ID: 906571226

View in Genome Browser
Species Human (GRCh38)
Location 1:46843144-46843166
Sequence GGGTTTCACCAGATCCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906571221_906571226 22 Left 906571221 1:46843099-46843121 CCCTTCGCAGTGGAAGTCAGCTT No data
Right 906571226 1:46843144-46843166 GGGTTTCACCAGATCCAGCAAGG 0: 1
1: 0
2: 1
3: 41
4: 230
906571222_906571226 21 Left 906571222 1:46843100-46843122 CCTTCGCAGTGGAAGTCAGCTTG No data
Right 906571226 1:46843144-46843166 GGGTTTCACCAGATCCAGCAAGG 0: 1
1: 0
2: 1
3: 41
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906571226 Original CRISPR GGGTTTCACCAGATCCAGCA AGG Intergenic
901527481 1:9832883-9832905 GGGTTTCACCATATTGACCATGG - Intergenic
902081279 1:13822587-13822609 GGGTTTCACCGTAGCCAGGATGG + Intronic
902431005 1:16363097-16363119 GGGTTTCACCACGTTCAGGATGG + Intronic
904537905 1:31212801-31212823 GGGTTTCACCGTAGCCAGGATGG - Intronic
905059638 1:35128642-35128664 GGGTTTCACCATAGCCAGGATGG + Intergenic
906571226 1:46843144-46843166 GGGTTTCACCAGATCCAGCAAGG + Intergenic
907228179 1:52969242-52969264 GTGTATCACCATATCCAGAAAGG - Intronic
907916277 1:58872787-58872809 GGGTTACACCACACCCAGCCAGG - Intergenic
911412084 1:97522523-97522545 GGGTTTCACCATAGCCAGGATGG - Intronic
912487099 1:110037597-110037619 TGATTTCACAAGGTCCAGCATGG - Intronic
914676138 1:149908828-149908850 GGGTTTCACCGTAGCCAGGATGG + Intronic
916523609 1:165588519-165588541 GGGTATCACAACATCCAGTATGG - Intergenic
917266145 1:173222942-173222964 GGCTTTCTCCAGTTCAAGCAGGG + Intergenic
919152102 1:193714352-193714374 GGGCTGCACCTGATTCAGCATGG - Intergenic
920031241 1:203038633-203038655 GGGTGTCGCTAGATCCAGCTGGG + Intronic
921262014 1:213393108-213393130 GGGTTACACCAGCTACAGCAGGG - Intergenic
921726720 1:218532755-218532777 GGGTTTCACCATAGCCAGGATGG + Intergenic
921824999 1:219662507-219662529 ATGATTCACCTGATCCAGCAGGG - Intergenic
923175576 1:231461281-231461303 GGGTTTCACCGTAGCCAGGATGG - Intergenic
924472138 1:244351851-244351873 GGGTTTCACCACGGCCAGGATGG - Intergenic
1063235692 10:4113289-4113311 GGGTTTCACCATAGCCAGGATGG - Intergenic
1063316690 10:5013575-5013597 AGGTTTAACCAGGTCCATCAGGG - Intronic
1064584767 10:16829026-16829048 GAGTTCCACCACATCCTGCAAGG + Exonic
1065181781 10:23133596-23133618 GGGTTTCTCCAGATCTGGGATGG + Intergenic
1065684881 10:28274294-28274316 GGGTTTCACCGGAGCCAGGATGG + Intronic
1065758310 10:28956360-28956382 GGGTTTCACCATAGCCAGGATGG - Intergenic
1067289814 10:44932533-44932555 GGGCCTCACGAGATCCTGCAGGG - Intronic
1067322587 10:45236075-45236097 GAGTTCCACCACATCCTGCAAGG + Intergenic
1067528425 10:47052430-47052452 GGAGTTCACCCGATCCAGCGCGG - Intergenic
1068716543 10:60195188-60195210 GGGTTTCACCGTAGCCAGGATGG - Intronic
1069625632 10:69866180-69866202 AGGTGTCACCAGATGCAGCCAGG - Intronic
