ID: 906567947

View in Genome Browser
Species Human (GRCh38)
Location 1:46813890-46813912
Sequence CCTGCTAAGCAGAGGGTAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906567947 Original CRISPR CCTGCTAAGCAGAGGGTAGG AGG (reversed) Exonic
900102964 1:970664-970686 CCTGCCAGGCACAGGGTAGGAGG - Exonic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
902053407 1:13581729-13581751 CCTGCTCAGCTGAGGGGAAGAGG - Intergenic
902810146 1:18883428-18883450 CCTGCAAGGCAGAGGGCCGGGGG + Exonic
902864694 1:19270352-19270374 GCTGCTATGCAGAGGGCATGGGG + Intergenic
904242825 1:29160599-29160621 CATGCTTAGCAAAGGTTAGGTGG + Intronic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904702486 1:32366160-32366182 CCTGTTTAGCCAAGGGTAGGTGG + Intronic
906345642 1:45012741-45012763 CCTGATAGGCAGAGAGGAGGCGG + Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
914802547 1:150972057-150972079 CCTGCAAAACAGGGGGTGGGGGG + Intronic
915653195 1:157334746-157334768 GATGCTGAGCAGAGGGTAGGGGG - Intergenic
915684369 1:157616754-157616776 GATGCTGAGCAGAGGGTAGGGGG + Intergenic
917643042 1:177001743-177001765 CCTGCAGGGCAGAGTGTAGGGGG + Intronic
920307521 1:205028618-205028640 CCTGCTACCCAGAGCGGAGGAGG - Intergenic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
922950170 1:229552627-229552649 CCTGTTCAGCAGTGGGCAGGTGG - Intronic
1063614929 10:7593155-7593177 GCTGCTGAGCTGAGGGAAGGAGG - Intronic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064873542 10:19966849-19966871 CCTGCAATGCAGAGGCCAGGGGG + Intronic
1065178891 10:23105445-23105467 CCTGGAAAGCAGGGGGTAGGGGG - Intronic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068516257 10:58029116-58029138 CATGCTAAGCAGTGGGTACTTGG - Intergenic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1070427117 10:76299702-76299724 CTTGCTAATTAGAGGGTTGGAGG + Intronic
1071757800 10:88564420-88564442 CCTGAAAATCAGAGGGTGGGGGG + Intronic
1076433064 10:130420967-130420989 CCAGCCAAGCATAGGGCAGGAGG + Intergenic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1078908532 11:15709958-15709980 CCGGATAAGCAAAGGTTAGGAGG + Intergenic
1080892737 11:36423660-36423682 CCTTCAAAGCAGAGTGTATGTGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084955829 11:72691037-72691059 GGTGCTCAGCACAGGGTAGGTGG - Intronic
1086438921 11:86808445-86808467 CCTGCTAAGCAGCTGCCAGGGGG + Exonic
1088742951 11:112781633-112781655 CCTGTTAGGAAGAGGGTTGGAGG + Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1089612890 11:119679446-119679468 CCAGCTAGGCAGAGGGAAGTGGG + Intronic
1094523967 12:31219673-31219695 CCTGCAGAGCAGGGGGTTGGAGG - Intergenic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1096814894 12:54195845-54195867 CCTGCTCAGCTCAGGGTGGGAGG - Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1100260993 12:92931971-92931993 CCTGTGCAGCAGAGAGTAGGTGG - Intergenic
1101493041 12:105227676-105227698 ACTCCTAAGCATAGGGGAGGTGG - Intronic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1102970526 12:117162491-117162513 GCTGCTAAGAAGATGGAAGGAGG + Intronic
1104501617 12:129291828-129291850 TGTTCTAAGCAGAGGCTAGGAGG + Intronic
1104868718 12:131978392-131978414 GGTGCAAAGCAGAGGGGAGGAGG - Intronic
1111718276 13:91909231-91909253 CCAGCTCAGCAGAGGCTGGGAGG - Intronic
