGAGGGAGAGCAGGG - Intergenic
1113670772 13:112174439-112174461 CAAGGAACAGAGAGTGTGCAAGG + Intergenic
1113945897 13:114043900-114043922 GGGGGCTCAGAGAGTGAGGCGGG - Intronic
1114155463 14:20099038-20099060 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1114566289 14:23635652-23635674 GGAGGCACCAAGAGTGAGCAAGG - Intronic
1114608288 14:24015975-24015997 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1114653109 14:24299317-24299339 GGAGGCCCAGAGAGTGAAGAAGG + Intronic
1114957680 14:27845211-27845233 GGAGGCACGGAGAGCGAGCAAGG - Intergenic
1115174665 14:30548026-30548048 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1115421424 14:33199248-33199270 GGAGGCACTGAGAGCAAGCGAGG + Intronic
1116084458 14:40217306-40217328 GGAGGCGCCAAGAGTGAGCTAGG + Intergenic
1116133175 14:40886583-40886605 GGAGCAAGAGAGAGAGAGCAAGG - Intergenic
1116152202 14:41154747-41154769 GGAGGCGCGGAAAGCGAGCAAGG + Intergenic
1116310935 14:43326457-43326479 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
1116437518 14:44912003-44912025 GGAGGCGCGGAGAGAGAGCGAGG - Intergenic
1116452281 14:45080288-45080310 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1117003513 14:51395303-51395325 AGAGTCACAGAGAGTCAGAAGGG - Intergenic
1117082517 14:52166598-52166620 GGAGGCACTGAGAGGGAGCGAGG - Intergenic
1117297499 14:54393313-54393335 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1117297799 14:54394860-54394882 GGAGGCACTGAGAGCGAGTGAGG + Intergenic
1117302432 14:54442903-54442925 GGAGGCGCCGAGAGTGAGGGAGG - Intergenic
1117449742 14:55839360-55839382 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1117727415 14:58687761-58687783 GGAGGCGCCGAGAGTGGGCGAGG + Intergenic
1117742550 14:58833782-58833804 GGAGGCACTGAGAGCGAGCAGGG - Intergenic
1118306254 14:64658030-64658052 GGAGGCGCTGAGAGTGAGCAAGG - Intergenic
1118478411 14:66140674-66140696 GGAGGCAGAGTGAATGAGAATGG + Intergenic
1118879967 14:69817598-69817620 GGAGGCAGAGAGACAGAGAAGGG - Intergenic
1118904458 14:70013559-70013581 GGAGGGTGAGAGAGTGGGCAGGG + Intronic
1119176856 14:72574831-72574853 GTGGGCACAGAGACTGAGAAAGG + Intergenic
1119695127 14:76707162-76707184 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1119731614 14:76954852-76954874 GGATGGGCAGAGATTGAGCAAGG - Intergenic
1119780705 14:77275258-77275280 GGAGGAACAGAAAGTGGGCAGGG + Exonic
1119905764 14:78300596-78300618 AGAGAGACAGAGAGAGAGCAAGG - Intronic
1120209952 14:81624274-81624296 GGGGGCACCGAGAGCGAGCCAGG + Intergenic
1120229843 14:81829957-81829979 GGAGGCGCTGAGCGTGAGCGAGG + Intergenic
1120330907 14:83092236-83092258 GGAGGCGCCGAGAGGGAGCGAGG - Intergenic
1120429839 14:84399911-84399933 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1120439188 14:84513417-84513439 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1120603773 14:86545882-86545904 GGAGTCATAGTGAGTGAGAATGG + Intergenic
1120704860 14:87735270-87735292 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
1120716124 14:87842496-87842518 GGAGACACAGAGAATGAGCATGG - Intronic
1120844084 14:89111499-89111521 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1121030787 14:90657081-90657103 CGAGGCACAGAGAGAAAGCGAGG - Intronic
1121239046 14:92414810-92414832 ACAGGAACAGAGAGTGAGAATGG - Intronic
1121350731 14:93170592-93170614 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1121423813 14:93834037-93834059 GGGGGCGCAGAGAGTGAAAATGG + Intergenic
1122039109 14:98969870-98969892 GGAGGGACAGAGAGAGAGAAGGG + Intergenic
1122216606 14:100208650-100208672 GGAGGAACCGAGAGCGAGCAAGG + Intergenic
1122359473 14:101150979-101151001 AGAGGCACAGAGAGAAAGAAGGG - Intergenic
1122588907 14:102831311-102831333 GGAGGACCACACAGTGAGCAGGG + Intronic
1122793352 14:104193636-104193658 GGAGGCACTGAGGGTGAGGAGGG - Intergenic
1122819707 14:104335336-104335358 GCAGGGACAGGGAGTGGGCACGG - Intergenic
1122868483 14:104621838-104621860 GGAGGGAAAGAGAGAGAGGAAGG + Intergenic
1123051803 14:105547682-105547704 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
1123106083 14:105841667-105841689 AGAGGCACAGAGGCTGGGCATGG + Intergenic
1202903851 14_GL000194v1_random:57589-57611 TGAGGCACTGAGAGGGTGCAGGG + Intergenic
1123403430 15:20006718-20006740 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1123512768 15:21013372-21013394 GCAGGCACAGAGCGTGGGCTGGG - Intergenic
1123627885 15:22239862-22239884 GGAAGCAGAGAGGGTGAGGAAGG - Intergenic
1123788264 15:23693911-23693933 GAAGGCACAGAGGGTGTCCACGG - Intergenic
1123799060 15:23802765-23802787 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1124208156 15:27740805-27740827 GTAGGGACAGAGACAGAGCAGGG - Intergenic
1124354578 15:28985191-28985213 GGAGGCCCTGAGGCTGAGCACGG + Intronic
1124686041 15:31782724-31782746 GGGGGTACAGAGAGAGAGTAAGG + Intronic
1124818547 15:33019981-33020003 GGAGGCACCGAGAGCGAGCGAGG + Intronic
1124887846 15:33703509-33703531 GGACACACAGAGAGATAGCAAGG - Intronic
1125132778 15:36303587-36303609 GGAGGCAAAGACAGTCAGAAAGG - Intergenic
1125319988 15:38475580-38475602 GGAAGCAGAGAGAGAGAGAAAGG - Intronic
1125631524 15:41151530-41151552 GGAGGCGCAGAGAGCGAGCAAGG - Intergenic
1125885618 15:43227057-43227079 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1125914628 15:43474387-43474409 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1126127996 15:45313944-45313966 GGAGGCGCCGAGAGTGAGGGAGG - Intergenic
1126191740 15:45885816-45885838 GGAGGCACCGAGAGCCAGCGAGG - Intergenic
1126393262 15:48182106-48182128 GGAGGGAGAGAGAGAGAGAAAGG - Intergenic
1126639596 15:50811828-50811850 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1127243869 15:57150189-57150211 GAAGGAGCAGAGAGAGAGCAAGG + Intronic
1127710138 15:61589083-61589105 GGAGCAGGAGAGAGTGAGCAAGG + Intergenic
1127754608 15:62079226-62079248 GAAGTCAAAGAGAGTGAGGATGG + Intergenic
1127862663 15:63007273-63007295 GGAGACACACAGAGGGAGGAAGG + Intergenic
1127904102 15:63363539-63363561 AGAGGAACAGAGGGTGACCAAGG - Intronic
1128141137 15:65301581-65301603 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1128813384 15:70587674-70587696 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1128990051 15:72252194-72252216 GGAGGCCCAGAGACAGGGCAAGG + Intronic
1129158341 15:73732654-73732676 GGAGGCACTGAGAGCGAGCGCGG + Intergenic
1129374083 15:75116454-75116476 GGAGGCGCGGAGAGCGAGCCAGG + Intronic
1129586925 15:76876321-76876343 GGAGGCACCAAGAGTGAGCGAGG + Intronic
1129777579 15:78246647-78246669 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1130020461 15:80226452-80226474 GGAGGGCCAGAGAGAGATCAGGG - Intergenic
1130370426 15:83281874-83281896 TGAGGTACAGAAAGTGGGCATGG + Intronic
1131012780 15:89032162-89032184 GGAGGCACCAAGAGCGAGCGAGG + Intergenic
1131212620 15:90510811-90510833 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1131250185 15:90825373-90825395 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1131472898 15:92711526-92711548 GGAGGTGCCGAGAGCGAGCAAGG + Intronic
1131644726 15:94329517-94329539 GGAGCAAGAGAGAGAGAGCAGGG + Intronic
1131657210 15:94474268-94474290 GGAGACAAAGGAAGTGAGCATGG - Intronic
1131846201 15:96492346-96492368 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1131992456 15:98104732-98104754 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1132044138 15:98549606-98549628 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1132059936 15:98684037-98684059 GGAGGGACTGAGGCTGAGCACGG - Intronic
1132097632 15:98999901-98999923 GGAGGGGCTGAGAGTGCGCAAGG - Intronic
1132423010 15:101690145-101690167 AGAGGCACAGGGGGTGAGCCAGG + Intronic
1132497943 16:272707-272729 GGAGTGACCGGGAGTGAGCAGGG + Intronic
1132510942 16:341118-341140 GGAGGCGCTGAGAGCGAGCGAGG - Intronic
1132833046 16:1938836-1938858 GGAGGCACCTAGAGTGAGCAGGG + Exonic
1132836897 16:1958680-1958702 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1133246767 16:4454396-4454418 GGAGGCACAGAGAGGTTACAGGG - Intronic
1133338160 16:5020023-5020045 GGAGACACAGAGAGAGAGGAAGG - Intergenic
1133438613 16:5801784-5801806 ACAGGCACAGAGAGTGAACCGGG + Intergenic
1133442076 16:5829378-5829400 AGAGGCACAGTGAGGGAGCAAGG + Intergenic
1133770839 16:8866682-8866704 GGAGGAGCAGAGAGAGAGGAGGG + Intronic
1133814341 16:9184670-9184692 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1134453748 16:14379169-14379191 GCAGGCATGGAGAGTGAGCCTGG - Intergenic
1134678211 16:16105135-16105157 GGAGGCACAGAGAGCGAGCGAGG + Intronic
1134903778 16:17961773-17961795 GGAGGCAAAGAAAGTGAGGGAGG + Intergenic
1135280775 16:21152449-21152471 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1135340108 16:21637868-21637890 GGAGGCGCTGAGAGCGAGCGAGG + Intronic
1135520424 16:23172743-23172765 GCAGGCACAGAGAAGCAGCACGG + Intergenic
1135630386 16:24031888-24031910 GCAGGCAGGGTGAGTGAGCATGG + Intronic
1135751147 16:25059419-25059441 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1135902056 16:26469633-26469655 TCAGGCACAGAGAGAGGGCAGGG - Intergenic
1136144032 16:28305141-28305163 GGAGGTGCAGAGAGTGGGCTTGG - Intronic
1136230738 16:28883828-28883850 GGAGCCAGGGAGAGTGAGCTGGG - Intronic
1136296940 16:29309161-29309183 GGAGGCACAGGCAGAGGGCATGG - Intergenic
1136606156 16:31335229-31335251 GGAGGCTGGGAGAGTGGGCAGGG + Intergenic
1136625892 16:31462093-31462115 GGGAGCACAGAGGGTGAACAAGG - Intronic
1136735942 16:32467757-32467779 GGAGGCACTGGCAGTGGGCAGGG + Intergenic
1137526546 16:49241393-49241415 GGAAGCAGGGAGAGTGAGCTAGG - Intergenic
1137569616 16:49557134-49557156 GGCGGCCTAGAGAGTGACCAGGG + Intronic
1137704215 16:50522920-50522942 GGAGGGAGAGAGAGTGGGGATGG - Intergenic
1138013972 16:53412675-53412697 GGAAGCACTGAGAGTGAGCGAGG - Intergenic
1138015227 16:53421556-53421578 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1138058386 16:53860597-53860619 GGAGGAAGAGAGAGTGAGGGGGG + Intronic
1138115505 16:54357642-54357664 GGAAGCACAGTGAGACAGCAAGG - Intergenic
1138168760 16:54829670-54829692 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
1138313916 16:56052023-56052045 GGAGGCACAGCAAGAGAGAAGGG + Intergenic
1138688694 16:58748702-58748724 GGAGGCACCAAGGGTGAGCGAGG - Intergenic
1138889956 16:61129293-61129315 GGAGGCGCCCAGAGTGAGCAAGG + Intergenic
1139147660 16:64343747-64343769 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1139168677 16:64603254-64603276 GGAGCCACAGAGTGTATGCATGG - Intergenic
1139292594 16:65872070-65872092 GGAGGCACAGGGAGGGAGTGGGG - Intergenic
1139588672 16:67920670-67920692 AGAGGCACAGCCAGTGAGGATGG - Intronic
1139602975 16:67998067-67998089 GGAGGCCCCGAGAGCGAGCGAGG - Intronic
1139974452 16:70797818-70797840 GGAGCAAAAGAGAGTGAGCAGGG - Intronic
1140239283 16:73186385-73186407 GCAGTTACAGAGAGTGAGCTAGG - Intergenic
1140337066 16:74117739-74117761 GGAGGCACCGTGAGGGAGTAGGG + Intergenic
1140722602 16:77784886-77784908 GGAGGCCCCGAGAGTGAGCGAGG + Intergenic
1140918960 16:79519524-79519546 GGAGGGACAGAGAGTGGTAAGGG - Intergenic
1141668878 16:85481024-85481046 AGCGGCCCAGAGAGGGAGCAAGG - Intergenic
1141976069 16:87517477-87517499 GGAAGCAGAGAGGGTGAGGAAGG + Intergenic
1142125719 16:88409342-88409364 GGATGACCAGAGACTGAGCACGG + Intergenic
1142243290 16:88956805-88956827 GAAGGCACAGAGGGAGGGCAAGG - Intronic
1142435731 16:90055825-90055847 GGAGCAAGAGAGAGTGAGGAGGG - Intergenic
1203017133 16_KI270728v1_random:361817-361839 GGAGGCACTGGCAGTGGGCAGGG - Intergenic
1203035468 16_KI270728v1_random:634975-634997 GGAGGCACTGGCAGTGGGCAGGG - Intergenic
1143124862 17:4635612-4635634 AGAGCAACAGAGAATGAGCAGGG - Intronic
1143137799 17:4721391-4721413 GGGGGCAGAGAGAGTGATAATGG - Exonic
1143250992 17:5522864-5522886 GTAGGAACATAGAGTGACCAAGG + Intronic
1143283286 17:5771096-5771118 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1143460578 17:7101036-7101058 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1143701109 17:8660868-8660890 GGAGGAAAAGAGAGAGAGGAAGG - Intergenic
1143708737 17:8718576-8718598 GGAGGCGCCCAGAGTGAGCCAGG + Intergenic
1144128007 17:12220755-12220777 GGCGGCACCGAGAGCGAGCGAGG - Intergenic
1144642877 17:16948191-16948213 GGAGGCAGAGAGAGAGGGCAAGG + Intronic
1144828001 17:18117251-18117273 AGAGCCAGAGAAAGTGAGCAGGG + Intronic
1145050380 17:19654824-19654846 GGAGGTGCTGAGAGCGAGCAAGG + Intronic
1145094767 17:20016317-20016339 GGAGGCACCGAGAGCGAGCGAGG - Intronic
1145912740 17:28552131-28552153 GGAGGCACAGAGAGAGATCAAGG + Intronic
1146185464 17:30721385-30721407 GGACACACAGAGAGTGAGGAGGG - Intergenic
1147431742 17:40375678-40375700 GGAGGCACCCAGAGCGAGCAAGG - Intergenic
1147628019 17:41912406-41912428 GAAGCCACAGTGAGTGGGCATGG - Exonic
1147805269 17:43126692-43126714 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1148023298 17:44568069-44568091 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1148026787 17:44594192-44594214 GGAGGGAGAGAGAGCGAGGAAGG + Intergenic
