ID: 906581077

View in Genome Browser
Species Human (GRCh38)
Location 1:46935527-46935549
Sequence CCACCTGGATGCTGCCCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 2, 1: 0, 2: 2, 3: 24, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906581072_906581077 8 Left 906581072 1:46935496-46935518 CCCTGCAGCTGGAGGGTTGTCAC 0: 2
1: 0
2: 0
3: 9
4: 126
Right 906581077 1:46935527-46935549 CCACCTGGATGCTGCCCTGATGG 0: 2
1: 0
2: 2
3: 24
4: 269
906581073_906581077 7 Left 906581073 1:46935497-46935519 CCTGCAGCTGGAGGGTTGTCACT 0: 2
1: 0
2: 0
3: 16
4: 158
Right 906581077 1:46935527-46935549 CCACCTGGATGCTGCCCTGATGG 0: 2
1: 0
2: 2
3: 24
4: 269
906581068_906581077 28 Left 906581068 1:46935476-46935498 CCACTTGATAAGAACAAGGGCCC 0: 2
1: 0
2: 0
3: 4
4: 60
Right 906581077 1:46935527-46935549 CCACCTGGATGCTGCCCTGATGG 0: 2
1: 0
2: 2
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906581077 Original CRISPR CCACCTGGATGCTGCCCTGA TGG Exonic