1069900104 10:71702137-71702159 GGGGTTCTCCCGGTCCAGCATGG - Intronic
1081283043 11:41234591-41234613 GAGATTCACCAAATCAAGCATGG - Intronic
1082949179 11:58791901-58791923 AGGTTTCAACTGATCCATCATGG + Intergenic
1083195039 11:61081072-61081094 GGGTTTCACCACAGCCAGGATGG + Intergenic
1083511576 11:63213676-63213698 GGGTTTCTCCACAGACAGCAGGG - Intronic
1084084428 11:66848500-66848522 GGGCTGCACAGGATCCAGCATGG + Intronic
1085087512 11:73680457-73680479 GGGTTTCACCATGTCCAGGCTGG - Intronic
1085897631 11:80659037-80659059 GGGTATCATCAGATTCAGCTTGG - Intergenic
1087176848 11:95104252-95104274 GGGTTTCCCCACATCCAGGCTGG - Intronic
1091594343 12:1865686-1865708 GGGCTCCACCAGATGCAGCCCGG + Intronic
1091851587 12:3703280-3703302 GGGTTTCACCATAGCCAGGATGG + Intronic
1091917719 12:4281565-4281587 GTGTTTCATCAGCTCCAGGACGG - Intronic
1092131022 12:6113489-6113511 GGGTTTCACCATAGCCAGGATGG + Intronic
1096271409 12:50168462-50168484 GGGTTTCACCATGGCCAGCCTGG - Intergenic
1096473625 12:51895074-51895096 GGGTTCCACCAGATCCACCACGG - Intergenic
1096712547 12:53468000-53468022 GGGGTTGGCCAGATCCATCAAGG - Intronic
1097285440 12:57873614-57873636 GGGTTTCACCGTAGCCAGGATGG + Intergenic
1098769408 12:74535128-74535150 GGGTTTCACCATGTCCAGGATGG - Intergenic
1100136020 12:91554333-91554355 AGGTGCCACCACATCCAGCATGG - Intergenic
1100555053 12:95685060-95685082 GGGTTTCACCATGTCCAGGCTGG + Intronic
1101387727 12:104272595-104272617 GGGTTTCACCATAGCCAGGATGG - Intronic
1102306280 12:111807067-111807089 GGGTTTCACCGTAGCCAGGATGG - Intronic
1103349069 12:120270550-120270572 GGGTTTCACCATGGCCAGGATGG - Intergenic
1103580828 12:121914086-121914108 GGGTTTCACCATGCCCAGCCTGG + Intronic
1103605936 12:122086175-122086197 GGGTCTCACAAGATTCAGCAGGG - Intronic
1104151202 12:126085004-126085026 GGGTTTCACCAAATACATCTTGG - Intergenic
1104918375 12:132278075-132278097 GGGCTTCCCCAGAGCCCGCAGGG - Intronic
1106739154 13:32620458-32620480 GGGTTTCACCATTTACAGGATGG - Intronic
1110471658 13:75866641-75866663 GGGTTTCACCGTAGCCAGGATGG + Intergenic
1111362747 13:87196743-87196765 GGGTTTCACCATGGCCAGCCTGG - Intergenic
1112202689 13:97292003-97292025 GGGTTTCACCGTGTCCAGGATGG - Intronic
1115754823 14:36520044-36520066 GGGTTTCACCTGAGCCTGCCGGG + Exonic
1116599094 14:46895531-46895553 GGGTTTCACCATATTGACCAGGG - Intronic
1119399544 14:74353104-74353126 GGGTTTCACCATGTCCGACAGGG - Intronic
1119428383 14:74550507-74550529 GGGTTAGACCAGACCCAGTATGG - Intronic
1119724312 14:76913053-76913075 GGGTTTCACCATATTGACCAGGG - Intergenic
1125094203 15:35832038-35832060 GGGTTTCACCGTAGCCAGGATGG - Intergenic
1130004291 15:80079846-80079868 GGGTTTCACCGTAGCCAGGATGG + Intronic
1130324731 15:82870822-82870844 GGGTTTGGCCAGATCAACCATGG + Intronic
1130602717 15:85287798-85287820 GGGTTTCACCATAGCCAGGACGG - Intergenic