1148240062 17:45994404-45994426 GGAGGCAGAGAGGCTGAGCCTGG + Intronic
1148543125 17:48495741-48495763 GGGAGCCCAGAGACTGAGCAAGG - Intergenic
1148588221 17:48796195-48796217 GAGGGCACAGAGAGGAAGCAGGG - Intronic
1148854708 17:50572443-50572465 CGAGGCATATAGGGTGAGCAGGG - Intronic
1148983687 17:51601768-51601790 GGATGCACAGGGAGTGGGGAAGG + Intergenic
1148991182 17:51668625-51668647 GGAGGTCCCGAGAGCGAGCAAGG - Intronic
1149080678 17:52653087-52653109 GGAGGGAGAGAGAGAGAGAAAGG + Intergenic
1149099334 17:52884467-52884489 AGAGGCGCCGAGAGCGAGCAAGG + Intronic
1149248561 17:54740970-54740992 AGAGACACAGAGACTGAACATGG - Intergenic
1149482504 17:57015279-57015301 AGAGCCAGAGAGAGAGAGCATGG + Intergenic
1149574002 17:57698326-57698348 GCGGGCACAGAAAGTGGGCAAGG - Intergenic
1149753900 17:59172377-59172399 GGAGGCACGGAAAGCGAGCGAGG - Intronic
1149782691 17:59410476-59410498 GGCTGCACAGTCAGTGAGCATGG + Intergenic
1150574082 17:66414324-66414346 GGAGGAAGAAAGAGGGAGCAGGG - Intronic
1150597179 17:66616530-66616552 GGGGGCACACAGAGTGAGTAAGG + Intronic
1150620531 17:66804472-66804494 GGAAGCCAAGAGAGTGAGCAGGG + Exonic
1150682437 17:67294603-67294625 GGAGGCGCAGAGAGCGAGCCAGG - Intergenic
1150775747 17:68080508-68080530 GGAGGCCCCGAGAGCGAGCGAGG - Intergenic
1150786817 17:68169865-68169887 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1150788187 17:68179700-68179722 GGAGGCGCCAAGAGTGAGCCAGG - Intergenic
1150804682 17:68309415-68309437 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1151429904 17:74055468-74055490 GGAGGGAGAGAGAGAGAGAAGGG - Intergenic
1151438582 17:74113817-74113839 GGAGGCACCAAGAGCGAGCGAGG + Intergenic
1151922461 17:77167716-77167738 GGACACTCAAAGAGTGAGCAAGG + Intronic
1151983259 17:77526574-77526596 GGAGACACCGAGAGTGAGCGAGG + Intergenic
1152362819 17:79840269-79840291 GGAGGCAGAGAGAGCGGGCGCGG + Intergenic
1152542308 17:80982421-80982443 TGAGGGACAGAGAGTGGGGAGGG + Intergenic
1152584480 17:81182865-81182887 GGAGGCAGAGGGAGTGTGCCTGG - Intergenic
1152620539 17:81362224-81362246 GCAGGCAGAGAGCGTGTGCAGGG - Intergenic
1152722768 17:81930995-81931017 GAAGCCACAGAGCGTGAGGACGG - Intergenic
1152921010 17:83066698-83066720 GGACGCACAGTGAGTGTGCAGGG - Intergenic
1152921056 17:83066868-83066890 GGACGCACAGTGAGTGTGCAGGG - Intergenic
1153026362 18:676452-676474 GGAGGAAGAGAGAGTGAGGGGGG - Intronic
1153678798 18:7480518-7480540 GGAGGCCCAGAGTGAGAGCAGGG + Intergenic
1154106959 18:11531962-11531984 GGAGAGTCAGATAGTGAGCAGGG + Intergenic
1154231220 18:12557653-12557675 GGAGGCACCAAGAGCGAGCAAGG + Intronic
1154255394 18:12777360-12777382 GGAGGCGCCGAGAGGGAGCGAGG + Intergenic
1154294180 18:13135176-13135198 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
1155272033 18:24150059-24150081 GGAGGCGCCAAGAGCGAGCAAGG + Intronic
1155313066 18:24543912-24543934 GGAAGCACAGTGTGTGAGGATGG - Intergenic
1155976707 18:32139717-32139739 GGAGGCGCCCAGAGCGAGCAAGG - Intronic
1156150270 18:34233810-34233832 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1156324708 18:36064100-36064122 GGAGGCGCCGAGAGCGAGCAAGG - Intronic
1156372681 18:36485391-36485413 GGAGGGAGGGAGAGTGAGCATGG + Intronic
1156657754 18:39308945-39308967 GGAGGTGCCGAGAGCGAGCAAGG - Intergenic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1157557834 18:48624297-48624319 TGAGGCACAGAAATGGAGCATGG + Intronic
1157648711 18:49304777-49304799 GGAGGGAAAGACAGTGAGCTAGG - Intronic
1157856973 18:51112313-51112335 GGAGGCTCCGAGAGCGAGCGAGG + Intergenic
1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG + Intergenic
1158125234 18:54093591-54093613 GGAGGGACAGAGAGCAAGCAGGG + Intergenic
1158282377 18:55841203-55841225 GGAGGCACCAAGAGCGAGCAAGG + Intergenic
1158351839 18:56572142-56572164 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1158393110 18:57059543-57059565 GGAGGGACAGAGACAGAGCTGGG + Intergenic
1159024409 18:63169445-63169467 GGAGGGAGAGAGAGGGAGAAAGG - Intronic
1159109735 18:64042838-64042860 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1159260566 18:66006463-66006485 GGAGGTGCTGAGAGTGAGCGAGG + Intergenic
1159322142 18:66866554-66866576 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1159503669 18:69306644-69306666 GGAAGCACTGCAAGTGAGCAAGG + Intergenic
1159629091 18:70728325-70728347 GGACACACAGAGAATCAGCAGGG - Intergenic
1159953279 18:74501226-74501248 GCAGCCACAGAGGGTGAGCCTGG + Intronic
1160040949 18:75345000-75345022 GGAGGCACAGGCTGTGAGGAAGG + Intergenic
1160123953 18:76153741-76153763 GGAGGCACCAAGAGAGAGAAGGG + Intergenic
1160176700 18:76600638-76600660 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1160200138 18:76789041-76789063 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
1160416428 18:78714797-78714819 CTAGGAACAGAAAGTGAGCACGG + Intergenic
1160514225 18:79469715-79469737 GGAGGCAAAGAGAGGGAGAACGG - Intronic
1160595309 18:79969291-79969313 GGAGGGAGAGAGAGAGAGAAAGG + Intronic
1160811771 19:1015937-1015959 GGAGGCCCTGAGTCTGAGCACGG + Intronic
1160939418 19:1613430-1613452 TGGGGCCCACAGAGTGAGCAGGG - Intronic
1161237172 19:3203933-3203955 GGAGGCACAGAGGGAGGGCCGGG + Intronic
1161240854 19:3222960-3222982 GGAGGGGGAGAGAGGGAGCAGGG + Intergenic
1161257919 19:3320155-3320177 GGAGGGAGAGAGAGGGAGAAGGG + Intergenic
1161267407 19:3370715-3370737 GGAGGAACAGAGAGAGAGGAAGG - Intronic
1161477779 19:4495972-4495994 GGAGTGACAGAGAGAGAACACGG - Intronic
1161622136 19:5303621-5303643 GCGGGCAGAGTGAGTGAGCAGGG + Intronic
1161693946 19:5754782-5754804 GGAGGCACAGAGACAGCACAAGG - Intronic
1161940342 19:7398896-7398918 GGAGGCACAGCCAGTCACCACGG - Intronic
1162091163 19:8280860-8280882 GGAGGCACCGAGAGCAAGCGAGG + Intronic
1162093397 19:8295698-8295720 GGAGGCACCGAGAGCAAGCGAGG + Intronic
1162106922 19:8375612-8375634 GGAGTCGCAGAGAGTGAGCGAGG - Intronic
1162233195 19:9283963-9283985 GGAGTCGCGGAGAGTGAGCGAGG + Intergenic
1162237570 19:9321252-9321274 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1162262120 19:9541832-9541854 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
1162479788 19:10921537-10921559 AGAGTCACAGAGAGAGAGAAAGG - Intronic
1162534000 19:11252655-11252677 GGAGGCTCAGAGAAAAAGCATGG + Intronic
1162569946 19:11465911-11465933 GGAGGCTCAGGGAGTCAGCCAGG - Intronic
1162973312 19:14194311-14194333 GGACACAAAGAGAGTGAGGAGGG + Intronic
1162987031 19:14277487-14277509 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1163508675 19:17722794-17722816 GGAGGGAGAGAGAGAGAGAAAGG + Intronic
1164049871 19:21576550-21576572 GGAGACACAGAGAAAGAGAAAGG - Intergenic
1164756237 19:30691863-30691885 GGAAGCACAGAGGGAGAGAAAGG + Intronic
1165266858 19:34668046-34668068 GGAGGCGCCGAGAGAGAGCGAGG - Intronic
1165415607 19:35691567-35691589 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1165838128 19:38771617-38771639 CGAGGGACAGAGAGACAGCAGGG - Intronic
1165841437 19:38791080-38791102 CGAGGGACAGAGAGACAGCAGGG + Intronic
1166036305 19:40170649-40170671 GGAGGCGCGGAGAGCGAGCGAGG + Intergenic
1166119028 19:40673857-40673879 AGAGACACAGAGGGTGAGCCTGG - Intronic
1166123739 19:40701364-40701386 GGAGGCAGAGAATATGAGCAAGG + Intronic
1166146467 19:40840212-40840234 GGAGCAAGAGAGAGTGAGCGGGG - Intronic
1166150513 19:40870825-40870847 GGAGCAAGAGAGAGTGAGCGGGG - Intronic
1166177208 19:41082565-41082587 GGAAGCACAGGAAGTGAGTAAGG - Intergenic
1166487087 19:43222439-43222461 GGAGGCACCGAGAGCGAGCGAGG + Intronic
1166496488 19:43306548-43306570 AGAGGAGCAGAGAGGGAGCAGGG + Intergenic
1166920265 19:46224408-46224430 GGAGAGAAAGAGAGGGAGCAGGG - Intergenic
1166946882 19:46402882-46402904 GGAGACACAGAGAGGGAGGTGGG - Intergenic
1167103697 19:47418938-47418960 GGAGGGGCAGAGAGAGAGCGAGG + Intronic
1167333091 19:48868292-48868314 GGAGACACAGAAAGTGAGAGTGG - Exonic
1167449341 19:49557733-49557755 GGACGGACAGTGAGTGAGGACGG + Intronic
1167493295 19:49803884-49803906 GGAGGCCCAGAGAACGGGCAGGG - Intronic
1167520619 19:49952312-49952334 GCAGGAACAGAAAGCGAGCAGGG + Exonic
1167621993 19:50565926-50565948 GGAGGCACAGAGGGAGAGAAGGG - Intronic
1167637034 19:50661285-50661307 GGAGGCATGGAGCGTGAGAAAGG + Intronic
1168193961 19:54759507-54759529 AGAGGCACAGAGAGAAATCAGGG + Intronic
1168196006 19:54774232-54774254 AGAGGCACAGAGAGAAATCAGGG + Intronic
1168409832 19:56132811-56132833 AGATGTTCAGAGAGTGAGCAGGG - Intronic
1168659810 19:58157153-58157175 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
924967308 2:90844-90866 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
924977550 2:191851-191873 GGAGGCACTGAGAGCCAGCAAGG + Intergenic
925080166 2:1056848-1056870 GGAGGGAGAGAGGGAGAGCACGG + Intronic
925085033 2:1101157-1101179 GGAGGCACAGAATGCGAGCCTGG - Intronic
925099050 2:1230103-1230125 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
925172681 2:1759819-1759841 GGAGGTGCTGAGAGTGAGCAAGG + Intergenic
925290933 2:2748305-2748327 GGACGCACAGAGAGATTGCACGG - Intergenic
925532902 2:4884078-4884100 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
925810472 2:7695201-7695223 GGAGGAAGAGAGAATGAGCTTGG + Intergenic
925921015 2:8637894-8637916 GGGGGAAGAGAGAGAGAGCAGGG + Intergenic
926233430 2:11021930-11021952 GGAGACAAAGAGAGAGAGGAGGG + Intergenic
926247936 2:11134256-11134278 TGAGGCACAGGGAGTGAGGAAGG + Intronic
926437743 2:12854578-12854600 GGAGGCACGGAGAGCGAGTGAGG + Intergenic
926444612 2:12927018-12927040 GGAGGCGCGGAGAGCGAGCGAGG + Intergenic
926580273 2:14627045-14627067 GGGGGCACGGAGTTTGAGCAAGG + Intergenic
926685900 2:15697238-15697260 TGAGGCACCAAGAGTGAGCGAGG + Intronic
926742001 2:16119459-16119481 GGAGAGAGAGAGAGTGAGTAGGG - Intergenic
927504855 2:23606213-23606235 AGAGGCAGAGAGAGAGAGAAAGG + Intronic
927520688 2:23696296-23696318 GGAGGCAGAGAGAGCGGGCGGGG - Intronic
927596516 2:24402712-24402734 GGAGGCACTGAGAGCGAGCAAGG - Intergenic
927649500 2:24903488-24903510 GGAGGAACAGAGGGTGAAGAAGG - Intronic
927666974 2:25039535-25039557 GGAGGCACATACAAGGAGCAGGG - Intergenic
927719962 2:25376331-25376353 GAAAACACAGAGAGTCAGCAGGG + Intergenic
927777727 2:25915353-25915375 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
927900351 2:26814323-26814345 GGAGGCGCGGAGAGCGAGCCAGG - Intergenic
927917577 2:26946877-26946899 GGAAGCACAGAGGGTGAGACGGG - Intronic
928180485 2:29065140-29065162 GGAGGGACAGAAAGGGAGAATGG - Intronic
928415115 2:31085486-31085508 GGAGGCACATGGAGTAGGCAGGG + Intronic
928617295 2:33053498-33053520 GGAAGCACCGAGAGCGAGCGAGG - Intronic
928688485 2:33775201-33775223 GGAGGCACTGAGAGCAAGCGAGG - Intergenic
928701617 2:33904020-33904042 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
928723187 2:34143015-34143037 GGAGGCACTGAGAGCGAGCAAGG + Intergenic
928793785 2:34991901-34991923 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
928880505 2:36092093-36092115 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
928936814 2:36688113-36688135 GGAGGCACAGAGAGAGAGGGAGG - Intergenic
929069973 2:38020365-38020387 GGAGGCGCAGAGAGCGAGCGAGG - Intronic
929109798 2:38397163-38397185 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
929264250 2:39900437-39900459 GGCAGAACAGAGAGAGAGCAGGG - Intergenic
929379609 2:41335442-41335464 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
929806582 2:45151559-45151581 GGAGCAAAAGAGAGTGAGCAGGG - Intergenic
929890956 2:45918182-45918204 GGAGGCACCGAGAGCGAGCGAGG + Intronic
930037936 2:47099584-47099606 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
930255704 2:49087709-49087731 GGAGACAGAGGGAGGGAGCAAGG + Intronic
930338841 2:50084714-50084736 GGAGGCACCGAGAGCGAGGGAGG + Intronic
930420961 2:51152128-51152150 GGAGGTGCCGAGAGCGAGCAAGG + Intergenic
930557794 2:52921873-52921895 TAAGGCACAGAGAGTAAACAAGG + Intergenic
931106893 2:59066773-59066795 GGAGGGACCGAGAGCGAGCGAGG - Intergenic
931705359 2:64942414-64942436 GGATGCATAGAGATTGACCAGGG - Intergenic
931996485 2:67843950-67843972 CGAGACAGAGAGAGTGAGGAAGG + Intergenic
932483101 2:72061482-72061504 GGTGGGAAAGAGAGAGAGCAGGG + Intergenic
932493178 2:72134133-72134155 GGAGGCAAAGATAGTGGGCAGGG + Intronic
932563832 2:72893506-72893528 TGAAGCCCAGAGAGAGAGCAGGG - Intergenic
932774814 2:74521820-74521842 TGAGAGACAGAGAGAGAGCAAGG - Intronic
933420795 2:82043122-82043144 GGGGGCTCAGGGACTGAGCATGG + Intergenic
933442151 2:82326703-82326725 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
933447669 2:82402928-82402950 GGAGGCACTGAGAGTGAGCGAGG - Intergenic
933491130 2:82986229-82986251 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
933506256 2:83180895-83180917 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
933511541 2:83246434-83246456 GGAGGTGCCGAGAGCGAGCAAGG + Intergenic