1112002335 13:95222420-95222442 CCTGCTGAGCAAAGGGGTGGAGG + Intronic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1116415299 14:44671025-44671047 CCTGCTAACTTAAGGGTAGGAGG - Intergenic
1116441639 14:44961634-44961656 CCTGATAAGCAGATGGCAAGAGG + Intronic
1118320505 14:64749605-64749627 CTGGCTAAGAAGGGGGTAGGTGG - Exonic
1118906572 14:70027881-70027903 CCTGCAGAGCAGAGGGATGGAGG - Intronic
1119211679 14:72836618-72836640 GCTCCTAAGCACTGGGTAGGAGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1119739961 14:77007929-77007951 TCTGGGAAGGAGAGGGTAGGAGG - Intergenic
1120711632 14:87798698-87798720 CATGCTAAGCTGGGGGCAGGGGG + Intergenic
1122049014 14:99042681-99042703 CCTGCCAGGCGGAGGGGAGGAGG + Intergenic
1122412793 14:101534523-101534545 CCTGCAATGCAGAAAGTAGGGGG + Intergenic
1124136282 15:27038743-27038765 CCAGAAAGGCAGAGGGTAGGGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1128455253 15:67828180-67828202 CCTGCCGCGCACAGGGTAGGTGG - Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132328836 15:100996256-100996278 CCTGCTGAGAAGAGGGTATGTGG - Intronic
1132602056 16:777699-777721 CGTGCCAGGCAGAGGGGAGGTGG + Intronic
1132772632 16:1572814-1572836 CCTGCCCAGCAGTGGGTTGGGGG + Intronic
1134468627 16:14501619-14501641 CCTGGTAACCTGAGGGTTGGTGG - Intronic
1134558615 16:15188011-15188033 CGTGCTAAGCACTGGGGAGGCGG + Intergenic
1134656244 16:15949996-15950018 CCTGCGGAGCAGAGCGTGGGGGG + Intronic
1134919146 16:18099613-18099635 CGTGCTAAGCACTGGGGAGGCGG + Intergenic
1136708554 16:32212184-32212206 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1136759353 16:32717228-32717250 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1136808754 16:33153158-33153180 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1139098586 16:63736258-63736280 CCTACTAGGCAGAGAGTAGTAGG + Intergenic
1139524221 16:67503726-67503748 TATGCCACGCAGAGGGTAGGAGG + Intergenic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1141770298 16:86085669-86085691 CCTCCTAAGCAGTGGTGAGGAGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142416573 16:89946659-89946681 ACTGCTGAGCAGAGGCAAGGAGG + Intergenic
1203061508 16_KI270728v1_random:977537-977559 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1144369445 17:14576025-14576047 CCTGCTGAGCAGAGACTAGGGGG - Intergenic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1148467042 17:47871552-47871574 CATGCTATGCAGAGAGTTGGAGG - Intergenic
1151229248 17:72671292-72671314 CCTGCAGAGGAGAGGGTAAGGGG - Intronic
1154499452 18:14987975-14987997 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
1155926331 18:31659466-31659488 GCTGCTAAGCAGAGGGTGTTGGG + Intronic
1157706479 18:49812255-49812277 CCAGCTAAGCATTGGTTAGGGGG - Intronic
1159224135 18:65509844-65509866 GCTGCAAAGCAGAGGGTATTGGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1163154741 19:15433508-15433530 ACTGCGAGGCAGAGGGTTGGCGG - Intronic
1165367521 19:35377650-35377672 CCTGGTAAGCAGAGGTTGTGAGG + Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1166770709 19:45280452-45280474 CCTGCCCAGCAGGAGGTAGGTGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926155135 2:10449138-10449160 CCGGTAAAGCAGAGGGTAGTGGG - Intergenic
927886668 2:26723068-26723090 CCAGCTAGGCCAAGGGTAGGAGG + Intronic
928360798 2:30660668-30660690 CCTGCTTTTCAGAGGGTACGGGG + Intergenic
929554962 2:42920487-42920509 CATGCCAAGCAGAGGGAAGGAGG - Intergenic