1130923567 15:88368670-88368692 GGGTTTCACCATCACCAGGATGG - Intergenic
1132708634 16:1256931-1256953 GGGCTCCTCCAGCTCCAGCAGGG - Exonic
1133826712 16:9284443-9284465 GGGTATTGCCAGAGCCAGCATGG + Intergenic
1134335795 16:13298709-13298731 GGGTTTCGCCAGATGAAGTACGG - Intergenic
1135568832 16:23532671-23532693 GAGCTTCTCCAGGTCCAGCAGGG + Exonic
1138037238 16:53621827-53621849 GGGTTTCACCATATTTAGCCAGG - Intronic
1138882287 16:61030993-61031015 GGGATTCCTCAGAGCCAGCAGGG + Intergenic
1140433344 16:74923668-74923690 GGGTTTCACCATGGCCAGGATGG + Intronic
1140774408 16:78236880-78236902 GGGTTTCACCATATTGATCAAGG - Intronic
1141072527 16:80970939-80970961 GGGTTTCACCATGTCCAGGCTGG - Exonic
1141113154 16:81286879-81286901 GGGTTTCACCATAGCCAGGTTGG - Intronic
1142303593 16:89273502-89273524 GGGTGTCACCATGTCCAGGATGG - Intronic
1143506968 17:7371993-7372015 GGGTTTCACCATGTTCGGCAAGG - Intergenic
1146132245 17:30288540-30288562 GGGTTTCGCCAGGTCCAGACTGG + Intronic
1146591272 17:34129934-34129956 GGGATGCACCTGAACCAGCAAGG + Intronic
1147183769 17:38702946-38702968 GGGTTTCTCCAGACCTCGCAGGG + Intergenic
1149710393 17:58736409-58736431 GGGTTTCATCACATCCAGGCTGG + Intergenic
1149917264 17:60621765-60621787 GGGTTTCACCATAGTCAGGATGG + Intronic
1150107706 17:62474603-62474625 GGGTTTCACCTTAGCCAGGATGG + Intronic
1150968965 17:70004899-70004921 GGGTTTCACCATATTGATCAGGG + Intergenic
1151531668 17:74710170-74710192 GGGTTTCACCGTAGCCAGGATGG + Intronic
1151626947 17:75282656-75282678 GGGTTTCACCAGTCACAGGATGG - Intronic
1155094279 18:22541026-22541048 GGGTTTCACCATAGCCAGGATGG - Intergenic
1155437691 18:25830321-25830343 GGTTCTCACCATATCTAGCAAGG + Intergenic
1156557374 18:38082831-38082853 GGGTTTCACCATAGCCAGGATGG - Intergenic
1157480058 18:48048085-48048107 GGGTTTAATCAGAGCCAGCCTGG + Intronic
1158367063 18:56748007-56748029 GGGTTTCAGCATATCTAGAAGGG + Intronic
1158809310 18:61013428-61013450 GTGTTTTAACACATCCAGCATGG - Intergenic
1161180572 19:2878471-2878493 GGGTTTCACCATAGCCAGGATGG - Exonic
1161671533 19:5614146-5614168 GGGTTTCACCATGTCCAGGCTGG + Intronic
1163324467 19:16594310-16594332 GGCTTTCCCCAGAGCCACCAGGG - Intronic
1163984550 19:20932989-20933011 GGGTTTCACCATTCCCAGGATGG - Intronic
1164848467 19:31457486-31457508 GGGTTTCACCATTTACAGGATGG + Intergenic
1165047853 19:33119825-33119847 GGCTTTCACCAAATTCACCAGGG - Intronic
1166889769 19:45983601-45983623 GGGTTTCACCATTTACAGGATGG + Intergenic
925896537 2:8476606-8476628 GGATTTTGCCAGATGCAGCAGGG + Intergenic
926822525 2:16868285-16868307 GTGTTTGACCAGAGCCTGCAGGG + Intergenic
926854556 2:17240469-17240491 GAGTTTCACCATAGCCAGGATGG + Intergenic
927590784 2:24356005-24356027 GGGTTTCACCATGTCCAGGCTGG - Intronic
928177041 2:29041435-29041457 TGGTTTTACCAGATTCACCATGG - Intronic
