ID: 906569037

View in Genome Browser
Species Human (GRCh38)
Location 1:46820655-46820677
Sequence CTGGCCACTCCGAGTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906569037_906569043 4 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569043 1:46820682-46820704 AGAGGCAGGAAACCACCACAAGG 0: 1
1: 0
2: 2
3: 25
4: 272
906569037_906569051 21 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569051 1:46820699-46820721 ACAAGGCTGTGGTGTGGGGGAGG 0: 1
1: 0
2: 3
3: 54
4: 582
906569037_906569040 -10 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569040 1:46820668-46820690 GAGTGGCCAGCCAGAGAGGCAGG 0: 1
1: 0
2: 6
3: 44
4: 399
906569037_906569048 17 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569048 1:46820695-46820717 CACCACAAGGCTGTGGTGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 259
906569037_906569045 15 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569045 1:46820693-46820715 ACCACCACAAGGCTGTGGTGTGG 0: 1
1: 0
2: 3
3: 16
4: 208
906569037_906569049 18 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569049 1:46820696-46820718 ACCACAAGGCTGTGGTGTGGGGG 0: 1
1: 0
2: 0
3: 30
4: 233
906569037_906569044 10 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569044 1:46820688-46820710 AGGAAACCACCACAAGGCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 259
906569037_906569047 16 Left 906569037 1:46820655-46820677 CCCTGTTCACTCGGAGTGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 82
Right 906569047 1:46820694-46820716 CCACCACAAGGCTGTGGTGTGGG 0: 1
1: 0
2: 2
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906569037 Original CRISPR CTGGCCACTCCGAGTGAACA GGG (reversed) Intergenic
900175812 1:1290904-1290926 CTGGCCACGCTAGGTGAACAGGG + Exonic
900702749 1:4058367-4058389 CTGACCTCTCTGAGGGAACATGG + Intergenic
900877389 1:5352951-5352973 CTGGCTTCTCTGAGTGAACTGGG - Intergenic
901439464 1:9268829-9268851 CTGGGCCCTCCGGGAGAACAGGG - Exonic
901828404 1:11877855-11877877 CTGGCCACCCCGAGTCACCAAGG + Intergenic
906569037 1:46820655-46820677 CTGGCCACTCCGAGTGAACAGGG - Intergenic
909725350 1:78828324-78828346 CTGGCCCATCAGAGGGAACAGGG + Intergenic
910306849 1:85773903-85773925 CTCACCACTCCTAGTCAACATGG - Intronic
914224287 1:145707581-145707603 CCAGCCACTCCCAGAGAACAAGG + Intronic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
1063238347 10:4142217-4142239 CGGGCAACTCCTAGAGAACAGGG - Intergenic
1064201728 10:13290357-13290379 ATGGGCACTCCGACTGGACATGG - Intronic
1064574353 10:16729443-16729465 CTGGCCACTCAGGCTGAAAAGGG + Intronic
1070234074 10:74605276-74605298 CTCGCCACTCCTATTCAACATGG - Intronic
1071059422 10:81552218-81552240 CTGACCACTCCTATTCAACATGG + Intergenic
1075631233 10:124001758-124001780 CTGGTCACTGCGACTGAAGATGG + Intergenic
1077242024 11:1515649-1515671 CTGGCCACTCGGAGGGAGCCGGG - Intergenic
1078456837 11:11482226-11482248 CAGGCCCCTCCGACTGCACATGG - Intronic
1081584895 11:44377416-44377438 ATGGCCACTGGGAGTGCACAGGG + Intergenic
1084951926 11:72671217-72671239 CTGGGCACTCCCTGAGAACAGGG + Intronic
1085153019 11:74267312-74267334 TTGGCCACTGGGAGAGAACAGGG + Exonic
1087400993 11:97667162-97667184 CTGGGCACTCTGAGTGCAGAGGG - Intergenic
1090559551 11:127916813-127916835 CTTGCCACTCCTATTCAACATGG + Intergenic
1098624218 12:72642746-72642768 AGGGCCCCTCCTAGTGAACATGG - Intronic
1100236293 12:92664637-92664659 CTGGCCACAGCGAGGGAACTTGG - Intergenic
1100950483 12:99843441-99843463 CTGTCCACTCCGTGTGTCCATGG + Intronic
1105480842 13:20773951-20773973 CTAGCCACTCCCACTGCACACGG - Intronic
1105592506 13:21806932-21806954 CTTGCCACTCCTATTCAACACGG + Intergenic
1106066054 13:26351408-26351430 CTGGCCACGCTGATTTAACAGGG - Intronic
1110541206 13:76708780-76708802 CTGGCCACTGCAATTGATCAGGG + Intergenic
1128886036 15:71289196-71289218 CTTGCCCCTCAGAGTCAACAGGG - Intronic
1130232833 15:82109689-82109711 CTGGCTGCTCCGTGTAAACATGG - Intergenic
1134470701 16:14522730-14522752 CTGCCCCCTCCAAGTGAAGAAGG + Intronic