933531564 2:83518024-83518046 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
933712224 2:85334859-85334881 GGAGGCACGGAGAGCGAGCGAGG + Intergenic
933797256 2:85929396-85929418 AGAGGCACCGAGAGTGAGCGAGG + Intergenic
934085058 2:88503018-88503040 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
934479604 2:94622692-94622714 GGAGACACGGAGAGCGAGCAAGG + Intergenic
934502802 2:94872825-94872847 TGAGGCACTGAGAGAGTGCAGGG - Intronic
934583255 2:95465133-95465155 GGAGGCACCCAGAGCGAGCGAGG - Intergenic
934596195 2:95611581-95611603 GGAGGCACCCAGAGCGAGCGAGG + Intergenic
934732596 2:96669018-96669040 GGAAGGAGAGAGAGTGAGAAGGG - Intergenic
934863838 2:97788299-97788321 GTAGGCCCAGGGAGTCAGCAGGG - Intronic
934898419 2:98138855-98138877 GGAGGCACTGAGAGTGAGCGAGG - Intronic
934926167 2:98383166-98383188 GGGGGAAGAGAGAGTGAACATGG - Intronic
935171405 2:100613619-100613641 GAAGGCACAGAGAGGCAGAAGGG - Intergenic
935333167 2:101992110-101992132 GGAGGCAGAGAGAGAGGGAAAGG + Intronic
935344012 2:102087656-102087678 GGAGAGACGGAGAGAGAGCAAGG - Intronic
935790236 2:106584271-106584293 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
935878434 2:107536597-107536619 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
935896935 2:107747845-107747867 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
935922478 2:108031415-108031437 GGAGGCGCTGAGAGCGAGCAAGG - Intergenic
936172778 2:110190701-110190723 GGAGGCGCCAAGAGTGAGCGAGG + Intronic
936346804 2:111681702-111681724 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
936396583 2:112136562-112136584 AGAGAGACAGAGAGGGAGCAGGG + Intergenic
936581611 2:113704913-113704935 GGAGGCGGGGAGAGTGAGCGAGG + Intergenic
936759389 2:115757444-115757466 GGAGGCAAAGAGCTTGTGCAGGG + Intronic
937264634 2:120608067-120608089 TGAGGCATAGAGGGGGAGCAGGG + Intergenic
937273409 2:120669678-120669700 GGAGGCACAGGGACTGGGCTCGG - Intergenic
937608274 2:123827253-123827275 GGAGGTGCTGAGAGTGAGCAAGG + Intergenic
937723031 2:125126078-125126100 GGAGGATCAGAGAGTGGGCGGGG + Intergenic
938023677 2:127926467-127926489 GGAGCAAGAGAGAGTGAGAAGGG + Intergenic
938126156 2:128672632-128672654 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
938160234 2:128979112-128979134 GGCTGCACAGAGAGTGAGTCTGG - Intergenic
938315863 2:130327733-130327755 GGAGGCGCCGAGAGCAAGCAAGG - Intergenic
938512544 2:131966289-131966311 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
938726108 2:134109857-134109879 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
938827544 2:135020771-135020793 GGAGAGACAGAGAGAGTGCAGGG - Intronic
938931279 2:136088531-136088553 GGAGGCGCCGAGAGTGAGCAAGG + Intergenic
939053296 2:137332115-137332137 GGAGGCACCGAGAGCGAGCGAGG + Intronic
939056752 2:137374161-137374183 GGAGGGAGAGAGAGAGAGCTGGG + Intronic
939085601 2:137715649-137715671 GGAGGCACTGAGAGTGAGCGAGG - Intergenic
939229676 2:139410193-139410215 GGAGGCACGGAGAGCGAGCGAGG - Intergenic
939281677 2:140073648-140073670 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
939298080 2:140295862-140295884 TGGGGCAAAGAGAGGGAGCATGG + Intronic
939569770 2:143826970-143826992 GGAGAGACAGAGAGAGAGAAAGG - Intergenic
939738862 2:145881419-145881441 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
939745465 2:145961009-145961031 GGAGGTGCTGAGAGTGAGCAAGG + Intergenic
939765110 2:146238643-146238665 GGAGGTACAGAGGGTAAGAAGGG - Intergenic
939834498 2:147112110-147112132 GGAGCAAGAGAGAGAGAGCAGGG - Intergenic
939868982 2:147506773-147506795 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
939886503 2:147686751-147686773 GGACACACTGAGAGCGAGCAAGG + Intergenic
940112720 2:150171532-150171554 TGAGGCACCGAGAGCGAGCGTGG + Intergenic
940235115 2:151502923-151502945 ACAGGCACAGAGAGTAAGGAAGG + Intronic
940666784 2:156618568-156618590 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
940796780 2:158089011-158089033 GGAGGATCAGGGAGTGGGCAGGG + Intronic
941240001 2:163026122-163026144 GGAGGCGCAGAGAGAGAGCGAGG - Intergenic
941381849 2:164802836-164802858 GGAGGGAAAGAGAGGGAGGAAGG + Intronic
941398014 2:164995265-164995287 GGAGGCGCAGAGAGAGAGCGAGG + Intergenic
941647702 2:168058992-168059014 ATGGGCACAGAGAGTTAGCAGGG - Intronic
941712201 2:168725406-168725428 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
941827556 2:169916977-169916999 GGAGGTAAAGAGAGGGAGCAGGG - Intronic
941953093 2:171176795-171176817 GGTGAAGCAGAGAGTGAGCAAGG - Intronic
942046099 2:172100380-172100402 GGTGGCCCCGGGAGTGAGCAGGG + Exonic
942311439 2:174660628-174660650 TGAGGCACAGTGTGTCAGCAGGG + Intronic
942317680 2:174710076-174710098 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
942778960 2:179617970-179617992 AGAAGAAGAGAGAGTGAGCACGG - Intronic
942813782 2:180027406-180027428 AGAGGCACACAGAGAGAGAAGGG - Intergenic
942867209 2:180691239-180691261 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
942957197 2:181787292-181787314 TGAGACAGAGAGAGTGAGCATGG + Intergenic
943024155 2:182608328-182608350 GGAGGCGCCGAGAGCGAGCCCGG - Intergenic
943166151 2:184328161-184328183 GGAAGCATCGAGAGTGAGCGAGG + Intergenic
943222760 2:185132461-185132483 GGAGGCACCGAGAGCCAGCGAGG - Intergenic
943680430 2:190761472-190761494 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
943789975 2:191921511-191921533 GGAGGCGCAGAGAGCTAGCAAGG - Intergenic
943941511 2:194003245-194003267 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
943942645 2:194020013-194020035 GGAGGTGCGGAGAGTGAGCGAGG - Intergenic
943947935 2:194090899-194090921 GGAGGCGCTGAGAGTGAGTGAGG + Intergenic
944055115 2:195515532-195515554 GGAGGCACGGAGAGCGAGCGAGG - Intergenic
944228356 2:197370424-197370446 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
944252565 2:197592065-197592087 GGAGGCGCGGAGAGTGAGTGAGG + Intronic
944688278 2:202136840-202136862 CGAGGCGCCGAGAGTAAGCAAGG + Intronic
944728522 2:202496762-202496784 GGAGGCGCTGAGAGCGAGCGAGG - Intronic
944729561 2:202503238-202503260 AGAGGCGCTGAGAGTGAGCGAGG - Intronic
944843211 2:203643335-203643357 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
944941386 2:204632176-204632198 GGAGCAAGAGAGAGTGAACAGGG - Intronic
945173063 2:207017074-207017096 TGAGGCACAGAGACTCAGGATGG + Intergenic
945302632 2:208228190-208228212 AGAGGCACTGAGAGCAAGCAAGG + Intergenic
945435499 2:209812487-209812509 GCAGCCACAGAGAGTGAGTAGGG - Intronic
945451556 2:210001076-210001098 GAAGGCACCGAGAGTGAGCGAGG + Intergenic
945575557 2:211524884-211524906 GGAGGCGCTGAGAGCGAGCGAGG + Intronic
945599419 2:211840241-211840263 GCAGGCAAAGCGAGTGTGCAAGG - Intronic
945870138 2:215218911-215218933 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
946125903 2:217562411-217562433 GGAGACACAGACATTGTGCATGG + Intronic
946174954 2:217916900-217916922 TGAGGGACAGAGAATGGGCAGGG + Intronic
946376425 2:219312672-219312694 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
946923646 2:224604210-224604232 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
946929069 2:224655150-224655172 GGAGGTGCTGAGAGCGAGCAAGG - Intergenic
946982248 2:225229957-225229979 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
947026551 2:225743981-225744003 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
947103720 2:226647859-226647881 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
947171845 2:227320479-227320501 GGAGGAGCTGAGAGTGAGCGAGG - Intergenic
947281435 2:228460126-228460148 GGCAGCACAGAGGGTGAGAAGGG + Intergenic
947406246 2:229780556-229780578 GGAGTCAGAGAGACTGAGCAGGG - Intronic
947411910 2:229850570-229850592 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
947461227 2:230306375-230306397 GGAGACACAGAGAGGGGGCATGG + Intronic
947539355 2:230964449-230964471 GTAGCCACAGAGAGTGCGCTGGG - Intergenic
947539435 2:230964760-230964782 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
948234529 2:236378705-236378727 CGTGGCACAGTGTGTGAGCATGG + Intronic
948237791 2:236403369-236403391 GGAGACACAGAGAAAGAGGATGG + Intronic
948449195 2:238058366-238058388 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
948456679 2:238107726-238107748 GGAGGCACACAGAGTGGGAGGGG - Intronic
948605587 2:239132528-239132550 GGTGGCACAGAGCCTGGGCAGGG + Intronic
948723728 2:239919337-239919359 GGAGGGGCAGAGAGTGAGGAGGG - Intronic
948820018 2:240538132-240538154 GGAGGCGCCGAGAGTGAGCGAGG - Intronic
948939597 2:241189256-241189278 AGAGGGACAGAGACTGAGCCTGG - Intronic
1168952872 20:1814551-1814573 GGAGGCAGCATGAGTGAGCATGG - Intergenic
1169216426 20:3796988-3797010 GGAGGCACAATGAGGGAGGAGGG - Intronic
1169327243 20:4686326-4686348 GGGGGCACAGAGTGTGCGCCGGG + Exonic
1169525997 20:6426319-6426341 GGAGGGAGAGAGAGGGAGGATGG - Intergenic
1169564703 20:6841312-6841334 GGAGGGAGAGAGAGAGAGGAGGG + Intergenic
1169564706 20:6841329-6841351 GGAGGGAGAGAGAGAGAGGAGGG + Intergenic
1170636095 20:18105978-18106000 GGAGGCAGAGGGAGTGAGTGTGG + Intergenic
1170649425 20:18226617-18226639 GGAGGCACCCAGAGCGAGCGAGG - Intergenic
1170806929 20:19640142-19640164 GGAGGCGCGGAGAGCGAGCGAGG + Intronic
1170807351 20:19644177-19644199 GCAGGCACAGAGAGTCATCTGGG - Intronic
1170930810 20:20768291-20768313 GGAGGCACTGAGAGCGAGCGAGG - Intergenic
1170989805 20:21291726-21291748 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1171045921 20:21809369-21809391 GGAGGCACAGGGTAGGAGCAGGG + Intergenic
1171113584 20:22505198-22505220 GTAGGCACAGACAGGAAGCAAGG + Intergenic
1172114039 20:32563208-32563230 GGAGGGAGGGAGAGTGAGGAGGG + Intronic
1172431939 20:34899311-34899333 GGAGGCGCCGAGAGCGAGCAAGG + Intronic
1172536927 20:35681044-35681066 TGAGACACAGAGAGGGAGGAAGG - Intronic
1172828822 20:37814357-37814379 AGAGGCACACAAAGTGAGCCAGG - Intronic
1172928623 20:38564756-38564778 GGAGCCATAGAGAGAGACCAGGG + Intronic
1173298364 20:41779225-41779247 TGAGGCACAGAGAGTGTGAGTGG - Intergenic
1173542671 20:43866476-43866498 GGAGCCACAGAGAGAGGACATGG - Intergenic
1173601518 20:44298985-44299007 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1173762785 20:45578814-45578836 GGAGGGGCAGAGCCTGAGCAAGG - Intronic
1173805117 20:45919848-45919870 GGAGGCACAGCGAGGGAGGAGGG - Intergenic
1173831429 20:46091703-46091725 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
1174162962 20:48564571-48564593 GGAGGCACCGAGAGCAAGCAAGG + Intergenic
1174484088 20:50850747-50850769 GCAGGCACCAAGAGTGAGCACGG - Intronic
1174701391 20:52612628-52612650 GCAGGCAAAGAGAGAGAGCTTGG - Intergenic
1175275657 20:57768823-57768845 GGATGGAGTGAGAGTGAGCAGGG - Intergenic
1175472995 20:59246199-59246221 GAAGGCACAGAGAGAGAAGAGGG - Intronic
1175620151 20:60437242-60437264 GGAGGAACAGGAAGTGACCAAGG - Intergenic
1175893142 20:62324086-62324108 GAAGGCACTGAGAGGGGGCAGGG + Exonic
1175896817 20:62340242-62340264 AGAGGGACAGAAATTGAGCAAGG + Intronic
1176129090 20:63488666-63488688 GGAGGCCCCGCGAGTGAGGAAGG - Intronic
1176168702 20:63687595-63687617 GAGGGCACAGAGTGTGAGGACGG - Intronic
1176332354 21:5560098-5560120 GGAGGCCCGGAGAGTGAGCAAGG + Intergenic
1176344897 21:5733964-5733986 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176351711 21:5854548-5854570 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176395403 21:6260853-6260875 GGAGGCCCGGAGAGTGAGCAAGG - Intergenic
1176412042 21:6454388-6454410 GGTGGCACAGGCAGGGAGCAGGG - Intergenic
1176430349 21:6571537-6571559 GCAGGCAGGAAGAGTGAGCAAGG - Intergenic
1176441754 21:6728251-6728273 GGAGGCCCGGAGAGTGAGCAAGG + Intergenic
1176466016 21:7055320-7055342 GGAGGCCCGGAGAGTGAGCAAGG + Intronic
1176489577 21:7437098-7437120 GGAGGCCCGGAGAGTGAGCAAGG + Intergenic
1176499930 21:7590491-7590513 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1176539218 21:8132034-8132056 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176558169 21:8315079-8315101 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1176663152 21:9659887-9659909 GGAGGCACAGAGAGCGAGCCAGG - Intergenic
1176872320 21:14093478-14093500 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1176936166 21:14869482-14869504 GGAGGGACAGAGAGGGAGGGAGG + Intergenic
1176948595 21:15016162-15016184 GGAGCAACAGATACTGAGCAGGG + Intronic
1177112892 21:17049672-17049694 GGACAACCAGAGAGTGAGCAAGG + Intergenic
1177182473 21:17758095-17758117 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1177496849 21:21902269-21902291 GGAGGTACCGAGAGCAAGCAAGG - Intergenic
1177581037 21:23021839-23021861 GGAGACGCCGAGAGGGAGCAAGG + Intergenic
1177592376 21:23186872-23186894 GGAGGCAAAGAGAGAGAGATAGG + Intergenic
1177637532 21:23806869-23806891 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
1177767208 21:25472728-25472750 GGAGACAGAGAGGGTGAGGAGGG - Intergenic
1178024155 21:28446073-28446095 GGAGGGAGAGAGAGCGAGCAAGG - Intergenic