930157894 2:48124250-48124272 GGGTTTCACCATGGCCAGGATGG + Intergenic
931457685 2:62424969-62424991 TGGATTTACCAGCTCCAGCATGG + Intergenic
931777694 2:65554494-65554516 GGGTTTCACCATATTAAGCCAGG + Intergenic
932786769 2:74612086-74612108 GGGTTTCACCGTGTCCAGGATGG + Intronic
935535162 2:104285269-104285291 GGGTTTCACCTTAGCCAGGATGG + Intergenic
935800006 2:106686365-106686387 GGCTTTCACCATAGCCAGGATGG + Intergenic
936575047 2:113645996-113646018 GGGTTTCACCGTAGCCAGGATGG - Intergenic
936965031 2:118118946-118118968 GGGTTTGGCCAGTTCCGGCAGGG + Intergenic
937263936 2:120604292-120604314 GGGTTTCACCATAGCCAGGATGG - Intergenic
937859969 2:126700067-126700089 GGGCTTCAAAAGATCTAGCAAGG + Intergenic
940297435 2:152141781-152141803 GGGTTTCACCATATTGACCAGGG + Intronic
941464084 2:165804829-165804851 GTGTTTCACAAGATGCAGAAAGG - Intergenic
943134887 2:183897702-183897724 GAGTTTCACCAGAGCCAGTCAGG - Intergenic
943470324 2:188287566-188287588 GGGTTTCACCGTAGCCAGAATGG - Intergenic
943529006 2:189055078-189055100 GGGTTTCACCATAGCCAGGGTGG + Intronic
944555322 2:200882710-200882732 GGGTTTCACCATAGCCAGGATGG - Intronic
944847991 2:203688096-203688118 GGGTATCACCATAGCCAGGATGG - Intergenic
946857424 2:223966027-223966049 GGGTTTCACCGTAGCCAGGATGG - Intronic
948119662 2:235519975-235519997 GGGTTTCACCATGTCCAGGCTGG + Intronic
1169171537 20:3469741-3469763 GGGTTTCACCACGTCGATCAGGG + Intergenic
1170582635 20:17710761-17710783 GGCTTTCATCAGATCCAGAGAGG + Intronic
1172142612 20:32733979-32734001 GGGTTTCACCGTAGCCAGGATGG - Intronic
1173853295 20:46232572-46232594 GGGTTTCCCCAGACCCAGTGGGG - Intronic
1174638967 20:52026640-52026662 GGGTTTCACCATATTGACCAGGG + Intergenic
1174653485 20:52150009-52150031 GGGTTTCACCGTAGCCAGGATGG - Intronic
1174977957 20:55355838-55355860 GGGTTCCACAAGCTTCAGCATGG + Intergenic
1175175819 20:57111457-57111479 CAGTTTCTCCACATCCAGCAAGG + Intergenic
1178955842 21:37021085-37021107 GGGTTTCACCATGTCCAGGCAGG - Intergenic
1181175487 22:21032506-21032528 GGGTTGCAGCAGATCCTGCGGGG - Intronic
1181579864 22:23822214-23822236 GGCTTTGCCCAGTTCCAGCAGGG + Intronic
1181714473 22:24714075-24714097 GGGTTTCACCATATCAGCCAGGG + Intergenic
1182089302 22:27583326-27583348 GGGTTCCACAAGGTCCAGGAGGG + Intergenic
1183317884 22:37146862-37146884 GGCTTACATCAGAGCCAGCATGG + Intronic
1183411464 22:37657404-37657426 GGGTTTCACCGTAGCCAGGATGG + Intronic
1183489904 22:38110727-38110749 GGGCGTAACCAGATCCGGCAGGG + Intergenic
1183767418 22:39891810-39891832 GGGTTTCACCATATTGACCAGGG + Intronic
1184136137 22:42550943-42550965 GGGTCTCACCAGAGCCACTAGGG - Intergenic
1184223680 22:43116745-43116767 GGGTTTCACCAGGCCGGGCACGG - Intronic
1184641753 22:45876686-45876708 GGGTCTCCCCAGGTCCGGCATGG + Intergenic
1185356212 22:50372879-50372901 GGGTTTCACCATATTGACCAGGG + Intronic
