ID: 906581748

View in Genome Browser
Species Human (GRCh38)
Location 1:46940838-46940860
Sequence CTGTGCTCCCTGGCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906581743_906581748 7 Left 906581743 1:46940808-46940830 CCTCATGGCATGGATTCCTCAGA 0: 1
1: 0
2: 0
3: 20
4: 227
Right 906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG 0: 1
1: 0
2: 0
3: 20
4: 248
906581742_906581748 16 Left 906581742 1:46940799-46940821 CCATAAACTCCTCATGGCATGGA 0: 1
1: 1
2: 1
3: 17
4: 199
Right 906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG 0: 1
1: 0
2: 0
3: 20
4: 248
906581746_906581748 -9 Left 906581746 1:46940824-46940846 CCTCAGATGGGTGTCTGTGCTCC 0: 2
1: 0
2: 3
3: 23
4: 205
Right 906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG 0: 1
1: 0
2: 0
3: 20
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906581748 Original CRISPR CTGTGCTCCCTGGCAAACAC AGG Intronic
900708193 1:4093857-4093879 GTTTGCACCCTGGCAAATACAGG - Intergenic
900893421 1:5466044-5466066 ATGGGCTCCGTGGCAGACACAGG + Intergenic
901455585 1:9361086-9361108 CTCTGCTCCCGGGCAGACCCTGG - Intronic
903344685 1:22676874-22676896 CAGTGCTCCCTGGGAAATTCTGG + Intergenic
904770162 1:32876690-32876712 CTGTTCTCACTGGCGAACAGCGG + Intergenic
904868032 1:33597601-33597623 CTGTACATCCTTGCAAACACTGG - Intronic
904935226 1:34125439-34125461 ATGTGCTCCAGGGCACACACAGG + Intronic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906601969 1:47138060-47138082 CTGTGCTCCCAGGCAAATGCAGG - Intronic
907222097 1:52914578-52914600 CTGGGCTCCTGGGCACACACGGG - Intronic
910322484 1:85963717-85963739 CTGTGTTACCTAGTAAACACAGG - Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915251596 1:154593323-154593345 CTCAGCTCCCTGGCAGACAGTGG + Intronic
919149315 1:193675098-193675120 CTGTGCTCTCTGGCACACTGTGG - Intergenic
920978095 1:210804637-210804659 CTGTGCTACCTGCCAAGGACAGG + Intronic
1070345426 10:75537010-75537032 CTGTGCTCCCTGGCAATTCTAGG - Intronic
1072460366 10:95612770-95612792 CTGTGGTGCTTGGCAAACACAGG + Intronic
1075482239 10:122791866-122791888 CTGTGCGCACTGGCTACCACAGG + Intergenic
1076381399 10:130026816-130026838 CTGTGCTCCCTGGAACACCGTGG - Intergenic
1076834437 10:133014024-133014046 CTGTGCTCCCTGGTCGACCCTGG - Intergenic
1077135708 11:997275-997297 CTGTGCTCCCCAGCACACCCGGG - Intronic
1077210551 11:1369244-1369266 CCGTTCTCCCTGGCACACACAGG - Intergenic
1078453532 11:11457714-11457736 ATGTGCTCCCAGGAAACCACTGG + Intronic
1078492210 11:11780072-11780094 CCCAGGTCCCTGGCAAACACTGG - Intergenic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1082847885 11:57741177-57741199 CTCTCCTCCCTGGCAACCGCAGG - Intronic
1086014273 11:82146981-82147003 CTCTGCTCCAGGGTAAACACTGG - Intergenic
1086356066 11:86001114-86001136 GTGTCTTCCCTGGCAAGCACTGG - Exonic