1178074101 21:29000028-29000050 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1178585724 21:33868825-33868847 GGAGGCACCGAGAGCGAGCGAGG + Intronic
1178737684 21:35167470-35167492 GGAAGCACTGTGAGGGAGCAGGG + Intronic
1178983432 21:37283694-37283716 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1179417060 21:41207595-41207617 GGAGGCAGAGAGAGAGAACAAGG - Intronic
1179605777 21:42514268-42514290 GGAGGCAGAGGGAGCGGGCACGG + Exonic
1179687536 21:43062710-43062732 GGTGGCACAGGCAGGGAGCAGGG - Intronic
1179705743 21:43178999-43179021 GCAGGCAGGAAGAGTGAGCAAGG - Intergenic
1180166533 21:46033613-46033635 GGACCCACAGAGAGGCAGCACGG + Intergenic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1180192394 21:46172191-46172213 GGATGCACAGAGCGTGAGGCGGG + Intronic
1180536620 22:16398195-16398217 GGAGGCACTGGCAGTGGGCAGGG - Intergenic
1180741127 22:18053865-18053887 GGAGGCACGGAGAGCGAGCGAGG + Intergenic
1180755018 22:18155377-18155399 GGAGGCACCGAGAGCGAGCGAGG - Intronic
1181338461 22:22159544-22159566 GGAAGCAGAGAGGGTGAGGAGGG - Intergenic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181775153 22:25154021-25154043 GGAGGTACAGAGAGGTATCAGGG + Intronic
1181800953 22:25347415-25347437 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
1181851420 22:25752712-25752734 GGAGGCACCGAGAGCGAGCAAGG - Intronic
1181885261 22:26017064-26017086 AGAGGCACAGAGAGGAAGGAAGG - Intronic
1182102440 22:27667608-27667630 GTGGGCACAGAGAGTTTGCACGG + Intergenic
1182198339 22:28542346-28542368 GGAGCCACAGAAGGTGAGGAAGG + Intronic
1182263291 22:29091947-29091969 CGAAGCACAGCGAGTGAGTAAGG + Intronic
1182338098 22:29598530-29598552 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1182371262 22:29812673-29812695 AGAGGCCCAGAGAGAGAGCTGGG - Intronic
1182479306 22:30596712-30596734 GGAGGCACTGAGAGCGAGCGAGG - Intronic
1182816927 22:33172442-33172464 AGAGAGAGAGAGAGTGAGCAGGG - Intronic
1183282234 22:36937995-36938017 GGAGGCCCAGAGAGGGAACTAGG - Exonic
1183315937 22:37136790-37136812 GGAGGCAAAAAGAGTGACCCAGG - Intronic
1183345803 22:37307063-37307085 GGAGGGACACAGAGCCAGCAGGG + Intronic
1183422204 22:37718348-37718370 GGAGGCGCCGAGAGTGAGCGAGG + Intronic
1183684469 22:39353597-39353619 TGAGGCACAGAGGGTGGGGAGGG - Intronic
1183746466 22:39694731-39694753 GGAGACACAGAGACAGAGGAAGG - Intergenic
1183820511 22:40342319-40342341 GGAGTCCCAGACAGTGAGCTAGG + Intergenic
1183990280 22:41593378-41593400 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1184069278 22:42138143-42138165 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1184099993 22:42336953-42336975 GGGGAGACAGACAGTGAGCAAGG - Intronic
1184656140 22:45943193-45943215 AGAGGGACAGAGAGGGACCAAGG - Intronic
1184837085 22:47030093-47030115 AGAGCCACTGACAGTGAGCAGGG - Intronic
1184898124 22:47424202-47424224 GGAGGGACAGAGGGGGAGCTGGG + Intergenic
1185104232 22:48858178-48858200 GGATGGACAGAGAGAGAGCATGG - Intergenic
1185115214 22:48930499-48930521 GGAAGCACAGGGAGAGAGGAAGG - Intergenic
1185130192 22:49034689-49034711 TGAGGCCCACAGGGTGAGCAGGG + Intergenic
1203244167 22_KI270733v1_random:48389-48411 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
949292682 3:2484766-2484788 GGAGGTGCGGAGAGCGAGCAAGG - Intronic
949747104 3:7307944-7307966 GAGGGCACAGAGAGTTACCATGG + Intronic
949932148 3:9087593-9087615 GGAGGCACGGAGACTGGGGATGG + Intronic
949942382 3:9164955-9164977 GGAGACCCAGAGACGGAGCAGGG - Intronic
949945428 3:9185963-9185985 GCAGGCACACAGGGTTAGCAAGG + Intronic
950069014 3:10136874-10136896 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
950203527 3:11061234-11061256 GGAGGCTCCGAGAGCAAGCAAGG - Intergenic
950204924 3:11071731-11071753 GGAGGCGCTGAGAGCAAGCAAGG + Intergenic
950207818 3:11093888-11093910 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
950257042 3:11513751-11513773 GGAGGCGCTGAGAGTGAGCGAGG + Intronic
950308272 3:11933682-11933704 GGAGCCAGAGAGGGCGAGCAAGG + Intergenic
950418475 3:12882743-12882765 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
950435154 3:12974925-12974947 TGGGGCACAGAGAGTGGACACGG - Intronic
950470091 3:13179607-13179629 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
950513451 3:13447705-13447727 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
950600448 3:14030000-14030022 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
950632566 3:14293073-14293095 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
950929321 3:16773569-16773591 GGAGGCACCGAGAGCAAGCGAGG - Intergenic
951025016 3:17818500-17818522 GGAGGCACCGGGAGCGAGCGAGG + Intronic
951415365 3:22416804-22416826 GGAGGCGCCGAGAATGAGCAAGG - Intergenic
951491307 3:23272512-23272534 GGAGGCGCTGAGAGCGAGCGAGG + Intronic
951551950 3:23883043-23883065 GGAGGCACCAAGAGCGAGCGAGG + Intronic
952076242 3:29701429-29701451 GGAGGCACCGAGGGCGAGCGAGG - Intronic
952089261 3:29864901-29864923 GGAGGAAGAGAGAGAGAGGAAGG + Intronic
952350479 3:32531429-32531451 GGATGTAGGGAGAGTGAGCAAGG - Intronic
952360391 3:32625491-32625513 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
952513071 3:34076435-34076457 TGAGGAACAGAGAGAGGGCAGGG + Intergenic
952593556 3:34988216-34988238 GGAGGCTCAGAGAGTGAACGAGG - Intergenic
952674227 3:36007899-36007921 GGAGCAACAGAGAGAGAGGAGGG + Intergenic
952713235 3:36453197-36453219 GGAGGCGCCGGGAGCGAGCAAGG - Intronic
952730560 3:36633759-36633781 GGAGGCGCAGAGAGCGAGCGAGG - Intergenic
952870380 3:37894652-37894674 GAAGGCAAAGAGAGAGAGAATGG - Intronic
953096202 3:39779602-39779624 GAAGGCGCTGAGAGTGAGCGAGG - Intergenic
953495885 3:43386713-43386735 GGAGGCAGGGAGAATGAGCAGGG + Intronic
953522570 3:43656934-43656956 GGAGGCGCTGAGAGCGAGCAAGG + Intronic
953930508 3:47003552-47003574 GGGGGCCCAGGGAGTGGGCAGGG + Intronic
954089404 3:48272431-48272453 GGAGGCGCTGAGAGTGAGCGAGG + Intronic
954807322 3:53228155-53228177 GGTGACACAGAGGGTGAGTAAGG + Intronic
955286654 3:57647881-57647903 GAAGAATCAGAGAGTGAGCAGGG + Intronic
955286812 3:57649766-57649788 GGAGAATCAGAGAGTGAGCAGGG - Intronic
955386543 3:58485442-58485464 GGAGGCCCTGTGAGGGAGCAAGG - Intergenic
956109420 3:65855637-65855659 GGAGAAACAGAGAGAGAGAAAGG + Intronic
956438753 3:69260119-69260141 GGAGGCACCGAGAGCGAGCGAGG - Intronic
956481383 3:69677305-69677327 GGAGGCACCGAGAGCGAGCTAGG - Intergenic
957009262 3:74985634-74985656 GGAGGCGCCGAGAGCAAGCAAGG + Intergenic
957209505 3:77240592-77240614 GGAGGCACTGAGAGTGAGCAAGG + Intronic
957277384 3:78108242-78108264 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
957362004 3:79173190-79173212 GGAGGCACCGAGAGCGAGTGAGG - Intronic
957560239 3:81812491-81812513 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
957665263 3:83218119-83218141 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
957804989 3:85134369-85134391 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
957885427 3:86282102-86282124 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
957919938 3:86733588-86733610 GGAGGCCCCGAGAGTGAGAGAGG + Intergenic
958548659 3:95589045-95589067 GGAGGCACTGAGAGCGAGCAAGG + Intergenic
958549719 3:95595989-95596011 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
959422666 3:106148479-106148501 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
959462384 3:106643622-106643644 GGAGGTGCCAAGAGTGAGCAAGG - Intergenic
959983128 3:112540607-112540629 GGGAGTACAGAGAGTAAGCAAGG + Intronic
960090996 3:113637904-113637926 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
960114461 3:113879366-113879388 GGAGTATCAGAGACTGAGCAGGG - Intronic
960149883 3:114238798-114238820 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
960150773 3:114246601-114246623 GGAGAAACAGAGAGTGAGAACGG - Intergenic
960272463 3:115689831-115689853 GGAGGCAGAAAGAATAAGCAAGG + Intronic
960282056 3:115791415-115791437 GGAGGAGCAGAGAGCGAGCGAGG - Intergenic
960479465 3:118171250-118171272 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
960487241 3:118269532-118269554 GGAGGCTCCGAGAGCGAGCAAGG - Intergenic
960560115 3:119073908-119073930 GGAGGCGCCAAGAGTGAGCGAGG + Intronic
960685429 3:120289568-120289590 GGAGGCTCCGAGAGCGAGCGAGG - Intergenic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
960868655 3:122227684-122227706 GGAGGCACCGAGAGTGAGTGAGG + Intronic
960954642 3:123023573-123023595 TGAGGCACAGAGAGGGAACTTGG + Intronic
961576641 3:127842246-127842268 GGAGTCACAGAGAGTGGGGCTGG - Intergenic
961648206 3:128403903-128403925 GAAGGCACAGACAGTGAACAAGG - Intronic
961648341 3:128404661-128404683 TGGGGCACAGAGTGTGGGCATGG - Intronic
961659486 3:128461051-128461073 GGGGGCTCAGGGAGTGGGCAGGG - Intergenic
961700872 3:128743431-128743453 GGAGGTGCTGAGAGCGAGCAAGG + Intronic
961807542 3:129500198-129500220 GGAGACACAGAGATTGCACAAGG + Intronic
961943250 3:130658534-130658556 GGAGGCACAGCATGTAAGCATGG - Intronic
962106555 3:132396273-132396295 GGAGGCGCTGAGAGGGAGCGAGG - Intergenic
962177319 3:133167897-133167919 GGAGGCACCGAGAGCGAGTGAGG + Intronic
962234323 3:133694412-133694434 AAAGGCACAGAGAGCGAACAGGG + Intergenic
962361035 3:134742982-134743004 GGAGGGACAGAGACAGAGCCTGG - Intronic
962383844 3:134916868-134916890 GGAGGTACCAAGAGCGAGCAAGG + Intronic
962758175 3:138484508-138484530 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
962827734 3:139112164-139112186 GGAGGCACAAAGTGTGGGCCAGG - Intronic
962848269 3:139289341-139289363 GGAGGCAGAGAGGGAGAGAAGGG + Intronic
962998060 3:140651276-140651298 GGAGGCACCGAGAGTGAGTGAGG - Intergenic
963036862 3:141038021-141038043 GAAGCCACAGAGAGAGAGAAAGG - Intergenic
963266883 3:143248781-143248803 GGAGGCTGAGAGATGGAGCAGGG + Intergenic
963397128 3:144749664-144749686 GGAAGCACCGAGAGCGAGCGAGG - Intergenic
963440331 3:145333246-145333268 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
963533191 3:146497151-146497173 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
963554579 3:146772198-146772220 GGAGGCGCTGAGAGCAAGCAAGG - Intergenic
963583269 3:147153939-147153961 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
963590051 3:147246061-147246083 GGAGGCGCGGAGAGCGAGCGAGG + Intergenic
963743080 3:149098357-149098379 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
963744083 3:149109237-149109259 GGAGGCGCCAAGAGTGAGCAAGG - Intergenic
963862087 3:150322820-150322842 GGAGGCGCAGAGAGCGAGCGAGG - Intergenic
964037465 3:152217156-152217178 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
964063994 3:152559302-152559324 GGAGGCGCTGAGAGCGAGCTAGG - Intergenic
964118051 3:153156228-153156250 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
964130468 3:153281254-153281276 GGAGGCGCGGAGAGCAAGCAAGG - Intergenic
964374976 3:156041171-156041193 GGAGGCACCGAGAGCGAGCGAGG - Intronic
964376189 3:156051630-156051652 GGAGGCACTGAGAGTGAGCGAGG - Intronic
964378456 3:156073013-156073035 GGAGGCGCCGAGAGTGAGCAAGG - Intronic
964394803 3:156234183-156234205 AGAGGAACAGACAGTGAGGAAGG + Intronic
964443925 3:156740430-156740452 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
964452218 3:156823185-156823207 GGAGGCGCCAAGAGCGAGCAAGG + Intergenic
964668881 3:159203689-159203711 GGAGACAGAGGGATTGAGCAAGG + Intronic
964974092 3:162599551-162599573 GGAGGCACCAAGAGCGAGCAAGG - Intergenic
964977683 3:162639923-162639945 GGAGGTGCTGAGAGTGAGCAAGG - Intergenic
964982579 3:162703428-162703450 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
964983224 3:162711018-162711040 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
965003448 3:162987203-162987225 GGAGGCGCCGAGAGCAAGCAAGG - Intergenic
965033836 3:163408591-163408613 GGAGGAAGAGAGAGTGAAGAGGG - Intergenic
965109507 3:164402420-164402442 GGAGGCCCCGAGAGCGAGCAAGG + Intergenic
965139184 3:164814103-164814125 GGAGGCACACAGAGTGAGCAAGG - Intergenic
965139798 3:164818327-164818349 GGAAGCACCAAGAGTGAGCGAGG - Intergenic
965220286 3:165918954-165918976 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
965220960 3:165924783-165924805 GGAGGCACCCAGAGCGAGCGAGG + Intergenic
965256714 3:166423829-166423851 GGAGGTGCCGAGAGTGAGCAAGG - Intergenic
965446398 3:168779993-168780015 GGAGGCCCCGAGAGCGAGCGAGG - Intergenic
965652289 3:170947091-170947113 GGAGGCGCCAAGAGTGAGCGAGG - Intergenic
965744288 3:171907559-171907581 GGAGGTGCCGAGAGCGAGCAAGG + Intronic
966075996 3:175937227-175937249 GGAGGCGCTGAGAGCGAGCAAGG - Intergenic
966183105 3:177204406-177204428 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
966186229 3:177229068-177229090 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
966191095 3:177272235-177272257 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
966336595 3:178874684-178874706 GGAGACAGAGAGAGGGAGAAGGG - Intergenic