929780348 2:44953121-44953143 CCTCCTAGGCAGCGCGTAGGAGG - Intergenic
931151192 2:59575337-59575359 CCTGCTATATAGAGGGTAGATGG + Intergenic
931451540 2:62371088-62371110 CCTTCTAAGCGGAAGATAGGAGG + Intergenic
931569951 2:63657845-63657867 CCTGCCAAGCAGAGGCCAGCTGG - Intronic
934014532 2:87865322-87865344 TCTGCTAAGCAGAGAGAATGAGG + Intergenic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
936261873 2:110966669-110966691 CCTGCTAAAAATAGGGGAGGAGG - Intronic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
938498656 2:131818343-131818365 CCTGCAGGGCAGAGGGGAGGTGG + Intergenic
941311697 2:163940783-163940805 CCCGCTAATCAGAGGATAAGGGG - Intergenic
942045509 2:172097180-172097202 CCTGCGAAGCCGAGAGCAGGAGG - Intergenic
947526199 2:230878166-230878188 CAAGCTAAGCAGGGGGAAGGAGG - Exonic
948109063 2:235440104-235440126 CCTGCAAAGCAGGTGGTAGGAGG + Intergenic
948260062 2:236597470-236597492 CCTGATAAGATGAGGGTTGGTGG - Intergenic
1168750409 20:277833-277855 CCTGCTGAGCAGAGGGGTGGTGG - Intronic
1169851674 20:10059101-10059123 CTTGATAAGCAAAGGGGAGGGGG - Intergenic
1173715434 20:45199577-45199599 CCTGCTTAGTAGAGGGTATGTGG + Intergenic
1173983471 20:47242462-47242484 CCTTCTAAGAGGAGGGCAGGGGG + Intronic
1176342628 21:5713005-5713027 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176411917 21:6453788-6453810 CCTGCTCAGGTGAGGGCAGGAGG - Intergenic
1176474882 21:7145156-7145178 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1176502199 21:7611451-7611473 GCAGATGAGCAGAGGGTAGGAGG + Intergenic
1176536949 21:8111074-8111096 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1179687411 21:43062110-43062132 CCTGCTCAGGTGAGGGCAGGAGG - Intronic
1181634717 22:24169245-24169267 CCTCCAAGCCAGAGGGTAGGTGG + Intronic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183583871 22:38740881-38740903 CTTGCCAAGCAGATGGTAGGGGG - Intronic
1183697687 22:39432494-39432516 CCTGCCCAGCAGAGTGGAGGGGG - Intronic
1203241899 22_KI270733v1_random:27478-27500 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
956668138 3:71661215-71661237 CCTGTGAAGAAGAGGGTTGGGGG + Intergenic
959308009 3:104694122-104694144 CCTTCAAAGCAGTGGGTAGAGGG - Intergenic
959532318 3:107447664-107447686 CCTAATAACCAGAAGGTAGGAGG + Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
963157769 3:142117607-142117629 AATGCTAAACAGAGGTTAGGAGG + Intronic
964443717 3:156739024-156739046 CCTGCAAAGAAGATGGGAGGAGG - Intergenic
966170581 3:177075647-177075669 ACTGCTAAGTAGATGGCAGGAGG - Intronic
969200501 4:5600816-5600838 CCTGCTGAGCAAAGGATGGGTGG - Intronic
975424269 4:74208108-74208130 CCTTCTAAGCTGGGGGTAGTGGG - Intronic
976843542 4:89460312-89460334 GGTTCTAAGCAGAGGTTAGGTGG - Intergenic
977710891 4:100123818-100123840 CCTGGTAAGCAGAGGATATCAGG + Intergenic
979363798 4:119796258-119796280 CCTGCTTAAGAGAGAGTAGGAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
985551177 5:534387-534409 CTGGCTCAGCACAGGGTAGGGGG + Intergenic
985652693 5:1114239-1114261 CCTGCCAGGCAGAAGGCAGGTGG + Intergenic
986456897 5:7928552-7928574 CGTGCTCAGCAAAGGGTAGCTGG + Intergenic
988485878 5:31667754-31667776 CCTGCTCACCAGAAGGCAGGAGG + Intronic
989963230 5:50440579-50440601 CCTGCCAAGAGGAGGGAAGGAGG + Intronic
991331647 5:65499101-65499123 CCTGCCAAGCTGAGGCCAGGTGG - Intergenic
992854806 5:80849207-80849229 CCTGCAAAGCACAGGGGAGGAGG - Intronic
