ID: 906573468

View in Genome Browser
Species Human (GRCh38)
Location 1:46865221-46865243
Sequence ACAGGCCATCTAGACAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906573467_906573468 -6 Left 906573467 1:46865204-46865226 CCAACTCTCAGCTTTAGACAGGC No data
Right 906573468 1:46865221-46865243 ACAGGCCATCTAGACAAATTTGG No data
906573465_906573468 -5 Left 906573465 1:46865203-46865225 CCCAACTCTCAGCTTTAGACAGG No data
Right 906573468 1:46865221-46865243 ACAGGCCATCTAGACAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906573468 Original CRISPR ACAGGCCATCTAGACAAATT TGG Intergenic
No off target data available for this crispr