1086890630 11:92254151-92254173 CTGTGCTCCCTAGAAGACAGAGG + Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088814750 11:113413286-113413308 CTGTTCTCCCTGTCAAACAAGGG + Intronic
1089638690 11:119832887-119832909 CTGTGCTCCCTGGAAACCCCAGG - Intergenic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1090505186 11:127304350-127304372 CTCTGCTCTCTGGGAAACCCAGG - Intergenic
1092913860 12:13172096-13172118 CTGTGTTGCCTGGCAACCAGAGG - Intergenic
1093390805 12:18618257-18618279 CTATAGTCTCTGGCAAACACAGG - Intronic
1094438016 12:30443441-30443463 CTTTGCTCCCTGGAAAAGAAGGG + Intergenic
1101789006 12:107911418-107911440 CTGTGCTTCCTCCCAGACACAGG + Intergenic
1101988773 12:109467758-109467780 TGGTGCTGCCTGGAAAACACAGG - Intronic
1102507554 12:113393181-113393203 CTGTGCACCCTGGGAAACTCAGG - Intronic
1104200142 12:126580689-126580711 CTGTGCTCCCTGGTTAACTCTGG - Intergenic
1104619619 12:130301481-130301503 CTGAGCTCCCTGCCCAACACAGG + Intergenic
1105068456 12:133219305-133219327 CTCAGCTCCATGGCAGACACAGG + Exonic
1105595867 13:21837351-21837373 CTCTGCTCCAGGGCAGACACTGG + Intergenic
1108257319 13:48623218-48623240 CTGTCCACCCTGTCAAAGACTGG + Intergenic
1112991286 13:105516566-105516588 CTGTGCTCACTGGAAATTACAGG + Intergenic
1113069793 13:106409388-106409410 CTGTGATTGCTGGCAAAGACAGG + Intergenic
1113218450 13:108070430-108070452 CTGTGTTCCCAGGCAAGCGCTGG + Intergenic
1113375793 13:109764641-109764663 CTGTGCTGCCAGGGAAAGACAGG + Intronic
1113836391 13:113330971-113330993 CTGGGCTCCCATGCACACACTGG - Intronic
1114955733 14:27816416-27816438 ATGTTCTCACTGGCAAAGACAGG + Intergenic
1115060427 14:29181843-29181865 CTGTGCTCCCTGTCATACCAAGG + Intergenic
1117101369 14:52351785-52351807 TTATGCTCCTTGGCAAAGACTGG - Intergenic
1117763312 14:59055858-59055880 CTGTGCTGCCTGGCATCTACTGG - Intergenic
1118411923 14:65488403-65488425 CTGAGCTCCCTGAAAAGCACAGG - Intronic
1118849576 14:69573518-69573540 CTGTGCGCCCTGGGAATCAGGGG + Exonic
1119002201 14:70892621-70892643 CTTTCCTCCCTGGAAAATACTGG + Intergenic
1121265629 14:92600644-92600666 GTGTGCTGCCTGGCACACAGTGG - Intronic
1121272598 14:92648232-92648254 GTTTGCACCCTGGCAAACCCTGG - Intronic
1121687942 14:95853239-95853261 CTGTCCTTCCTGCCAAACTCAGG - Intergenic
1124864313 15:33473933-33473955 GTGTGCTCACTGTGAAACACAGG - Intronic
1127846183 15:62873522-62873544 CTGTCCTGCCTCTCAAACACTGG - Intergenic
1127859251 15:62979326-62979348 GTGTGCTCCCTGGGAACCATTGG - Intergenic
1129329321 15:74818914-74818936 GTGAGGTCCCTGGCACACACGGG + Intronic
1129459602 15:75693893-75693915 CTTTGCTCCTTGGCAGACTCAGG - Intronic
1129697376 15:77748281-77748303 CTTTGCCCACTGGCAAACTCTGG - Intronic
1130272381 15:82458790-82458812 CTTTACTCCTTGGCAAACTCAGG + Intergenic