992910228 5:81389236-81389258 ACTGCAATGCAGAGAGTAGGAGG + Intronic
994781256 5:104093720-104093742 CCTGCCTAGCAGAGGTCAGGAGG + Intergenic
997594343 5:135096145-135096167 CCTGTTCACCTGAGGGTAGGGGG + Intronic
998151772 5:139761646-139761668 CATGGAAAGCAGAGGTTAGGGGG - Intergenic
998496421 5:142594370-142594392 CCTGGTAAGCAGAGGCTTTGGGG - Exonic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1006738857 6:36293342-36293364 CCGGCTTGGCAGTGGGTAGGTGG - Intronic
1007180684 6:39927188-39927210 CCTGGTAAGCAAGGGGTAGCAGG + Intronic
1011704714 6:89989501-89989523 CCACCTAAGCAGAAGGGAGGTGG - Intronic
1015465106 6:133540283-133540305 CCTGTTAAGCAGAATGTTGGAGG - Intergenic
1015809832 6:137150874-137150896 CCTGCTAATTAGAGAGTTGGGGG + Intronic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1017321224 6:153096160-153096182 GCTGCTAAGACGAGGGAAGGAGG + Intronic
1018173499 6:161160551-161160573 CCTGGTAAACAGAGGGAAGTTGG - Intronic
1020269402 7:6584744-6584766 CCAGCTACTCAGAGGCTAGGCGG - Intronic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1023352335 7:39333113-39333135 CCTGCTCAGCAAAGTGTTGGGGG - Intronic
1026354141 7:69542602-69542624 GCAGCTAAACAGAGGGAAGGTGG - Intergenic
1026396793 7:69963556-69963578 GCTACTAAGCAGAGGTTAGGAGG + Intronic
1026448381 7:70505763-70505785 CCTGCTAACCAGAGGGTTTGGGG + Intronic
1028270032 7:88777100-88777122 CCTGCAAAGCAAAGGTCAGGTGG - Intronic
1029339762 7:99933410-99933432 CCTGAAAAGCAGGGGGTAAGGGG - Intergenic
1031333410 7:120495769-120495791 CCTACTAAGCTTAAGGTAGGTGG - Intronic
1031986426 7:128167163-128167185 CGTGCTAGGTAGAGGGTGGGAGG + Intergenic
1032529126 7:132605516-132605538 CCTGTTAGGAAGTGGGTAGGTGG + Intronic
1033152107 7:138924534-138924556 CCTTCTAAGGACAGGGTACGGGG + Intronic
1033760293 7:144430060-144430082 CCTGGTCACTAGAGGGTAGGGGG + Intergenic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1039174481 8:34787295-34787317 CCTACTAAGCAAAGAGTAGAGGG - Intergenic
1042109752 8:65367866-65367888 CCTGCTAAGCTCAGTGGAGGTGG - Intergenic
1044866262 8:96574046-96574068 CTAGCTATGCAGAGGGGAGGGGG - Intronic
1045854335 8:106746451-106746473 CTTGCTAAGCCCAGGCTAGGTGG - Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048145325 8:131836315-131836337 ACTGCCAAGCAGAGGGTTGGTGG - Intergenic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1060089517 9:120730810-120730832 CCTGCTAAGCAAACAGCAGGTGG + Intergenic
1061183774 9:129040254-129040276 CCTGGTAGGCAGAGGGTCTGTGG + Intronic
1203458217 Un_GL000220v1:10555-10577 GCAGATGAGCAGAGGGTAGGAGG - Intergenic
1186055066 X:5641591-5641613 CCTTCTAAGCTGAAGGCAGGAGG - Intergenic
1186192253 X:7077212-7077234 CCTGCTATGGAGAAGGTAAGTGG - Exonic
1195929606 X:110061439-110061461 CCTACTAAGAAGATGGAAGGAGG - Intronic
1196441150 X:115721348-115721370 CCTGCTAAGGGGAGAGTTGGGGG - Intergenic
1196444678 X:115839336-115839358 CCTGCTAAGGGGAGAGTTGGGGG - Intergenic
1199129944 X:144173189-144173211 TCTGCTAAGCAGAGAGAATGAGG - Intergenic
1200052937 X:153444413-153444435 CCTGCTCAGCAGGGGGTCGAGGG + Intergenic
1200183003 X:154162610-154162632 CCTGTTAAGAAGAGAGTCGGTGG + Intergenic
1200188657 X:154199724-154199746 CCTGTTAAGAAGAGAGTCGGTGG + Intergenic
1200194306 X:154236865-154236887 CCTGTTAAGAAGAGAGTCGGTGG + Intergenic
1200200062 X:154274668-154274690 CCTGTTAAGAAGAGAGTCGGTGG + Intronic