ID: 906573263

View in Genome Browser
Species Human (GRCh38)
Location 1:46862703-46862725
Sequence GCACCAGTGTTGGCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906573263_906573266 9 Left 906573263 1:46862703-46862725 CCTGGAGCAGCCAACACTGGTGC No data
Right 906573266 1:46862735-46862757 TCACCCTGGTGCCCAAGAACAGG No data
906573263_906573265 -5 Left 906573263 1:46862703-46862725 CCTGGAGCAGCCAACACTGGTGC No data
Right 906573265 1:46862721-46862743 GGTGCTAGTATACATCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906573263 Original CRISPR GCACCAGTGTTGGCTGCTCC AGG (reversed) Intergenic