1130464732 15:84186143-84186165 CTTTACTCCTTGGCAAACTCAGG + Intergenic
1130487953 15:84408661-84408683 CTTTACTCCTTGGCAAACTCAGG - Intergenic
1130499534 15:84487394-84487416 CTTTACTCCTTGGCAAACTCAGG - Intergenic
1130587024 15:85190757-85190779 CTTTACTCCTTGGCAAACTCAGG + Intergenic
1133204349 16:4224068-4224090 CTGTGCTCCCTGGGCAGCTCTGG - Intronic
1133301149 16:4783686-4783708 CTGTCGGCCCTGGCAATCACGGG + Exonic
1133573665 16:7066755-7066777 CTTTTCTCCCTGGAAAACCCTGG - Intronic
1133856821 16:9557455-9557477 CTGAGAACACTGGCAAACACAGG - Intergenic
1134612623 16:15622116-15622138 CTGTGTGCTCTGGCACACACAGG + Intronic
1135472377 16:22742849-22742871 CTGTACTCCAAGGAAAACACTGG + Intergenic
1135503514 16:23017039-23017061 CTGGGCTCAGTGGCACACACCGG - Intergenic
1135550312 16:23392601-23392623 CTGATCTCAATGGCAAACACAGG + Intronic
1137554684 16:49463162-49463184 CCTTGCTTCCTGGCAAGCACAGG - Intergenic
1138022486 16:53497228-53497250 CTGTGGTGCCTGGCACACACGGG - Intronic
1138246479 16:55470619-55470641 CTGTGCTCCCTGGGATGGACTGG + Intronic
1139318242 16:66091739-66091761 CTGTGCTGCCTAGCTAACTCAGG + Intergenic
1143720061 17:8803132-8803154 CTGTGCTCCCAGGCACTCGCTGG + Exonic
1144631963 17:16878252-16878274 CTGGGCTGCCTGGCAGGCACTGG + Intergenic
1144696705 17:17308756-17308778 CTGTGCTCCCTGCCAGCCCCTGG + Intronic
1150070912 17:62149130-62149152 CTGTGCTCTCCTGCAAACCCGGG + Intergenic
1152039627 17:77894468-77894490 CTGTGCTTCCTTGCAACCCCAGG - Intergenic
1152115587 17:78385016-78385038 CTCTGCTTCATGGAAAACACTGG - Intronic
1152245643 17:79183343-79183365 CTGTGCTCCATGGCGAACTCGGG - Intronic
1153190956 18:2537883-2537905 CCTTGGCCCCTGGCAAACACTGG - Intronic
1154356241 18:13624796-13624818 CTGTGCCCCCTGGCAGAGCCTGG + Intronic
1155355389 18:24947553-24947575 TTGTGCTTACTGGCAAACATCGG + Intergenic
1157003813 18:43558972-43558994 GTCTGCTTCCTGGCAAACATGGG + Intergenic
1158337237 18:56426277-56426299 CTGTGCTCCTTGGCAAATTCAGG - Intergenic
1160390100 18:78523587-78523609 CAATGCTCCCTGCCAAACAGTGG - Intergenic
1160439752 18:78880286-78880308 CTGTGCTCGGTGGCAAGCACTGG - Intergenic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162109337 19:8391590-8391612 CTGGGCTCCCTGGCTGACAATGG + Intronic
1162156976 19:8684849-8684871 CTCTCCTCCTTGGCAAACCCAGG + Intergenic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1164655540 19:29918477-29918499 CTGTCCTCCCTGCCCCACACAGG + Intergenic
1164695944 19:30244393-30244415 TTGTGATCCCTGGAAAACAAAGG - Intronic
1165073638 19:33269244-33269266 CTCTGCTCCCTGGCAGGCAGGGG - Intergenic
1165312841 19:35039392-35039414 GAGTGCTCCCTGTCAGACACAGG + Intronic
1167488395 19:49776739-49776761 CTGGGCTCCCTGGCCATCACGGG + Intronic
1167862638 19:52297566-52297588 CTGTGCTCCAGGGCCAACAAAGG - Intronic