966372487 3:179263487-179263509 GGAGGCGCGGAGAGCGAGCGAGG + Intronic
966425526 3:179775994-179776016 GGAGGTGCTGAGAGCGAGCAAGG + Intronic
966887072 3:184382694-184382716 TGTGTCACTGAGAGTGAGCAGGG - Exonic
967100096 3:186209409-186209431 TGAGGCACAGAGATTTAGAAGGG - Intronic
967234179 3:187368077-187368099 GGAGGCTCCGAGAGCGAGCGAGG + Intergenic
967278432 3:187799073-187799095 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
967718265 3:192788884-192788906 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
968276818 3:197446549-197446571 GGGGGCTCAGAGGGTGAGCCTGG + Intergenic
968412875 4:404467-404489 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
968524946 4:1051901-1051923 GCAGGCAGAGAGTGTGTGCAGGG - Intergenic
968591403 4:1461465-1461487 GGATGAACAGAGGGTGAACAAGG + Intergenic
968922990 4:3532199-3532221 GAAGGCCCAGCGAGTGAGCGCGG - Exonic
969017640 4:4115253-4115275 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
969040192 4:4289976-4289998 TGGGGCTCAGAGAGTGAGTAGGG - Intronic
969227007 4:5805215-5805237 AGAGGCACAGTGAGAGGGCAGGG + Intronic
969304643 4:6318671-6318693 GGTGGCAGAGGTAGTGAGCAGGG - Intergenic
969362280 4:6672576-6672598 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
969387333 4:6863040-6863062 GGAGGGACAGAAAGAGAGCCTGG + Exonic
969453276 4:7286928-7286950 AGAGGCAGAGAGAGGGACCAGGG + Intronic
969655050 4:8491917-8491939 GGAGGCACTGAGAGCGAGCGAGG + Intronic
969736350 4:8993356-8993378 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
969801428 4:9568690-9568712 AGAGACACAGAAAGTGAGCCTGG - Intergenic
970108241 4:12609486-12609508 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
970182525 4:13415257-13415279 AGAGGCCCCGAGAGTGAGCAAGG - Intronic
970272049 4:14358518-14358540 GGAGGCGCTGAGAGCGAGCAAGG - Intergenic
970408710 4:15787214-15787236 GGGGGCACTGAGAGCGAGCGAGG + Intronic
970457387 4:16238614-16238636 GGAGGAACAGAGAATGGTCAGGG - Intergenic
970574646 4:17414789-17414811 GGAGGCGCCGACAGGGAGCAAGG + Intergenic
970659071 4:18264253-18264275 GGAGACACAGAGAGTGAAGGGGG + Intergenic
970673241 4:18418846-18418868 GGAGGCGCCGAGAGAGAGCGAGG + Intergenic
970906896 4:21226274-21226296 GGAGACAGAGAGAGAGAGAAAGG + Intronic
971280607 4:25239740-25239762 GGAGGCGCCGAGAGTGAGCGAGG + Intronic
971377199 4:26064488-26064510 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
971413281 4:26398203-26398225 AGAAGCGCAGAGAGTGAGCCTGG + Intronic
971564267 4:28117649-28117671 GGAGGCGCGGAGAGCGAGCGAGG + Intergenic
971639742 4:29117205-29117227 GGAGGCGCCGAGAGCGACCAAGG - Intergenic
971792427 4:31185478-31185500 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
971905271 4:32716733-32716755 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
972034870 4:34507086-34507108 GGAGGTGCGGAGAGTGAGCGAGG + Intergenic
972061708 4:34882665-34882687 GGAGGAAGAGAGAGAGAGCGTGG + Intergenic
972125306 4:35758257-35758279 GGAGGTAGAGAAAGAGAGCAGGG - Intergenic
972392479 4:38626757-38626779 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
972505857 4:39719010-39719032 GGAGGCACCAAGAGTGAGCAAGG + Intronic
972571450 4:40314028-40314050 GGAGACAGAGAGAGAGAGCTGGG + Intergenic
972574426 4:40338823-40338845 AGAGACAGAGAGAGCGAGCACGG - Intronic
972878778 4:43397650-43397672 TGAAGCACAGAGAGAGAGGAAGG - Intergenic
972890400 4:43551066-43551088 GGAGGCGCCAAGAGTGAGCAAGG - Intergenic
972998291 4:44911564-44911586 TTAGGAACAGAGACTGAGCAGGG + Intergenic
973037024 4:45420015-45420037 GGAGGCCCCGAGAGCGAGCAAGG - Intergenic
973041873 4:45477858-45477880 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
973587836 4:52410253-52410275 GGAGGTGCCGACAGTGAGCAAGG + Intergenic
973684418 4:53354584-53354606 GGAGGCACTGAGAGCGAGCAAGG + Intronic
973878051 4:55241355-55241377 GGAGGCACCAAGAATGAGCAAGG - Intergenic
973934361 4:55828079-55828101 GGAGGCAGAGAGAGTGACTAAGG - Intergenic
974089957 4:57300677-57300699 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
974129035 4:57730286-57730308 TGAGGCGCCGAGAGTGAGCGAGG + Intergenic
974129052 4:57730398-57730420 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
974147636 4:57967046-57967068 GGAGGCACTGAGAGCGAGCGAGG - Intergenic
974186723 4:58456780-58456802 GGAGGCACTGAGAGCGAGCAGGG - Intergenic
974187945 4:58464974-58464996 GGAGGCACTGAGAGCAAGCAAGG - Intergenic
974374773 4:61062117-61062139 GGAGGCAGAGAGAGAGAGAGAGG + Intergenic
974484868 4:62492404-62492426 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
974743087 4:66032969-66032991 GGGGGCACGGAGAGTGAGGATGG + Intergenic
974781825 4:66561989-66562011 GGAGGCGCCAAGAGCGAGCAAGG + Intergenic
974838301 4:67275751-67275773 GGAGGCACCGAGATTGAGCAAGG + Intergenic
974839860 4:67287204-67287226 GGAGGTGCCGAGAGTGAGCAAGG + Intergenic
974887107 4:67833309-67833331 GGAGGCACTGAGGCTGAGGAGGG - Exonic
975055330 4:69923744-69923766 GGAGGCGCAGAGAGCGAGCGAGG - Intergenic
975342667 4:73258884-73258906 GGAGGGAGAGGGAGGGAGCAAGG + Intergenic
975390789 4:73814952-73814974 GGAGGCAAAGAGAATGAGGTAGG + Intergenic
975754751 4:77561740-77561762 GGAGGTGCTGAGAGTGGGCAAGG - Intronic
976042185 4:80899787-80899809 TGAGGCAGAGAGAGTAAGCCAGG - Intronic
976102422 4:81580303-81580325 GGAGGCACTGAGAGCGAGCAAGG - Intronic
976406307 4:84664570-84664592 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
976597063 4:86904417-86904439 GGAGGCGCGGAGAGTGAGCGAGG + Intronic
976597599 4:86908640-86908662 GGAGGGAGAGAGAGAGAGTAAGG - Intronic
976736361 4:88313653-88313675 GGAGGCGTGGAGAGTGAGCAAGG + Intergenic
976741309 4:88360376-88360398 GGAGGCGCCAAGAGCGAGCAAGG - Intergenic
976850820 4:89542457-89542479 GGAGCCATAGAGACTGAGCTGGG - Intergenic
977021135 4:91761572-91761594 GGAGCAAGAGAGAGTGAGCAGGG + Intergenic
977206436 4:94169693-94169715 GGAGGCGCCGGGAGTGAGCGAGG - Intergenic
977370351 4:96126568-96126590 GGAGGCGCCGAGAGTGAGTGAGG + Intergenic
977400000 4:96520976-96520998 GGAGGCACCGAGAGTGAGTGAGG - Intergenic
977416607 4:96742430-96742452 GGAGGCAACAAGAGTGAGCGAGG - Intergenic
977470772 4:97438592-97438614 GGAGGTGCTGAGAGTGAGCAAGG + Intronic
977607004 4:98993989-98994011 GGAGGCACCGAGAGCAAGCAAGG + Intergenic
977717427 4:100197028-100197050 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
977885840 4:102250794-102250816 GGAGGCACCCAGAGCGAGCCAGG + Intergenic
977895287 4:102357689-102357711 GGGGAGAGAGAGAGTGAGCAGGG + Intronic
977989069 4:103419681-103419703 GGCGGGAGAGAGAGAGAGCAAGG + Intergenic
978241960 4:106525851-106525873 GGAGGCGCTGAGAGCGAGCAAGG + Intergenic
978254961 4:106681962-106681984 GGAGGCACTGAGAGCGATCGAGG + Intergenic
978466181 4:109012326-109012348 GGAAGTGCTGAGAGTGAGCAAGG - Intronic
978620997 4:110634106-110634128 GGAGGCACAGAGGCGGGGCAGGG + Intronic
978809015 4:112830658-112830680 GGAGGTGCCGAGAGCGAGCAAGG - Intronic
978918050 4:114149065-114149087 GGAGGCGCCCAGAGTGAGCCAGG + Intergenic
979143928 4:117216374-117216396 GGAGAGAGAGAGAGTGAGCAGGG - Intergenic
979688503 4:123537770-123537792 GGAGGCGCGGAGAATGAGCGAGG - Intergenic
979822477 4:125191803-125191825 GGAGGCGCCAAGAGCGAGCAAGG - Intergenic
979825784 4:125230097-125230119 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
979829281 4:125280803-125280825 GCAGGCGCAGAGAGCGAGCCAGG - Intergenic
979899795 4:126201798-126201820 GGAGGCGCCGAGAGCAAGCAAGG + Intergenic
979920388 4:126489872-126489894 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
979949581 4:126874945-126874967 GGAGGTGCCGAGAGTAAGCAAGG + Intergenic
979951458 4:126898387-126898409 AGAGAGAGAGAGAGTGAGCAGGG + Intergenic
980043462 4:127964745-127964767 GGAGGCCTGGAGAGCGAGCAAGG + Intronic
980052013 4:128048066-128048088 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
980115142 4:128672515-128672537 GGAGGCGCGGAGAGTGAGTGAGG - Intergenic
980230327 4:130039050-130039072 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
980328381 4:131379216-131379238 GGAGGAGCAGAGAGCGAGCAAGG - Intergenic
980595510 4:134948658-134948680 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
980698672 4:136395200-136395222 GGAGGCACTGAGAGCGAGCAAGG - Intergenic
980711412 4:136573297-136573319 GGAGGAAGAGAGAGAGAGAAGGG - Intergenic
980761652 4:137241430-137241452 GGAGCCAGAGAGAGCGAGCAGGG - Intergenic
980774415 4:137420871-137420893 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
980799687 4:137733589-137733611 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
981136124 4:141213405-141213427 GGAGGCGTTGAGAGAGAGCAAGG - Intergenic
981169624 4:141605847-141605869 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
981777423 4:148386007-148386029 GGAGGCACAGACAGGGATAAGGG + Intronic
982024273 4:151236098-151236120 GGAGGCACCAAGAGTGAACGAGG - Intronic
982293739 4:153806120-153806142 GGAGGCGCTGAGAGCGAGCCAGG - Intergenic
982432539 4:155338943-155338965 GGAGAGAAAGAGAGAGAGCAGGG - Intergenic
982630177 4:157821858-157821880 GGAGGCGCGGAGAGTGAGCGAGG - Intergenic
982647603 4:158044024-158044046 GGAGGCAGCGAGAGTGAGTGAGG - Intergenic
982700649 4:158657342-158657364 GGAGGCACCGAGAGCAAGCCAGG - Intergenic
982863304 4:160481622-160481644 GGAGGCGCTGAGAGCGAGCCAGG - Intergenic
982868887 4:160550628-160550650 GGAGGCACGGAGAGCGAGTGAGG + Intergenic
982921192 4:161277095-161277117 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
982985683 4:162203441-162203463 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
983026019 4:162739393-162739415 GGAGGCGCGGAGAGTGAGCCAGG - Intergenic
983060263 4:163152698-163152720 GGAGGCGCGGAGAGTGAGCCAGG - Intronic
983134874 4:164068248-164068270 GGAGGTGCCGAGAGTGAGCGAGG - Intronic
983230738 4:165126445-165126467 GGAGGCGCGGAGAGTGAGCGAGG + Intronic
983290730 4:165799894-165799916 GGAGGCTCCCAGAGCGAGCAAGG + Intergenic
983656661 4:170091083-170091105 GGAGGCGCCAAGAGTGAGCGAGG - Intronic
984266080 4:177499525-177499547 GGAGGCACCGAGAGTGAGCAAGG - Intergenic
984728586 4:183044930-183044952 GGAGGCGCCGAGAGTGAGCAAGG - Intergenic
984805422 4:183746947-183746969 GGAGGCACCGAGAGGGAGCGAGG + Intergenic
984918031 4:184741060-184741082 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
984948805 4:184990596-184990618 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
985145353 4:186889968-186889990 GGAGGCGCCGAGAGCGAGCGTGG - Intergenic
985210555 4:187588136-187588158 GGAGGAACAGAGATTTATCAAGG + Intergenic
985269228 4:188178831-188178853 GGAGGCACTGAGAGCGAGCGAGG - Intergenic
985412170 4:189696162-189696184 GGAGGCACAGAGAGCGAGCCAGG + Intergenic
985423618 4:189807396-189807418 GGAGGCGCCCAGAGCGAGCAAGG + Intergenic
985590816 5:764239-764261 GGAGGTGCCGAGAGTGAGCGAGG - Intronic
985668293 5:1193096-1193118 GGAGGGACAGGCCGTGAGCAGGG + Intergenic
986124864 5:4875530-4875552 GGAGGAAGAGAGACAGAGCAAGG + Intergenic
986127200 5:4894095-4894117 GGATGCACAGGGAGTAAGCTAGG + Intergenic
986223217 5:5789048-5789070 GCATGCACAGAGAGAGAGAAAGG + Intergenic
986370667 5:7077334-7077356 GGAAGCACTGAGAGTGAGCCTGG - Intergenic
986483465 5:8212368-8212390 TGAGGCAGAGTCAGTGAGCATGG - Intergenic
986579342 5:9248726-9248748 GGAGGCAGAGATAGTGATGAAGG + Intronic
986626088 5:9725164-9725186 GGAGGCGCCCAGAGCGAGCAAGG - Intergenic
986802879 5:11279807-11279829 GGAGCAAGAGAGAGAGAGCATGG + Intronic
986912609 5:12574982-12575004 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
986918956 5:12661760-12661782 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
987384090 5:17312280-17312302 GGAGGCGCTAAGAGAGAGCAAGG + Intergenic
987488894 5:18552191-18552213 GGAGGCACCAAGAGTGAGTGAGG + Intergenic
987543752 5:19287597-19287619 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
987872258 5:23635846-23635868 GGAGGGAAAGAGAGTAAGCATGG + Intergenic
987896216 5:23951129-23951151 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
988020591 5:25615064-25615086 GGAGGTGCTGAGAGTGAGCGAGG + Intergenic
988201856 5:28078160-28078182 AGAGGCACCGAGAGCGAGCGAGG + Intergenic
988279629 5:29128130-29128152 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
988291826 5:29296942-29296964 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
988369168 5:30345581-30345603 GGAGGCGCCGAGAGCGAACAAGG - Intergenic
988591456 5:32553276-32553298 GGAAGCACCGAGAGTGAGCGAGG + Intronic
988606000 5:32678782-32678804 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
988883514 5:35531479-35531501 GGAGGTGCCGAGAGCGAGCAAGG - Intergenic
989003128 5:36782434-36782456 AGAGGCACCAAGAGTGAGCGAGG - Intergenic
989777313 5:45225486-45225508 GGAGTCATGGAGAGTGAGCGAGG - Intergenic
989950509 5:50292708-50292730 GGAGGTGCCGAGAGTGAGCAAGG - Intergenic
989957861 5:50376685-50376707 GGAGGTGCCGAGAGTGAGCGTGG - Intergenic
989965752 5:50464867-50464889 GGAGGCACTGAGAGGGAACGAGG - Intergenic