1138075383 16:54037203-54037225 CAGGCCACCCCGAGCGAGCATGG + Intronic
1142427756 16:90009643-90009665 CTGGCCTCCCCTAGTGAACAAGG + Intronic
1147414890 17:40281556-40281578 CTTGCCACTGCCAGTTAACAGGG - Exonic
1148029225 17:44608402-44608424 CTGGCCCCTCCCGGGGAACAAGG + Intergenic
1149331671 17:55589057-55589079 CTGGTAACTCCAAGTGCACAGGG - Intergenic
1150754830 17:67902271-67902293 CTGGCCTCTCTCAGTGAAAATGG + Intronic
1163746476 19:19051778-19051800 CTGGCCACTGCAGGTGACCAGGG + Exonic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
927312821 2:21649733-21649755 CTGGGCTCTACCAGTGAACATGG - Intergenic
927717188 2:25360385-25360407 CTGGCCTCTCCCAGTGGATAAGG - Intergenic
930369060 2:50481186-50481208 CTTGCCACTTAGAGTGTACAGGG - Intronic
930729682 2:54715982-54716004 CTGGACACTCCGTCTGAAAATGG + Intergenic
935268478 2:101414130-101414152 CTGGCCACACTGAGTCCACAGGG + Intronic
936795679 2:116201146-116201168 CTGGACACTCAGTGTGGACAAGG - Intergenic
1170800236 20:19584515-19584537 CTGGCCACACTGAGGGAACTGGG + Intronic
1172962125 20:38806600-38806622 CTGGGCACTCCGGGTGACCTTGG - Intronic
1175298241 20:57923979-57924001 ATGTACACTCCGAGTGAGCAGGG - Intergenic
1175523551 20:59618404-59618426 CTGGCCACCCCGGGTGGAAATGG + Intronic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1185131826 22:49043698-49043720 CCTGCCCCTCCGTGTGAACAAGG + Intergenic
952304111 3:32130216-32130238 CTGTCCACACCCAGTGACCAGGG - Intronic
952607610 3:35169013-35169035 CTGACCACTCCTATTCAACATGG - Intergenic
954386925 3:50249026-50249048 CTGGCCACTGAGAGTGAAGAGGG - Intronic
958591132 3:96159370-96159392 CTCGCCACTCCTATTCAACATGG + Intergenic
958680040 3:97317799-97317821 CTGGGCATTCCCAGTGCACAAGG + Intronic
962996515 3:140634115-140634137 CTGGCCATACCCAGAGAACATGG + Intergenic
964083704 3:152790356-152790378 CTGGCCACCCCAAATGAAGATGG - Intergenic
967891236 3:194365899-194365921 CTGCCCACTCCCAGTGCACCTGG + Intronic
971907155 4:32741371-32741393 CTGGCCACTGCTGCTGAACATGG + Intergenic
982546130 4:156735466-156735488 CTGGCCACTCAAAGTGTACATGG + Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
991364929 5:65858553-65858575 CTGGCCACTCAGAGAGAAAGAGG - Intronic
992297298 5:75337662-75337684 CTGCCTACTCTGACTGAACAGGG - Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
1001641895 5:173250219-173250241 CTGGCTACTCCCAGGGAAGAAGG + Intergenic
1002581701 5:180212716-180212738 GTGGCCACACCCAGTGAACAAGG - Intergenic
1004310100 6:14537820-14537842 CTGGCCAATCGGAATGGACAGGG - Intergenic
1007764512 6:44152773-44152795 CAGGCCACCCCGAGTGGACAGGG + Intronic
1016353772 6:143195614-143195636 CTGGCCACCCTGAGGGAGCACGG + Intronic
1017054360 6:150424344-150424366 CTGGCCCCTCCAAGAGCACAGGG - Intergenic
1018847949 6:167568070-167568092 CTGGCCACTGAGAGAGAACATGG - Intergenic
1021595323 7:22309984-22310006 CTGGCAACTCCTACTGGACATGG - Exonic
1026288630 7:68986085-68986107 CTGGCCAGTCCCACTCAACATGG + Intergenic
1027361297 7:77413280-77413302 CTGGCCATTTTGACTGAACATGG - Intronic
1032773949 7:135090623-135090645 GTGACCACTCTGAGTGACCAAGG + Intronic
1039678420 8:39699987-39700009 CTGGACACTCAGAGTGCATAGGG + Intronic
1041933462 8:63311559-63311581 CTGGCCACTCTGAGTGGGCCCGG - Intergenic
1044416871 8:91948981-91949003 CTTGCCACTCAGGGTGAAGAAGG - Intergenic
1045199276 8:99962600-99962622 CTGGCCATTCAGAATGTACAGGG - Intronic
1052341334 9:27367023-27367045 CTGGCCACTCTGTGAGAGCAGGG + Intronic
1057450279 9:95152493-95152515 GTGGCCACACCCAGTGAACCGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1203664625 Un_KI270754v1:14123-14145 CTGGCCCCTCCGAGTGACATAGG + Intergenic
1187258231 X:17660691-17660713 CTGGCAACTCAGAGTGCCCAAGG + Intronic
1193141232 X:78029334-78029356 GTGGCCAGTCCCAGTGAACAGGG - Exonic
1193383719 X:80846413-80846435 CTGGCCTCTCCCAGGGCACAGGG - Intergenic
1195984303 X:110612674-110612696 CTCTCCACTCCTAATGAACATGG + Intergenic
1196531978 X:116798753-116798775 CTCGCCACTCCTATTCAACATGG - Intergenic