926777534 2:16437296-16437318 CTGTGGTTCCTGGCAAGCCCAGG + Intergenic
932617611 2:73244530-73244552 CTCTGCTCCCTGGGACACAAGGG - Exonic
933700602 2:85252741-85252763 TTGGGCTCCCTGGCAGGCACAGG - Intronic
934473754 2:94578668-94578690 CTTTTCTCACTGGCAAACATGGG - Intergenic
934481544 2:94651649-94651671 ATGTTCTCACTGGCAAAGACAGG - Intergenic
937285869 2:120750824-120750846 AAGTGCTCCCTGGTAAACATCGG - Intronic
937383439 2:121403458-121403480 CTGGGCTCTCTGGCCATCACAGG + Intronic
938764184 2:134449546-134449568 CTGGGCTCTCTGGACAACACAGG - Exonic
940135131 2:150426885-150426907 CTGTGGTGCCTGGCACACAGTGG + Intergenic
941888044 2:170549851-170549873 TTGCGCTCCCTTCCAAACACAGG - Intronic
942961115 2:181830718-181830740 CTGCTCTCCCTGGCACACAGAGG - Intergenic
943722054 2:191215284-191215306 CTTTGTTCCCTGGAAAACACAGG - Intergenic
947166128 2:227264147-227264169 CTCTGCTCTCTGGGAAACTCGGG - Intronic
1169161068 20:3378883-3378905 CTGTGTTCCCTGGAACACCCTGG - Intronic
1169998169 20:11582878-11582900 CTGGACTCACTGGCAGACACAGG - Intergenic
1170871120 20:20207517-20207539 CTGAGCTCCCAGGCAGAAACTGG + Intronic
1171324390 20:24278328-24278350 CTGTAGTCCCTGACTAACACTGG + Intergenic
1172134218 20:32676166-32676188 CTGTGCTCCCTGGAATTCCCAGG - Intergenic
1172152051 20:32797528-32797550 CTGTACACCCTGGGCAACACAGG - Intronic
1172566411 20:35934216-35934238 TTGTGCTCTCTGGCACACAGAGG + Intronic
1174078595 20:47955313-47955335 CTGTCCTCCATGGCAGTCACTGG + Intergenic
1174774186 20:53328681-53328703 ATGAGCTTCCTGGCAACCACTGG - Intronic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1175580863 20:60098045-60098067 CTGTAGTCCCTGGCAATCACTGG + Intergenic
1175668802 20:60883294-60883316 CTGTGCTCCCTGTTAAGGACGGG - Intergenic
1176115866 20:63431761-63431783 CTGTCCACCCTGGCCAACTCAGG + Intronic
1177003126 21:15637981-15638003 CTGTGCACACTGGTAAAGACAGG + Intergenic
1177757577 21:25366339-25366361 CTGTGCTTCCTGCCAACCCCAGG + Intergenic
1178425245 21:32473915-32473937 CTGTGCTCCGTGGCACAAAAAGG - Intronic
1178579094 21:33822089-33822111 CTGGGCCCCATGGCAGACACAGG - Intronic
1179319386 21:40275185-40275207 CTGGGCTCAGTGGCATACACTGG + Intronic
1179627546 21:42657261-42657283 CTGTGCACCCTGGCAAGCCAAGG - Intronic
1182650299 22:31846147-31846169 CTCTAATCCCTGGCAACCACTGG + Intronic
1183376402 22:37467894-37467916 CTCTCCTCCCTGGAAAACAAAGG + Intergenic
1185082473 22:48717694-48717716 CTGTGGTCCCTGGGAAGCACTGG - Intronic
950652618 3:14416661-14416683 CTGTGCCCTCTGGCACAGACTGG - Intronic
952090616 3:29880933-29880955 ATGAGCTCCCTGGAAAACAGAGG - Intronic
952709723 3:36417224-36417246 CTGAGCACCATGGCATACACAGG - Intronic
953032558 3:39187980-39188002 CTGTCCTGCATGGCATACACTGG + Exonic
953198629 3:40756617-40756639 CTGTGCTCCCTCTGAGACACTGG - Intergenic