990490002 5:56295205-56295227 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
990510791 5:56487650-56487672 GGAGGTGCTGAGAGCGAGCAAGG - Intergenic
990512228 5:56499163-56499185 GGAGGCACTGAGAGTGAGTGAGG + Intergenic
990665785 5:58069617-58069639 GGAGGCACCAAGAGCGAGCAAGG + Intergenic
990869397 5:60415308-60415330 GGAGGCGCTGAGAGCCAGCAAGG - Intronic
990880152 5:60530172-60530194 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
991214867 5:64149933-64149955 GGAGGCACCGAGAGTGAGAGAGG - Intergenic
992048788 5:72925344-72925366 GGAGGCGCCGAGAGTGAGGGAGG - Intergenic
992277097 5:75131287-75131309 GGAGGCACCGAGAGCGAGCGAGG + Intronic
992947369 5:81823575-81823597 GGAGGCACCGAGAGCAAGCGAGG - Intergenic
993068866 5:83133802-83133824 GGAGGCACCAAGAGCAAGCAAGG - Intronic
993328657 5:86570031-86570053 GGAGGCGCCGAGAGCGAGCCAGG + Intergenic
993678674 5:90847966-90847988 GGAGGCACCGAGAGTGAGCGAGG + Intronic
993803616 5:92375391-92375413 GAAGGCACCGAGAGTGAGCGAGG + Intergenic
994210858 5:97085740-97085762 GGAGGCGCCAAGAGCGAGCAAGG + Intergenic
994229893 5:97301001-97301023 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
994251604 5:97542386-97542408 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
994254869 5:97580500-97580522 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
994451389 5:99949469-99949491 GGAGGCACAGAGGCAGATCAAGG - Intergenic
994507027 5:100656616-100656638 GGAGGCACTGAGAGCTAGCGAGG - Intergenic
994570229 5:101505880-101505902 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
994647828 5:102491854-102491876 GGAGGTGCAGAGAGCGAGCGAGG + Intronic
994932508 5:106206552-106206574 GGAGGCGCAGAGAGTGAGTGAGG + Intergenic
994935219 5:106246115-106246137 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
995112449 5:108442546-108442568 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
995608868 5:113888566-113888588 GGAGGGTCTGGGAGTGAGCATGG - Intergenic
995656432 5:114432534-114432556 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
995678837 5:114695308-114695330 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
995722532 5:115151493-115151515 GGAGGAACAGGCAGTGGGCAGGG - Intronic
995975740 5:118033648-118033670 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
996106971 5:119516957-119516979 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
996221320 5:120936672-120936694 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
996575965 5:124976606-124976628 GGAGGTGCCGAGAGTGAGCGAGG + Intergenic
996585922 5:125088559-125088581 GGAGGCACTGAGAGCGAGTGAGG - Intergenic
996679900 5:126220773-126220795 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
996792873 5:127312100-127312122 GGAGGCACAGTGAGAGAGGAAGG - Intronic
997099868 5:130957288-130957310 GGAGAGAGAGAGAGAGAGCAGGG - Intergenic
997352140 5:133238844-133238866 GGAGGCTCCGAGAGCGAGCAAGG - Intronic
997375428 5:133394206-133394228 GGAGGCGCCAAGAGTGAGCAAGG - Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997428289 5:133819373-133819395 GGAGGAGCAGGGTGTGAGCAGGG - Intergenic
997758269 5:136420778-136420800 GGAGGGACAGAGTGAGAGGATGG - Intergenic
997760481 5:136444066-136444088 GGAGGTGCCGAGAGAGAGCAAGG - Intergenic
998691689 5:144594985-144595007 GGAGGCACCAAGGGTGAGCAAGG - Intergenic
998885710 5:146691749-146691771 TGGAGCACAGTGAGTGAGCAGGG - Intronic
999231785 5:150066033-150066055 GGTGGCCCCGAGAGTGAGTAAGG + Intronic
999677119 5:154015238-154015260 AGAGGAACAGGCAGTGAGCAGGG - Intronic
999737451 5:154523374-154523396 GGAGGGACTGAGAGTCAGAAGGG - Intergenic
999855357 5:155587258-155587280 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
999957857 5:156721714-156721736 GAAGACCCAGAGTGTGAGCAAGG + Intronic
1000065959 5:157693692-157693714 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1000212295 5:159119026-159119048 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1000329267 5:160194414-160194436 GGAGGCCCCGAGAGTGAGCGAGG + Intronic
1000342702 5:160289717-160289739 GGAGAGACAGAGAGGCAGCAGGG + Intronic
1000432427 5:161166610-161166632 GGAGGCGCGGAGAGTGAGCGAGG + Intergenic
1000547536 5:162621696-162621718 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
1000889373 5:166784953-166784975 GGAGGCACCAAGAGCGAGCAAGG + Intergenic
1000891895 5:166810703-166810725 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1000902557 5:166927454-166927476 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1000903614 5:166936727-166936749 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
1001080657 5:168664951-168664973 GGAGGGAGAAGGAGTGAGCAAGG + Intronic
1001128771 5:169046033-169046055 GGAGTCACACAGACTGAACAGGG + Intronic
1001437545 5:171712019-171712041 GGAGGCAGGGAGAGCAAGCAGGG - Intergenic
1001841466 5:174880516-174880538 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1002004711 5:176222532-176222554 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1002078048 5:176721070-176721092 GGAGGCACCAAGAGCGAGCGAGG - Intergenic
1002089497 5:176796138-176796160 TGAGCCACAGAGACTGTGCATGG + Intergenic
1002400944 5:178991327-178991349 GGAGGCAGGGAGAGTGTGTAAGG + Intronic
1002556591 5:180046346-180046368 GGAGGCACCGAGAGCGAGCAGGG + Intronic
1002616368 5:180459027-180459049 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1002681681 5:180969877-180969899 GGAAGCACTGAGAGCGAGCACGG + Intergenic
1002698340 5:181104922-181104944 GGTGGCAGACAGAGTGAGCAGGG + Intergenic
1002708558 5:181179986-181180008 GGTGGCAGACAGAGTGAGCAGGG - Intergenic
1002757940 6:179426-179448 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
1002790803 6:436047-436069 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1003048994 6:2763775-2763797 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1003170927 6:3721272-3721294 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1003284925 6:4725810-4725832 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1003488165 6:6597361-6597383 GAAGGCACAGAACGGGAGCAGGG + Intronic
1003506754 6:6746181-6746203 GGAGGCGCGGAGAGTGTGTAAGG + Intergenic
1003508912 6:6762987-6763009 GGAGGCGCCGAGAGGGAGCGAGG + Intergenic
1003577963 6:7315071-7315093 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1003578367 6:7317241-7317263 GGAGGCCCCCAGAGCGAGCAAGG + Intronic
1003747931 6:9024131-9024153 GGAGGCGCCGAGAGCGAGCTAGG - Intergenic
1003770237 6:9290943-9290965 GGAGGCGCCGAGAGGGAGCGAGG + Intergenic
1003956597 6:11170927-11170949 GGAGGTGCTGAGAGTGAGCGAGG - Intergenic
1003982547 6:11403089-11403111 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1003984790 6:11424918-11424940 AGAAGCACAGGGACTGAGCAGGG - Intergenic
1004036879 6:11932878-11932900 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1004053234 6:12108897-12108919 GGAGGCGCCGAGAGGGAGCGAGG + Intronic
1004167641 6:13270968-13270990 AGAGAGAGAGAGAGTGAGCAGGG + Intronic
1004200196 6:13541393-13541415 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1004217511 6:13716604-13716626 GGAGGCACCCAGAGTGAGCGAGG - Intergenic
1004220539 6:13743057-13743079 GGAGGCACCGAGAGCGAACGAGG - Intergenic
1004233775 6:13855222-13855244 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1004248387 6:14002280-14002302 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1004452463 6:15759265-15759287 GGAGGCGCCGAGAGTGAGCAAGG + Intergenic
1004486346 6:16069694-16069716 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1004607436 6:17206910-17206932 GGAGGCGCTGAGAGTGAGCGAGG + Intergenic
1004689166 6:17976695-17976717 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1004811748 6:19270637-19270659 GGAGGCACTGAGAGCAAGCGAGG - Intergenic
1004861450 6:19807475-19807497 GGAGGCGACGAGAGCGAGCAAGG + Intergenic
1004907005 6:20245277-20245299 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1004908450 6:20259424-20259446 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1004912560 6:20301115-20301137 GGAGGCGCAGAGAGCGAGCGAGG - Intergenic
1005042337 6:21610368-21610390 GGAGGCCCCGAGAGCAAGCAAGG + Intergenic
1005114344 6:22318908-22318930 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1005197842 6:23309867-23309889 GGAGAGACAGAAAGTGAGCCAGG + Intergenic
1005561365 6:27045139-27045161 CGAGGCACCGAGAGTGAGCGAGG - Intergenic
1005596288 6:27381565-27381587 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1005600953 6:27425335-27425357 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1005725131 6:28640249-28640271 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1005752375 6:28895543-28895565 TGAGACACAGAGTGTGAGCCTGG + Intergenic
1005766245 6:29014977-29014999 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
1006005698 6:31000329-31000351 GGAGGCGCTGAGAGCGAGCAAGG - Intergenic
1006007743 6:31016645-31016667 GGAGGCTCCGAGACTGAGCGAGG - Intronic
1006118063 6:31785748-31785770 GGAGGACCAGAGGGTGAGCCAGG + Intronic
1006127888 6:31851911-31851933 GGAGGCGCCGAGAGCCAGCAAGG - Intergenic
1006221498 6:32495658-32495680 GGAGGCGCCGCGAGTGAGCAAGG + Intergenic
1006267057 6:32934420-32934442 GGAGTCACAGAGTATGGGCAAGG - Intergenic
1006947086 6:37791744-37791766 TGAGGCACAGAGGGTGGCCAGGG - Intergenic
1006978439 6:38124826-38124848 GGAGGCGCCAAGAGTGAGCGAGG + Intronic
1007104095 6:39271600-39271622 AGAGACACAGAGAGAGAGAAAGG - Intergenic
1007358119 6:41335482-41335504 GGCAGCACACAGAGGGAGCAAGG + Intergenic
1007738658 6:43997951-43997973 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1007791616 6:44312266-44312288 GGAAGCACATAGAGTGGGGAGGG + Intronic
1008038705 6:46774453-46774475 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1008230867 6:48983968-48983990 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1008270264 6:49482330-49482352 GGAGGCGCCGAGAGTGAGCGAGG + Intronic
1008270565 6:49483924-49483946 GGAGGCGCCAGGAGTGAGCAAGG + Intronic
1008284421 6:49630056-49630078 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1008567763 6:52786367-52786389 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1008587547 6:52962937-52962959 GAAGGCACTGAGAGTGAGCAAGG + Intergenic
1008844768 6:55950163-55950185 GGAGGCACTGAGAGTGAGTGAGG - Intergenic
1009407174 6:63326961-63326983 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1009587575 6:65627380-65627402 GGAGGCACCGAGAGCGAGCGAGG - Intronic
1009615562 6:65999869-65999891 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1009664391 6:66655869-66655891 GGAGGCGCCGAGAGAGAGCAAGG + Intergenic
1009685257 6:66949069-66949091 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
1009739209 6:67722902-67722924 GGAGGTGCCGAGAGTGAGCAAGG - Intergenic
1009873104 6:69472935-69472957 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1010235727 6:73573043-73573065 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1010251060 6:73707502-73707524 GGAGGCACAGTGGGTTAGAATGG + Intronic
1010269277 6:73903013-73903035 GGAGGCGCTGAGAGTGAGCCAGG - Intergenic
1010278019 6:73991137-73991159 GGAGGCACCAAGAGCGAGCGAGG + Intergenic
1010450261 6:75994588-75994610 GCAGGCATAGAGAGAGAGCTTGG + Intronic
1010624608 6:78122115-78122137 GGAGGAACAGAGAGGAGGCATGG + Intergenic
1011129395 6:84037946-84037968 GGAGGTGCTGAGAGTGAGCGAGG + Intronic
1011161858 6:84399916-84399938 GGTGGGGCAGAGAGTGAGAATGG + Intergenic
1011264467 6:85500526-85500548 GGAGCAAGAGAGAGAGAGCAGGG - Intergenic
1011410397 6:87060264-87060286 GGAGGCACCGAGAGCCAGCGAGG + Intergenic
1012789751 6:103677639-103677661 GGAGGCTCCGAGAGCAAGCAAGG + Intergenic
1012850917 6:104446189-104446211 GGAGGCACGGAGAGCGAGCGAGG - Intergenic
1013025799 6:106269910-106269932 GGAGACGCCGAGAGCGAGCAAGG + Intronic
1013059149 6:106615041-106615063 GGAGGCAAGGAGAGTGAGAGTGG - Intronic
1013410862 6:109881674-109881696 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1013694893 6:112689898-112689920 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1013853410 6:114542190-114542212 GGAGGCATTGAGAGTGAGTGAGG + Intergenic
1014280733 6:119440853-119440875 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1014299624 6:119665533-119665555 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1014302956 6:119706452-119706474 GGGGGCACAGAGAGAGGTCAGGG - Intergenic
1014507684 6:122280434-122280456 GGAGGCGCCGAGAGCGAGGAGGG - Intergenic
1014921153 6:127215098-127215120 GGAGGCGCCGAGAGGGAGCGAGG + Intergenic
1015465953 6:133548921-133548943 GGAAGCACAGAGGGTAAGGAGGG + Intergenic
1015600268 6:134904584-134904606 GGAGGCACCGAGAGCGAGTGAGG - Intergenic
1016104808 6:140148627-140148649 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