1185425126 22:50764879-50764901 GGGTTTCACCGTAGCCAGGATGG + Intergenic
949404323 3:3698532-3698554 GGGTTTCACCATTGCCAGGATGG + Intergenic
950456006 3:13093149-13093171 TGGTTTCACCAACTCCAGCTGGG + Intergenic
951190315 3:19761364-19761386 GTGCTTCATCAGATCCAGCAAGG - Intergenic
953662689 3:44902405-44902427 GGGTTTCACCATGGCCAGGATGG - Intronic
954769555 3:52953930-52953952 GGGTTTCACCATTGCCAGGATGG - Intronic
956192739 3:66622647-66622669 GGGCTTCCCCAGATAGAGCAGGG - Intergenic
957044372 3:75362585-75362607 GGGATTCCCCAAACCCAGCAAGG + Intergenic
957220307 3:77373975-77373997 GGGTTTCACCATGTCCAGGCTGG - Intronic
959814328 3:110657899-110657921 AGCTTTCAGCAGATCCAGCCAGG + Intergenic
960858675 3:122129211-122129233 GGGTTTCACCATAGCCAGGATGG - Intergenic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
962361827 3:134749323-134749345 GAGTATCACCAGATCAGGCAAGG + Intronic
962621788 3:137187504-137187526 GGGCATCACCAGAGCCAGGAAGG + Intergenic
963328731 3:143891001-143891023 GAGTTTCAACAGAGCCAGGACGG - Intergenic
963501514 3:146132979-146133001 GGGTTTCACCATAGCCAGGATGG - Intronic
964663995 3:159152043-159152065 GGAATTCACCAAATCGAGCATGG - Intronic
966428701 3:179808878-179808900 GGGTTTCACCTTAGCCAGGATGG - Intronic
967090408 3:186130117-186130139 GGGTTTCACCATGGCCAGGATGG - Intronic
967106944 3:186261725-186261747 GGGGTTCACCAAGACCAGCAGGG + Exonic
967934205 3:194713667-194713689 GGATTTCCCCAGATCTAGGATGG - Intergenic
969558746 4:7932053-7932075 GGGTTTCACCATAACCAGGATGG + Intronic
970854503 4:20636648-20636670 GGGTTTCACTAAAACCAGGATGG - Intergenic
974528082 4:63071352-63071374 GGGTTTCACCATATTCAGGCTGG - Intergenic
974791435 4:66695343-66695365 GGGTTTCACCGTAGCCAGGATGG - Intergenic
974970730 4:68823311-68823333 GGGTTTCACCATATCGTTCAGGG - Intronic
974985060 4:69013096-69013118 GGGTTTCACCATATCGTTCAGGG + Intronic
975646779 4:76553681-76553703 GGGTTTCACCACATTGCGCAGGG + Intronic
982174446 4:152692416-152692438 GGGTTTCACCACATTCAGGCTGG - Intronic
984913333 4:184697071-184697093 GGGTTTCACCATATCGCCCAAGG + Intronic
985677412 5:1239145-1239167 GGGTTTGAGCAGCTCCTGCATGG - Intronic
987010562 5:13758924-13758946 GGCTTTCTGCAGATCCTGCATGG + Exonic
989059056 5:37392374-37392396 GGGTTTCACCATATCGGCCAGGG + Intronic
990594085 5:57295677-57295699 GGGTTTCACCACATTGACCAAGG - Intergenic
991523297 5:67526103-67526125 GGGTTTCACCATAGCCAGGATGG - Intergenic
991620595 5:68541030-68541052 GGCTTTCACTTGATACAGCAGGG + Intergenic
993032751 5:82723927-82723949 GGGTTTCACCGTAGCCAGGATGG - Intergenic
994087982 5:95781076-95781098 AGGTTGGAACAGATCCAGCAGGG + Intronic
994494886 5:100499412-100499434 GGGTTTCACCATATTGACCAGGG - Intergenic
995501295 5:112809802-112809824 GGGTTTCACCAAGGCCAGGATGG - Intronic
996609869 5:125365897-125365919 TGGCTTGACCGGATCCAGCAGGG + Intergenic