954111349 3:48435091-48435113 ATGTGCTGCATGGCAAACCCAGG + Exonic
954499163 3:50993905-50993927 CTGTGCTGCCTCCCAACCACAGG + Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
954740469 3:52745629-52745651 CTCTGCTTCTTGCCAAACACTGG - Intronic
960054734 3:113269077-113269099 CTGTGCCTCCAGGCACACACAGG + Intronic
962168552 3:133076790-133076812 CTGAGCCCCATGGCAAAGACGGG - Intronic
962178864 3:133184014-133184036 CTGTACTGCCTGGCATCCACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962309530 3:134315313-134315335 CATTGTTCCTTGGCAAACACAGG + Intergenic
963217434 3:142764861-142764883 CTCTGCTCCCTCTTAAACACAGG + Intronic
965523556 3:169692983-169693005 CTATACTCCCTGGCAAACCAAGG + Intergenic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965667438 3:171110467-171110489 GTGATCTCCCTGGAAAACACTGG + Intronic
967871743 3:194235492-194235514 CTGTCCTCTCTGGCAAGCACAGG + Intergenic
1202738016 3_GL000221v1_random:26296-26318 CAGAGCTCCCTGGGAAACATAGG - Intergenic
968679942 4:1910889-1910911 CAGAGCTCCCTGGGAAACAAAGG - Intronic
969275786 4:6134988-6135010 CTGGGCTCCCTGGCAGGCCCTGG + Intronic
969694633 4:8727725-8727747 CTGGGCTGCCGGGCAGACACTGG + Intergenic
969707946 4:8822011-8822033 CTGAGCTCTCTTTCAAACACAGG + Intergenic
970372938 4:15426702-15426724 CTGAGCTCCCTGGCAGAGACTGG + Intronic
971192974 4:24445236-24445258 CTGTGGTCACTGGCATTCACAGG + Intergenic
974605486 4:64145108-64145130 CTGGGCTACCTGCCAAACAGGGG - Intergenic
980177950 4:129369567-129369589 CTGTGCTTCATACCAAACACTGG - Intergenic
981206554 4:142047744-142047766 CTCTGCTCCCTTGCAATCCCTGG - Intronic
985537048 5:471409-471431 CTGTTCTCCCAGGCACAGACAGG + Exonic
986043774 5:4018348-4018370 CTGGTCTTCCTGTCAAACACAGG - Intergenic
986394606 5:7316006-7316028 CTGTGATCCTTGGAAAAGACAGG - Intergenic
987466425 5:18277163-18277185 TTGTGGGCCCTGGCAACCACCGG - Intergenic
996507372 5:124283177-124283199 CTATGCTCCTCTGCAAACACTGG - Intergenic
997480099 5:134178171-134178193 CTGTGGCACCTGGCAGACACTGG - Intronic
998162945 5:139823593-139823615 GTGTGATCCCGGGCAAGCACTGG + Intronic
1000109719 5:158096354-158096376 CTCTGCCCCATGGCATACACAGG - Intergenic
1000456718 5:161458379-161458401 TTGTACTCTGTGGCAAACACTGG - Intronic
1002308868 5:178301829-178301851 CTGTGCTCCGGCGCACACACAGG - Intronic
1002308899 5:178302144-178302166 CTGTGCTCCGGCGCACACACAGG - Intronic
1004132463 6:12933713-12933735 CTGTGTTCCCTGGAAAACCACGG + Intronic
1009497858 6:64373620-64373642 CTGTGCCCCTTGGCAAATTCAGG + Intronic
1009957603 6:70474132-70474154 CTGTGCTCCCTGGCCTGCAGAGG + Intronic
1011633545 6:89350365-89350387 GTGTGCACCCTGCCATACACAGG + Intronic
1014132168 6:117846771-117846793 CTGTGCCCCTTGGCAAATTCAGG - Intergenic