1016183456 6:141174958-141174980 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1016482392 6:144495650-144495672 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1016785805 6:148010019-148010041 GGAGAGAGAGAGAGAGAGCAGGG - Intergenic
1016859132 6:148699088-148699110 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
1017017853 6:150116139-150116161 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1017581299 6:155867262-155867284 GGAGGCGCGGAGAGCAAGCAAGG + Intergenic
1017630619 6:156392987-156393009 GGAGAGAGAGAGAGTGAGCATGG - Intergenic
1017839584 6:158210295-158210317 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1017870265 6:158480980-158481002 AGAGGGAAAGAGAGTGGGCACGG - Intronic
1017913345 6:158813927-158813949 GAAGGCATGGGGAGTGAGCAAGG - Intronic
1018109473 6:160520775-160520797 GGAGGCGCCCAGAGTGAGCGAGG + Intergenic
1018412117 6:163560522-163560544 AGAGGGGCAGAGAGTGCGCAGGG + Intronic
1018545597 6:164933153-164933175 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1018624726 6:165765793-165765815 GGAGGCACCCAGAGTGAGCGAGG + Intronic
1018869489 6:167770254-167770276 GGAGACACATAGGGTGAGAAAGG - Intergenic
1019127046 6:169847527-169847549 GGAGGAAGAGAGAGAGAGAAGGG - Intergenic
1019295538 7:272130-272152 GGAGGAGCAGGGAGGGAGCACGG + Intergenic
1019572819 7:1720954-1720976 TGAGGCACAGAGAGAGTGCAAGG - Intronic
1019965825 7:4497433-4497455 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1020046423 7:5044381-5044403 GGAGGAAAAGAGAGAGAGGAAGG - Intronic
1020098471 7:5381254-5381276 GGAGGGCCACAGAGTGAGGAGGG - Intronic
1020382822 7:7565681-7565703 AGTGGCACGGAGAGTGGGCATGG - Intergenic
1020552350 7:9621953-9621975 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1021065830 7:16171080-16171102 GGAGGCACTGAGAGCGAGTGAGG + Intronic
1021513889 7:21461752-21461774 GGAGGCACCGAGAGTGAGCCAGG + Intronic
1021567959 7:22032831-22032853 GGAGGCACCAAGAGTGAGAGAGG + Intergenic
1021702363 7:23331981-23332003 GGAGGGAGAGAGAGAGAGTAAGG + Intronic
1021761360 7:23905220-23905242 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1022174209 7:27857516-27857538 GGAGGCGCCGAGAGCGAGCTAGG + Intronic
1022957275 7:35392651-35392673 GGAGGGACAGACGGGGAGCAGGG + Intergenic
1023127871 7:36973597-36973619 GGAGTCACCGAGAGCGAGCGAGG - Intronic
1023267117 7:38418346-38418368 GGAGGCAGAGACAGAGAGAAAGG + Intronic
1023377925 7:39577296-39577318 GGAGGCACCTAGAGTGAGAGAGG - Intronic
1023396283 7:39754445-39754467 GGAGGCACCGAGAGCGAGCGAGG + Intergenic
1023741715 7:43287189-43287211 ATAGGGAAAGAGAGTGAGCATGG + Intronic
1024048395 7:45600813-45600835 GGAGACACAGAGAGACACCAAGG - Intronic
1024226648 7:47330629-47330651 GGAGGAACAGAGGGAGAGAAGGG + Intronic
1024349844 7:48352505-48352527 GGAGCCACCGACAGTGAGAAGGG + Intronic
1024461211 7:49661550-49661572 GAAGGCAGAGAGTGTGAGAATGG - Intergenic
1024465826 7:49711107-49711129 GGAGGCACCTAGAGCGAGCGAGG - Intergenic
1024691196 7:51805688-51805710 GGAGGTGCCGAGAGCGAGCAAGG - Intergenic
1024748272 7:52431746-52431768 GGAGGCGCTGAGAGGGAGCAAGG + Intergenic
1024825500 7:53385669-53385691 GGAGGCACAGAGAGCGAGCAAGG + Intergenic
1025962149 7:66231847-66231869 GGAGGCGCCCAGAGCGAGCAAGG + Intronic
1026055465 7:66979920-66979942 GGAGGCATGGAGAGTTTGCAAGG - Intergenic
1026098410 7:67365018-67365040 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
1026335819 7:69393682-69393704 GGAGGCGCTGAGAGCGAGCGAGG - Intergenic
1026512265 7:71037447-71037469 GGAGGCCCCGAGAGCGAGCGGGG - Intergenic
1026806339 7:73431454-73431476 GGAGGCACAGAAACTGACCGAGG - Intergenic
1027159903 7:75794735-75794757 GGAGGCACAGTGTGTTAGGAGGG + Intergenic
1027238087 7:76309943-76309965 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1027579792 7:79978116-79978138 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
1027667606 7:81057983-81058005 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1027698362 7:81437595-81437617 GGAGGCACCTAGAGCGAGCGAGG + Intergenic
1027778885 7:82499467-82499489 GGAGGTGCCGAGAGCGAGCAAGG - Intergenic
1027868018 7:83673171-83673193 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1027955967 7:84880422-84880444 GGAGGCCCGGAGAGCGAGCGTGG - Intergenic
1028070011 7:86440420-86440442 GGAGGCGCAGAGAGCTAGCGAGG - Intergenic
1028134277 7:87210001-87210023 GGGGGGACAGAGAGAGAGGAGGG + Intronic
1028303368 7:89229235-89229257 GGAGGCGCTGAGAGTGAGCGAGG + Intronic
1028558107 7:92143832-92143854 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1028778246 7:94705348-94705370 GGAGGCCCCGAGAGTGAGCGAGG - Intergenic
1028852601 7:95552973-95552995 GGAGGCCCCGAGAGTGAGCGAGG + Intergenic
1029034235 7:97502222-97502244 GAAGGCAAAGAAAGAGAGCAGGG - Intergenic
1029076082 7:97935783-97935805 GGAGGCACTGAGAGCGAGCGAGG - Intergenic
1029371743 7:100154930-100154952 GGAGGCACAGCCCGGGAGCAGGG + Exonic
1029903886 7:104071643-104071665 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1029988087 7:104940010-104940032 GGAGGCGCCGAGAGTGAGCAAGG - Intergenic
1030367091 7:108657723-108657745 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1030381063 7:108812581-108812603 GGAGAGACAGAGAGTGAAGAGGG - Intergenic
1030481104 7:110104695-110104717 TGAGACACAGACAGAGAGCATGG - Intergenic
1030542102 7:110843870-110843892 GGAGGCAGAGAGGGTGGCCAGGG + Intronic
1030600061 7:111582450-111582472 GGAGGCGCCCAGAGCGAGCAAGG + Intergenic
1030772287 7:113488633-113488655 GGAGGTGCAGAGAGTGAGAGAGG + Intergenic
1030886686 7:114947287-114947309 GGAGGAAAAGACATTGAGCAAGG - Intronic
1031056613 7:116998505-116998527 GGAGGTGCCGAGAGTGAGCAAGG + Intronic
1031109894 7:117596001-117596023 GGAGGCCCTGAGAGTGAGCGAGG - Intronic
1031253208 7:119413835-119413857 GGAGGCGCCGAGAACGAGCAAGG + Intergenic
1031265698 7:119577429-119577451 GGAGACAGAGAGAGTGAGCGAGG + Intergenic
1031373102 7:120991587-120991609 GGAATCACACAGAGTGAACAAGG - Intronic
1031513384 7:122674337-122674359 GGAGGCACCAAGAGCGAGCAAGG + Intronic
1031544573 7:123035429-123035451 GGAGGCACTGAATGTGAGTAGGG + Intergenic
1031605597 7:123763678-123763700 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1031902793 7:127429017-127429039 GGAGGCACCAAGAGTGAGCGAGG - Intronic
1032204596 7:129850867-129850889 GGAGGGACAGAGAGAGAGAAAGG + Intronic
1032525040 7:132573643-132573665 GAAGGCACAGAGAAGGAGAAAGG + Intronic
1032561686 7:132899114-132899136 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1032611820 7:133423642-133423664 GGAGGCACAGAGAGCGACCGAGG - Intronic
1032802522 7:135328302-135328324 GGAAGCACATAGAAAGAGCAAGG + Intergenic
1033065004 7:138146016-138146038 GGAGGCGCCTAGAGCGAGCAAGG - Intergenic
1033312509 7:140271812-140271834 GGAGGCGCGGAGAGTGAGGGAGG + Intergenic
1033394160 7:140957451-140957473 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1033758669 7:144418405-144418427 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
1033759620 7:144424546-144424568 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1033839996 7:145361142-145361164 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1034037526 7:147840154-147840176 GGAGGCTCAGAAAGGGAGGAGGG + Intronic
1034352568 7:150426860-150426882 GGAGGCACAGAGGTTGTGAAAGG + Intergenic
1034435535 7:151061234-151061256 GAAGGCACAGAAGGTGGGCATGG - Intronic
1034531280 7:151697664-151697686 GGGGGCACAGAGAATGGGCACGG + Intronic
1034539733 7:151749367-151749389 GGAAGCAGAGAGAGTGAGGGAGG - Intronic
1034632215 7:152539367-152539389 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1034717051 7:153253096-153253118 GTAGGCACAGAGAGTGGGTAGGG - Intergenic
1034967189 7:155398656-155398678 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1035154246 7:156899266-156899288 TGAGGGGCAGAGAGTGAGCTTGG - Intergenic
1035325343 7:158062424-158062446 GGAGGTGCTGAGAGTGAGCGAGG - Intronic
1035470694 7:159106940-159106962 GGAGGTACAGAGAGAGGCCAGGG + Intronic
1035714792 8:1745703-1745725 AGAGGCCCAGTGAGTGACCAAGG + Intergenic
1035833834 8:2727688-2727710 GGAGGCGCGGAGAGCGAGCCAGG - Intergenic
1035999166 8:4582680-4582702 GGAGGCGCCGAGAGCGAGCGAGG - Intronic
1036441113 8:8781898-8781920 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1036488152 8:9198769-9198791 GGAAGCACAGAGGCTGAGCCTGG + Intergenic
1036546078 8:9771266-9771288 GGAGGAAGAGAGAGCGAGGAAGG + Intronic
1036546171 8:9771720-9771742 GAAGGAACAGGGAGTGAGAAAGG + Intronic
1036801293 8:11794658-11794680 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1036815859 8:11902474-11902496 GGAGGCGGAGAGAGTGGGGAGGG + Intergenic
1036831302 8:12022515-12022537 GGAGGCACCGAGAGCGAGCAAGG - Intergenic
1036837582 8:12088615-12088637 GGAGGCACTGAGAGCAAGCGAGG - Intergenic
1036859376 8:12334863-12334885 GGAGGCACTGAGAGCAAGCGAGG - Intergenic
1036952590 8:13154707-13154729 GGAGGCGCCGAGAGCGAGCGAGG + Intronic
1037127779 8:15371518-15371540 GGAGGGACAGGAAGAGAGCATGG - Intergenic
1037558884 8:20054644-20054666 GGAGGCACCCAGAGTGAGCGAGG - Intergenic
1037676216 8:21052864-21052886 GGAGCAAGAGAGAGTGAGCAGGG + Intergenic
1037813305 8:22099044-22099066 AGAGGCACACACGGTGAGCAGGG + Exonic
1037957633 8:23071295-23071317 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1038726629 8:30087995-30088017 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1038847678 8:31244613-31244635 GGAGGCGCCAAGAGTGAGCGAGG + Intergenic
1039068659 8:33631531-33631553 GGAGGCACCAAGAGGGAGCAAGG - Intergenic
1039284790 8:36028679-36028701 GGAGGCACCAAGAGTGAGTGAGG - Intergenic
1039412562 8:37367266-37367288 GGAGCCTCAGCGAGAGAGCAGGG - Intergenic
1039579498 8:38652251-38652273 GGAGCCAGAGAGAATGAGAAGGG - Intergenic
1039587538 8:38719718-38719740 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1039637222 8:39179967-39179989 GGAGGCACCGAGAGCAAGCGAGG - Intronic
1039868984 8:41529441-41529463 GGTGGCACTGAGAGGGAGGAGGG + Intronic
1040000797 8:42575068-42575090 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1040014378 8:42689346-42689368 GGAGGCGCCCAGAGTGAGCCAGG - Intergenic
1040026471 8:42786628-42786650 GGAGGTGCCGAGAGGGAGCAAGG - Intronic
1040027500 8:42795505-42795527 GGAGGCACTGAGAGCGAGCAAGG - Intronic
1040323893 8:46331586-46331608 GGAGGTGCTGAGAGTGAGCGAGG - Intergenic
1040418724 8:47219531-47219553 GAAGGCCTAGAGAGTGAGGAAGG - Intergenic
1040638748 8:49306365-49306387 GGAGGCGCCGAGAGTGAGCTAGG - Intergenic
1040701709 8:50074711-50074733 GGAGGCACTGAGAGTGAGCAAGG - Intronic
1040874204 8:52133305-52133327 GAAGGCACAGGAAGAGAGCATGG + Intronic
1040953941 8:52961247-52961269 GGAGGCACCAAGAGTGAGCGAGG - Intergenic
1040964650 8:53071644-53071666 GGAGGCACTGAGAGTGAGCGAGG + Intergenic
1041173739 8:55171810-55171832 GGAGGCACAGATGGAGAACAGGG - Intronic
1041445677 8:57948790-57948812 GGAGGCCCAGAGTAAGAGCATGG - Intergenic
1041875196 8:62679668-62679690 GAAGGGAAAGAGAGAGAGCAAGG + Intronic
1041883707 8:62783491-62783513 TGAGACACAGAGAATTAGCAAGG + Intronic
1042335954 8:67630577-67630599 GGAGGCACTGAGAGGGAGCGAGG - Intronic
1042512643 8:69626979-69627001 GGAGGCGCGGAGAGCGAGCGAGG + Intronic
1042794181 8:72642455-72642477 AGAGGCACAGGCAGTGAGCACGG + Intronic
1042948829 8:74180024-74180046 GGAGGCACTGAGAACGAGCGAGG + Intergenic
1043346380 8:79303347-79303369 GGAGGCGCCGAGAGCGAGCAAGG - Intergenic
1043726051 8:83611615-83611637 GGAGGTGCTGAGAGCGAGCAAGG + Intergenic
1043732012 8:83694463-83694485 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1043857077 8:85275915-85275937 GGAGGCGCTGAGAGCGAGCAAGG - Intronic
1043936035 8:86143596-86143618 GATGGCACTGAGAGTGACCATGG - Intronic
1044075746 8:87820687-87820709 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1044348014 8:91129216-91129238 GAAGACAGAGAGAGAGAGCAAGG + Intronic
1044457154 8:92401636-92401658 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
1044459721 8:92429737-92429759 GGAGGCACTGAGAGTGAGCGAGG + Intergenic
1044612108 8:94102102-94102124 GGAGGCTCAGAAAGTAAGCAAGG + Intergenic
1044633560 8:94300841-94300863 GGAGGCACCGAGAGCGAGCAAGG + Intergenic
1044788605 8:95823491-95823513 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1044853497 8:96452173-96452195 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1044880738 8:96719593-96719615 GGAGGCACTGAGAGCGAGTGAGG + Intronic
1045306101 8:100957615-100957637 GGAGGCACTGAGAGGGAGCGAGG + Intergenic
1045407469 8:101880515-101880537 GGAGGCGCTGAGAGTGAGTGAGG + Intronic
1045589677 8:103579899-103579921 GGAGACAGAGAGAGTGAAGACGG + Intronic
1045678486 8:104633392-104633414 GGAGGCACCGAGAGCGAGCGAGG + Intronic
1045795846 8:106043158-106043180 GAAGGCAGTAAGAGTGAGCAGGG - Intergenic
1045933668 8:107655458-107655480 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
1046149426 8:110203078-110203100 GGAGGCGCCGAGAGCGAGCATGG + Intergenic
1046661279 8:116950243-116950265 GGAGGCGCTGAGAGCGAGCAAGG + Intergenic
1046790139 8:118312868-118312890 GATGACACAGAGACTGAGCAAGG + Intronic