997311953 5:132893673-132893695 GGGTTTCACCATGGCCAGGATGG + Intronic
997757543 5:136413739-136413761 GGGCTTCACCAGATGCTGAAAGG - Intergenic
998099773 5:139423027-139423049 GGGTTTCACCGCAGCCAGGATGG + Intronic
998236682 5:140403604-140403626 GGGTTTCACCATGTCCAGGATGG + Intronic
998415667 5:141944572-141944594 GGCTTTCCCAAGATCAAGCAGGG - Exonic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1000601813 5:163284340-163284362 GGGTTTCACCATAGCCAGGATGG - Intergenic
1000774028 5:165394775-165394797 GGGTTTCACCATGTCCAGGCTGG - Intergenic
1001041159 5:168336376-168336398 GGGTTTCACCACATTGACCAGGG - Intronic
1001243333 5:170086813-170086835 GGGTTTTACCATACCCAACAGGG - Intergenic
1001543806 5:172557725-172557747 GGGATTCACCAGATGCAGACAGG + Intergenic
1001728354 5:173927582-173927604 GGGTTTCACCATACCCGGCTAGG - Intronic
1002535624 5:179874003-179874025 GGGACTCTCTAGATCCAGCAGGG - Intronic
1002581828 5:180213297-180213319 GGTTTTCACCAGACCAAGAATGG - Intergenic
1006316742 6:33296019-33296041 GGGTCTCACCGCATCTAGCAGGG + Exonic
1006971274 6:38048196-38048218 GGGTTTCGCCATGTCCAGGATGG + Intronic
1007257910 6:40541501-40541523 GGTATTCACAAGATCCAGGACGG + Intronic
1007750648 6:44068689-44068711 GGGTCTCAGCAGAGGCAGCAGGG + Intergenic
1010202883 6:73298626-73298648 GGGTTTCACCATGTCCGTCAGGG + Intronic
1012415335 6:99006652-99006674 GGGTTTCACCGTAGCCAGAATGG + Intergenic
1012618934 6:101315464-101315486 GGGTTTCACCATTTACAGAATGG + Intergenic
1012953926 6:105548349-105548371 GGGTTTCACCACATTGACCAAGG + Intergenic
1013323714 6:109022609-109022631 GGGTTTCACCATAGCCAGGATGG + Intronic
1015951569 6:138558614-138558636 GGGTTTCACCATGTTCAGGACGG + Intronic
1016964714 6:149708220-149708242 GGGTTTCACCATATTGACCAGGG - Intronic
1016981328 6:149857334-149857356 GGGTTTCACCAGTTCCAGGCTGG - Intronic
1019221190 6:170474221-170474243 GGGTTTCACCAGATCACCAAAGG - Intergenic
1020688829 7:11329477-11329499 GCGTTTCACCAGATCCTGGGAGG + Intergenic
1021981371 7:26058804-26058826 GCCTTTCCCCAGATGCAGCATGG - Intergenic
1022611887 7:31883980-31884002 TGGTTTCAACAGATCCAGAGAGG + Intronic
1022779868 7:33569556-33569578 GGATTTCACCATAGCCAGGATGG - Intronic
1024023067 7:45388272-45388294 GGGCTTCACCAGTATCAGCAGGG + Intergenic
1026690055 7:72543609-72543631 GGGTTTCACCATAACCAGGATGG + Intergenic
1028554048 7:92103496-92103518 GGGTTTCAGCATAGCCAGGATGG - Intronic
1029288673 7:99484734-99484756 GGGTTTCACCATATCACCCAGGG - Intronic
1029379446 7:100203376-100203398 GGGTTTCACCATCGCCAGGATGG + Intronic
1030032574 7:105383262-105383284 GGGTTTCACCGTAGCCAGGATGG + Intronic
1030590898 7:111480275-111480297 GGGTTTCACCGTAGCCAGGATGG + Intronic
1031562174 7:123251631-123251653 CTGTTTCACCAATTCCAGCATGG + Intergenic
1032208702 7:129892144-129892166 GGGTTTCACCGTAGCCAGGATGG + Intronic