1014250828 6:119114106-119114128 CTGTGGTCTCAGGCAACCACTGG + Intronic
1014747686 6:125219195-125219217 CTGGGTTCCCTGGAGAACACAGG + Intronic
1015633275 6:135252303-135252325 CTGTGGTACCTTGCACACACAGG + Intergenic
1016910238 6:149191815-149191837 CTCTGCCCCCAGGCAACCACTGG - Intergenic
1018745015 6:166755061-166755083 CTGGGCTCCTTGACAAGCACAGG - Intronic
1019217847 6:170455060-170455082 CTCTCCTCTCTGGCAAACCCGGG - Intergenic
1019500954 7:1364539-1364561 CTGAGCTCCCTGGTTTACACTGG + Intergenic
1022453493 7:30537421-30537443 CTGTGCTTCCTGGGGAGCACCGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024047841 7:45597113-45597135 CTGTGCTCTCCTGCAAACCCAGG - Intronic
1024602403 7:50995325-50995347 CTGTCCTCCCTGGCAAGAGCAGG - Intergenic
1025301278 7:57821246-57821268 CTTTGCTCCCTGGTAGGCACTGG + Intergenic
1027635607 7:80668920-80668942 CTATGATCCATGGCAAACATTGG - Intronic
1030267036 7:107631455-107631477 CAGTTATCTCTGGCAAACACAGG - Intergenic
1030612750 7:111706740-111706762 CTTTGCTCCTTGGCAATCAGAGG - Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032464358 7:132134569-132134591 CTGTGCTCCCTGGCAAGGGAAGG + Intronic
1032900381 7:136300634-136300656 CTCTGGACCCTGGCAACCACTGG + Intergenic
1034307713 7:150058960-150058982 GTGTGCATCCTTGCAAACACTGG - Intergenic
1034799135 7:154041709-154041731 GTGTGCATCCTTGCAAACACTGG + Intronic
1035444807 7:158932963-158932985 CTGTCCTCACTGGAACACACTGG - Intronic
1035640974 8:1184956-1184978 CTGAGCTCCCTAGCAAACCTGGG - Intergenic
1036495790 8:9268707-9268729 CTGTGCTGCCTGTCCAACTCAGG - Intergenic
1037870228 8:22487344-22487366 CTGGGCGCCCTGGCTCACACCGG + Intronic
1038882335 8:31628300-31628322 CTGTACTCCCTGGCAGCCCCAGG - Intergenic
1039389807 8:37169830-37169852 CTGTGCTCTCTGGGTACCACAGG + Intergenic
1039721753 8:40172305-40172327 CTGTGTTCCCTGGAGAAGACAGG - Intergenic
1047105637 8:121727617-121727639 CAGTGCTCCCTGGCTGACCCAGG - Intergenic
1047760282 8:127949477-127949499 CTGAGCTCCCTCCCAAAAACAGG - Intergenic
1048196878 8:132338676-132338698 CTGTGCTCTCAGGAACACACCGG + Intronic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1048809889 8:138276341-138276363 CTGTGCTCCTTGGCACATCCTGG - Intronic
1049320967 8:141996139-141996161 CCGTGCTGCCTGGCACACAGTGG - Intergenic
1049374627 8:142283281-142283303 CTCTGCTCATTGGCAGACACTGG - Intronic
1049374633 8:142283310-142283332 CTCTGCTCATTGGCAGACACTGG - Intronic
1049374745 8:142284044-142284066 CTCTGCTCATTGGCAGACACTGG - Intronic
1049483973 8:142841824-142841846 CTGTGCGCCAGGGCATACACTGG - Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049615242 8:143573037-143573059 CTGAGCTCCCTGGTCAACAGGGG - Intergenic
1050212087 9:3271803-3271825 CTGTGTTCCCAGCCAAACAGAGG + Intronic
1051696307 9:19771650-19771672 CTGAGCCCCCTGGAAACCACTGG + Intronic