1047135949 8:122078693-122078715 GGAGGCAGAGAGAGTGGGGAAGG + Intergenic
1047171531 8:122497950-122497972 GGTGGCACAGAGAAGAAGCATGG + Intergenic
1047209847 8:122832513-122832535 GAAGTCTGAGAGAGTGAGCACGG + Intronic
1047255550 8:123210930-123210952 GGAGGGACAGAGAGTGAAGGTGG - Intergenic
1047345130 8:124020393-124020415 TGAGGCACAGTGAGTGAGGAAGG + Intronic
1047542892 8:125787565-125787587 AGAGGCCCAGAGAGAGACCAGGG + Intergenic
1048186954 8:132250164-132250186 GGAGGCACTGAGCGCGAGCGAGG + Intronic
1048907553 8:139103135-139103157 GGAGGCAAAGAGCCTGTGCAGGG + Intergenic
1049180175 8:141218177-141218199 GGGGACACCGAGAGTGAGGAGGG - Exonic
1049232256 8:141490493-141490515 GCAGGCACACAGCGTGAGCAAGG - Intergenic
1049273076 8:141706454-141706476 GGAGGCAGGTAGAGTGAGGAGGG - Intergenic
1049341438 8:142114668-142114690 GGAGGGACAGAGGGAGAGGAAGG + Intergenic
1049485579 8:142858111-142858133 GGCAGCAGAGAGAGAGAGCAGGG + Intronic
1049579764 8:143406021-143406043 GCTGGCAGAGAGAGTGAGCTGGG - Intergenic
1049857868 8:144875023-144875045 GGAGGCACCGAGAGCAAGCAAGG - Intergenic
1050394904 9:5185654-5185676 GCAGGCGCAGACAGGGAGCAGGG - Exonic
1050826446 9:9952053-9952075 GGAGGGACAGAGGCTGAGGATGG + Intronic
1050905334 9:10996099-10996121 GGAGACATAGATAATGAGCACGG - Intergenic
1051383220 9:16480361-16480383 GGAGGCGCCGAGAGTGAGCGAGG - Intronic
1051388650 9:16539601-16539623 GGAGGGAGAGAGAGAGAGAAGGG + Intronic
1051388660 9:16539638-16539660 GGAGGGAGAGAGAGAGAGAAGGG + Intronic
1051434157 9:17013187-17013209 GGAGGTATAGAGAGAGAGCAAGG + Intergenic
1051549844 9:18315837-18315859 GGAGGCGCAGAGAGCGAGCGAGG + Intergenic
1051774923 9:20622586-20622608 GGAGGCAGAGCGAGCGAGCCAGG + Intergenic
1051934745 9:22433723-22433745 GGAGGCGCCGAGAGTGAATAAGG - Intergenic
1052014772 9:23451888-23451910 GGAGGCACTAAGAGCGAGCGAGG - Intergenic
1052068945 9:24057869-24057891 GGACATACAGAGAGAGAGCAGGG - Intergenic
1052122723 9:24738380-24738402 GGAGGCACTGAGAGTGAGCGAGG - Intergenic
1052313356 9:27092507-27092529 GGAGGCGCTGAGAGTGAGCGAGG - Intergenic
1052576497 9:30299120-30299142 GGAGGCACCGAGAGCGAGCGAGG - Intergenic
1053430772 9:38040456-38040478 GGAGGGACAGAGAGGGCACAGGG + Intronic
1053678223 9:40460888-40460910 GGAGACACGGAGAGCGAGCAAGG - Intergenic
1053928207 9:43089231-43089253 GGAGACACGGAGAGCGAACAAGG - Intergenic
1054285501 9:63164058-63164080 GGAGACACGGAGAGCGAGCAAGG + Intergenic
1054291301 9:63296425-63296447 GGAGACACGGAGAGCGAGCAAGG - Intergenic
1054389321 9:64600965-64600987 GGAGACACGGAGAGCGAGCAAGG - Intergenic
1054506396 9:65915407-65915429 GGAGACACGGAGAGCGAGCAAGG + Intergenic
1054937279 9:70701387-70701409 GGAGGCACAGTCAGTGAGAGTGG - Intronic
1055049283 9:71963392-71963414 GGAGGCACCGAGAGCGAGCGAGG - Intronic
1055248675 9:74276438-74276460 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1055462143 9:76529026-76529048 GGAGGCACCGGGAGTGAGCAAGG + Intergenic
1055557656 9:77490890-77490912 GGAGGCGCCGAGAGCGAGCAAGG + Intronic
1055561983 9:77530302-77530324 GGAGCAAGAGAGAGTGAGGAGGG - Intronic
1055651293 9:78409850-78409872 GGAGGCACGGAGAGCGAGCGAGG - Intergenic
1055738924 9:79364401-79364423 TAAGGCACAAAGAGTGATCATGG - Intergenic
1055985579 9:82054839-82054861 GGAGGCACTGGGAGCGAGCGAGG + Intergenic
1056081047 9:83093814-83093836 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1056216194 9:84408332-84408354 GGAGGCGCCGAGAGGGAGCGAGG - Intergenic
1056305686 9:85288900-85288922 GGAGGCACCGAGAGCAAGCGAGG - Intergenic
1056913940 9:90729309-90729331 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1057511057 9:95680184-95680206 GGAGGCGCCGAGAGCGAGCCAGG - Intergenic
1057811889 9:98263874-98263896 GAAGGCAAAGAGGGTGAGGAGGG - Intergenic
1057907264 9:98992613-98992635 GGAGGCACTGAGGGCGAGCGAGG + Intronic
1057929999 9:99185034-99185056 GGAAGGACGGAGAGTGAGGAGGG + Intergenic
1058365109 9:104200450-104200472 GGAGGCACCAAGAGCGAGCAAGG - Intergenic
1058379641 9:104363408-104363430 GGAGGCGCCAAGAGTGAGCAAGG + Intergenic
1058555196 9:106159429-106159451 GGGGGCACAGAGAACGAGAAGGG + Intergenic
1058585440 9:106501799-106501821 GGAGGCGCAGAGAGCGAGCGAGG + Intergenic
1058831413 9:108820584-108820606 GGAGGAAGAGAGAGAGAGCCAGG - Intergenic
1059212205 9:112523894-112523916 GGAGGTGGAGAGAGTAAGCAGGG - Intronic
1059791231 9:117643235-117643257 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1059810538 9:117851879-117851901 GGAGGCGCCGAGGGTGAGCGAGG - Intergenic
1059891520 9:118809723-118809745 GGAGGCCCCGAGAGCGAGCGAGG + Intergenic
1059990775 9:119863257-119863279 GGAGATACAGAGATTGAACAAGG + Intergenic
1060143411 9:121230245-121230267 GGAGGCTCAGAGAGAGAAAACGG + Intronic
1060166516 9:121421609-121421631 GGAGGTACAGAGAGAGATAAGGG - Intergenic
1060220658 9:121762502-121762524 AGAGGCACAGAGGGACAGCAGGG - Intronic
1060594310 9:124839230-124839252 GGAGGCACCGAGAGCGAGTGAGG + Intergenic
1060707315 9:125815969-125815991 GGAGGCAGAGAGAAAGAGTAGGG - Intronic
1060752578 9:126183064-126183086 AGAGAAACAGAGAGAGAGCAAGG + Intergenic
1062377422 9:136268433-136268455 TGAGGCCCAGAGAGGGAGAAGGG + Intergenic
1062525117 9:136975089-136975111 AAGGGCACAGAGAGTGTGCAGGG + Intergenic
1062606006 9:137349164-137349186 CCAGGCACAGAGAGAGACCAGGG - Exonic
1203429741 Un_GL000195v1:80234-80256 GGAGGCCCGGAGAGTGAGCAAGG - Intergenic
1203746408 Un_GL000218v1:42784-42806 TGAGGCACTGAGAGGGTGCAGGG + Intergenic
1203460498 Un_GL000220v1:31476-31498 GGAGGCACCAAGAGTGAGCGAGG + Intergenic
1203563699 Un_KI270744v1:76696-76718 TGAGGCACTGAGAGGGTGCAGGG - Intergenic
1203662947 Un_KI270753v1:61878-61900 GGAGGCACAGAGAGCGAGCCAGG + Intergenic
1203670424 Un_KI270755v1:6819-6841 GGAGGCACAGAGAGCGAGCCAGG - Intergenic
1185505241 X:628398-628420 GGAGAGACAGAGAGAGAGAAAGG - Intronic
1185505279 X:628914-628936 GGAGAGACAGAGAGAGAGAAAGG - Intronic
1185505289 X:629028-629050 GGAGAGACAGAGAGAGAGAAAGG - Intronic
1185615670 X:1420372-1420394 GGAGACACAGAGAGAGAGATAGG - Intronic
1185666505 X:1769502-1769524 GGAGAGACAGAGAGTGAGGGGGG + Intergenic
1186226701 X:7406769-7406791 AGAGGAAAAGAGAGTGAGGAAGG + Intergenic
1186282143 X:8003727-8003749 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
1186293111 X:8121441-8121463 GGAGGCACCGAAAGCGAGCGAGG - Intergenic
1186323332 X:8452999-8453021 GGAGGCGCCGAGAGTAAGCGAGG + Intergenic
1186358177 X:8809347-8809369 AGAGGCACAGTGAGATAGCAGGG + Intergenic
1186497649 X:10024678-10024700 GAAGGGACTGAGAGAGAGCATGG + Intronic
1186572413 X:10729130-10729152 GAAAGGACAGTGAGTGAGCACGG - Intronic
1186617330 X:11202962-11202984 GGAGGCACAGTGAGATAGCAGGG - Intronic
1187005926 X:15232239-15232261 GGAGGCGCCGAGAGCGAGCAAGG + Intergenic
1187138962 X:16575306-16575328 GGAGGCGCGGAGAGGGAGCGAGG - Intergenic
1187226505 X:17378606-17378628 GGAAGCACAGAGAGGGGGTAGGG + Intronic
1187583879 X:20638690-20638712 GGAGACACAGAGAGTGACAGAGG - Intergenic
1187903934 X:24049544-24049566 GGAGGCACCGAGAGCAAGCGAGG - Intergenic
1188078305 X:25806091-25806113 GGAGGCACCAAGAGCGAGCAAGG + Intergenic
1188111933 X:26204655-26204677 GGAGGCACCGAGAGTGAGCGAGG - Intergenic
1188167029 X:26874168-26874190 GGAGGCACCGAGAGTGAGCGAGG + Intergenic
1188415148 X:29923880-29923902 GAAGGCACAGAGAGTGAAGAAGG - Intronic
1189101632 X:38196695-38196717 GGAAGCACAGTGAGAAAGCAGGG + Intronic
1189268919 X:39736684-39736706 GGAGGCTCAGAGAGTGGGTGGGG - Intergenic
1189467195 X:41286216-41286238 GGAAGCGCAGAGAGTGAGCGAGG + Intergenic
1189896915 X:45665276-45665298 GGAGGCGCAGAGAGCAAGCGAGG + Intergenic
1189909847 X:45799447-45799469 GGAGGGAGAGAGAGAGAGGAGGG + Intergenic
1191957554 X:66661637-66661659 GGAAGGAAAGAGAGAGAGCAAGG - Intergenic
1192212967 X:69139432-69139454 TGAGGCCCAGAGAGGGGGCAGGG + Intergenic
1192242820 X:69348284-69348306 TGAACCACAGAGACTGAGCAGGG + Intergenic
1192438033 X:71154685-71154707 GGTGGCACAGGGAGAGAACAAGG - Intronic
1192870647 X:75180026-75180048 GGAGGTGCCAAGAGTGAGCAAGG + Intergenic
1193040271 X:76997150-76997172 GGAGGCACCAAGAGTGAGTGAGG + Intergenic
1193277972 X:79612737-79612759 GGAGGAAAAGAGAGAGAGGAGGG - Intergenic
1193541198 X:82774967-82774989 GGAGGATCAGGGAGTGGGCAGGG + Intergenic
1193709044 X:84857110-84857132 GGAGGCACCGAGAGCAAGCGAGG + Intergenic
1193719911 X:84974747-84974769 GGAGGCACTGAGAGTGAGCAAGG - Intergenic
1193951851 X:87809177-87809199 GGAGGTGCGGAGAGTGAGCGAGG + Intergenic
1194025662 X:88746834-88746856 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1194118108 X:89927043-89927065 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1194328227 X:92547512-92547534 GGAGGGAGAGAGAGGGAGAAAGG - Intronic
1194340523 X:92699983-92700005 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1194398376 X:93413694-93413716 GGAGGTAGAGAGAGAGATCAGGG + Intergenic
1195385861 X:104313217-104313239 GGAGGCACAGAGAGGGAGGAAGG - Intergenic
1195460332 X:105116216-105116238 GGAGGCACCGAGAGTGAGCAAGG + Intronic
1195590815 X:106623954-106623976 GGAGGCACAAAGAGGTAGGAAGG - Intronic
1195847140 X:109241040-109241062 GGAGTCAGAGAGAGAGAGAAAGG - Intergenic
1195877726 X:109559607-109559629 TGAGGTCCAGAGAGTCAGCAGGG - Intergenic
1195896447 X:109749827-109749849 GGAGGCGCCGAGAGTGAGCGGGG + Intergenic
1196254172 X:113496368-113496390 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1196582620 X:117394533-117394555 GGAGGTGCCGAGAGTGAGCGAGG - Intergenic
1196714529 X:118798808-118798830 GGAGGCGCCGAGAGCGAGCGAGG - Intergenic
1196794063 X:119488372-119488394 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1196844975 X:119890453-119890475 GGAGGCGCGGAGAGCGAGCGAGG - Intergenic
1197331264 X:125155968-125155990 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1197376884 X:125691088-125691110 GGAGGCGCGGAGAGCGAGCGAGG + Intergenic
1197780424 X:130153692-130153714 AGAGGGAGAAAGAGTGAGCAAGG - Intronic
1197978680 X:132193947-132193969 GGAGGCACCGAGAGCCAGCGAGG - Intergenic
1198060838 X:133044229-133044251 GGAGGCGCCAAGAGTGAGCGAGG - Intronic
1198116495 X:133549764-133549786 GGAGGGAGAGAGAGGGAGGAAGG - Intronic
1198380163 X:136076199-136076221 GGAGTGACAGAGTGTGAGAAGGG + Intergenic
1198683040 X:139202994-139203016 AGAGGCACAGAGAGGGAATATGG - Intronic
1198694367 X:139320664-139320686 GGAGGCGCCGAGAGTGAGCGAGG - Intergenic
1198872378 X:141189007-141189029 GGAGGCGCCGAGAGTGAGCGAGG + Intergenic
1198972673 X:142298754-142298776 GGAGGCGCAGAGAGAGAGCGAGG + Intergenic
1199010027 X:142746232-142746254 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1199050313 X:143229199-143229221 GGAGGCACCGAGAGCGAGGGAGG + Intergenic
1199097259 X:143757713-143757735 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1199192950 X:144993564-144993586 GGAGAGACAGAGAGAGAGAAAGG - Intergenic
1199210649 X:145206181-145206203 GGACCCACAGACAGTGAGCTGGG + Intergenic
1199277970 X:145968941-145968963 GCAGGCAAAGAGAGAGAGCTTGG - Intergenic
1199356323 X:146867387-146867409 GGAGGCGCTGAGAGCGAGCCAGG + Intergenic
1199373900 X:147084372-147084394 GGAGGAAGAGAGAGTGAAGAAGG - Intergenic
1199437519 X:147828987-147829009 GGAGGCACTGAGAGCGAGCGAGG + Intergenic
1199489062 X:148378973-148378995 GGAGGCTCAGAGTGAGAGGAAGG + Intergenic
1199628036 X:149758431-149758453 GGAGGCGCCGAGAGTGAGCAAGG - Intergenic
1199831859 X:151555659-151555681 GGAGGCACCGAGAGTGAGCAAGG + Intergenic
1199931686 X:152530049-152530071 GGAGACAGAGAGAGAGACCAGGG + Intergenic
1200383475 X:155865227-155865249 GGAGGCACCAAGAGTGAGCAAGG - Intergenic
1200470988 Y:3584612-3584634 GGAGGCCCTGAGAGCGAGCGAGG + Intergenic
1200648879 Y:5816719-5816741 GGAGGCGCTGAGAGCGAGCGAGG + Intergenic
1200684074 Y:6244826-6244848 GGAGGCACATGGGGTGAGCCAGG - Intergenic
1200748465 Y:6923078-6923100 GGAGGCACCGAGAGCAAGCGAGG + Intronic
1200954618 Y:8930955-8930977 AGAGGCACACAGAGTCAGCCAGG - Intergenic
1200955254 Y:8938190-8938212 GGAGGCACAGAGAGTGAGCAAGG - Intergenic
1201048561 Y:9909560-9909582 GGAGGCACATGGGGTGAGCCAGG + Intergenic
1201159739 Y:11157798-11157820 TGAGGCACTGAGAGGGTGCAGGG + Intergenic
1201474934 Y:14370141-14370163 GGAGAGACAGAGAGGGAGAAAGG - Intergenic
1201623502 Y:15986826-15986848 GGAGGAAGAGAGAGTGAGGAGGG + Intergenic
1201907193 Y:19097613-19097635 GGAGACAGAGAGAGTGTGAAGGG + Intergenic
1201982696 Y:19924224-19924246 GGAGTCACCGAGAGCGAGCGAGG + Intergenic
1202013813 Y:20379025-20379047 GGAGGTGCTGAGAGTGAGCAAGG - Intergenic
1202109759 Y:21407053-21407075 GGAGGCACGGAGAGCGAGCGAGG - Intergenic
1202137183 Y:21677170-21677192 GGAGGCGCCGAGAGCGAGCGAGG + Intergenic
1202271568 Y:23078848-23078870 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1202294458 Y:23341834-23341856 GGAGGCACCGAGAGTGAGCCAGG - Intergenic
1202424563 Y:24712592-24712614 GGAGGCACCGAGAGTGAGCCAGG + Intergenic
1202446226 Y:24957493-24957515 GGAGGCACCGAGAGTGAGCCAGG - Intergenic