ID: 906570398

View in Genome Browser
Species Human (GRCh38)
Location 1:46833110-46833132
Sequence CACACCTAACACTCAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906570398_906570402 -7 Left 906570398 1:46833110-46833132 CCAAGATCTGAGTGTTAGGTGTG No data
Right 906570402 1:46833126-46833148 AGGTGTGGTCCTTACTGCTGGGG No data
906570398_906570401 -8 Left 906570398 1:46833110-46833132 CCAAGATCTGAGTGTTAGGTGTG No data
Right 906570401 1:46833125-46833147 TAGGTGTGGTCCTTACTGCTGGG No data
906570398_906570400 -9 Left 906570398 1:46833110-46833132 CCAAGATCTGAGTGTTAGGTGTG No data
Right 906570400 1:46833124-46833146 TTAGGTGTGGTCCTTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906570398 Original CRISPR CACACCTAACACTCAGATCT TGG (reversed) Intergenic
No off target data available for this crispr