1052029295 9:23610180-23610202 CTGTGCTGTCTGGCAAAGCCAGG + Intergenic
1053676290 9:40432459-40432481 ATGTTCTCACTGGCAAAGACAGG + Intergenic
1053684576 9:40509844-40509866 CTTTTCTCACTGGCAAACATGGG + Intergenic
1053803073 9:41776130-41776152 CTGTGCTTCCTGGCAGGCAGGGG + Intergenic
1053926064 9:43058574-43058596 ATGTTCTCACTGGCAAAGACAGG + Intergenic
1053934543 9:43138122-43138144 CTTTTCTCACTGGCAAACATGGG + Intergenic
1054279149 9:63115117-63115139 CTTTTCTCACTGGCAAACATGGG - Intergenic
1054287429 9:63192434-63192456 ATGTTCTCACTGGCAAAGACAGG - Intergenic
1054289358 9:63267984-63268006 ATGTTCTCACTGGCAAAGACAGG + Intergenic
1054297672 9:63345306-63345328 CTTTTCTCACTGGCAAACATGGG + Intergenic
1054387392 9:64572530-64572552 ATGTTCTCACTGGCAAAGACAGG + Intergenic
1054395687 9:64649817-64649839 CTTTTCTCACTGGCAAACATGGG + Intergenic
1054430331 9:65155012-65155034 CTTTTCTCACTGGCAAACATGGG + Intergenic
1054500049 9:65866509-65866531 CTTTTCTCACTGGCAAACATGGG - Intergenic
1054508331 9:65943835-65943857 ATGTTCTCACTGGCAAAGACAGG - Intergenic
1056655305 9:88503885-88503907 CTCTCCTCCTTGTCAAACACAGG + Intergenic
1056804762 9:89719999-89720021 CGCTGCTCCCTGGCAGTCACTGG + Intergenic
1059353680 9:113683872-113683894 CTGTGCTCCCTGGCTCACTGAGG - Intergenic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1061609177 9:131735009-131735031 CTGTGCTCCCAGCGAACCACAGG - Intronic
1061632572 9:131882486-131882508 CTGTGCTTCCTGGCACACTGTGG + Intronic
1062035132 9:134379594-134379616 CTGTGCTCCCTGACAGCCGCAGG + Intronic
1062472929 9:136714080-136714102 CAGTGCTCCCTGGCCCACCCTGG - Intronic
1203692315 Un_GL000214v1:55876-55898 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203556500 Un_KI270744v1:2768-2790 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203643980 Un_KI270751v1:48315-48337 CAGAGCTCCCTGGGAAACATAGG - Intergenic
1186115935 X:6305186-6305208 ATATGCTACCTGGCAAAAACTGG + Intergenic
1186128212 X:6438725-6438747 ATGTTCTGCCAGGCAAACACTGG + Intergenic
1187098332 X:16168986-16169008 CTGTGCGCCCTGGGAAACCATGG + Intronic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1191714387 X:64184348-64184370 CCTTGCTCCCTGGCAAGCAAGGG - Intergenic
1191763025 X:64664503-64664525 CTGTGCCCCTTGGCAAATTCAGG - Intergenic
1191841678 X:65517791-65517813 CAGTGGTCCCTGGCACTCACAGG + Intronic
1195196301 X:102500646-102500668 CTGTGCTTCCTACCAAACCCTGG + Intergenic
1195330682 X:103796750-103796772 TTCTGCTCCCTGACAAATACCGG - Intergenic
1198031467 X:132757443-132757465 CTTTGCTCCCTGGCAGAGAGTGG - Intronic
1200097666 X:153671804-153671826 CCGTGCTCCCGGGAAAACAAAGG + Intronic
1202370486 Y:24192530-24192552 CTTTACTCCTTGGCAAACTCAGG - Intergenic
1202500298 Y:25477587-25477609 CTTTACTCCTTGGCAAACTCAGG + Intergenic