1032642541 7:133785864-133785886 GGGTTTCACCATAACCAGGATGG + Intronic
1032670754 7:134080438-134080460 TGGTTACACCAGATCCCTCAAGG - Intergenic
1035210241 7:157322475-157322497 GGGTTTCACCGTAGCCAGGATGG - Intergenic
1035469541 7:159100873-159100895 GGGTCTCACGAGATCCGACAAGG + Intronic
1040373138 8:46796659-46796681 TGGTTTCCCCAGAGCCAGGATGG - Intergenic
1042583913 8:70313971-70313993 GGGTTTCACCGTAGCCAGGATGG - Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1044739380 8:95310227-95310249 GGGTTTCACCATAGCCAGGATGG - Intergenic
1044975870 8:97664951-97664973 GGGTTTCACCACATTGACCAAGG + Intronic
1045595523 8:103650597-103650619 GGGCTTCACCCACTCCAGCAAGG - Intronic
1049036647 8:140081536-140081558 GGGTTTCACCATATTGACCAGGG + Intronic
1052647419 9:31254284-31254306 GGATTTCACCAGAACCCGCCTGG + Intergenic
1053364216 9:37511401-37511423 GTGTGTCCCCAGATCCAGCCTGG - Exonic
1053518678 9:38754519-38754541 GGGTTTCACCTTGTCCAGGATGG + Intergenic
1055243870 9:74217585-74217607 GGGTTTCACCATAGCCAGAATGG - Intergenic
1058118297 9:101109169-101109191 GGGTTTCACCGTAGCCAGGATGG + Intronic
1060905323 9:127299760-127299782 CGGTTTCACCATAGCCAGAATGG + Intronic
1061642942 9:131973908-131973930 GGGTTTCACCATAGCCGGGATGG + Intronic
1185463175 X:341575-341597 GGTTTTCCCCAGATCCAGGCAGG + Intronic
1187298069 X:18021877-18021899 GGGTTTTACCATGTCCAGGATGG + Intergenic
1187476296 X:19614090-19614112 GGGTTTCACCTGAGGCAGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188687242 X:33083874-33083896 GGGTGTCTGTAGATCCAGCATGG - Intronic
1193111571 X:77735397-77735419 GGGTTTCACCGTAGCCAGAATGG - Intronic
1194721078 X:97340846-97340868 GGGTTTCACCACATCCAGGTTGG + Intronic
1194996333 X:100595310-100595332 GGGTTTCACCATAGCCAGGATGG + Intronic
1195313026 X:103652615-103652637 GGGTTTCACCTTAGCCAGGATGG + Intergenic
1195822732 X:108964706-108964728 GGGTTTCACCACTCACAGCATGG - Intergenic
1199055633 X:143290707-143290729 GGGTTTCACCATAGCCAGGATGG + Intergenic
1200759107 Y:7020386-7020408 GGGTTTCACCATATTGACCAGGG - Intronic
1200825661 Y:7637331-7637353 GGGTTTCACCATAGCCAAGATGG - Intergenic
1200881464 Y:8217205-8217227 GGGTTTCACCATAGCCAGGATGG - Intergenic
1200957287 Y:8963223-8963245 GGGTTTCACCATAGCCAGGATGG + Intergenic
1201337817 Y:12899190-12899212 GGGTTTCACCATATCGACCAGGG - Intergenic
1201453462 Y:14142154-14142176 GGGTTTCACCATATTGACCAGGG + Intergenic
1201674969 Y:16570908-16570930 GGGTTTCACCACATACCCCAGGG - Intergenic
1202105647 Y:21361678-21361700 GGGTTTCACCATAGCCAGGATGG - Intergenic
1202193495 Y:22270635-22270657 GGGTTTCACCATAGCCAGAATGG - Intergenic
1202234394 Y:22693757-22693779 GGGTTTCACCATAGCCAAGATGG + Intergenic
1202308765 Y:23502409-23502431 GGGTTTCACCATAGCCAAGATGG - Intergenic
1202562036 Y:26168179-26168201 GGGTTTCACCATAGCCAAGATGG + Intergenic