ID: 906581835

View in Genome Browser
Species Human (GRCh38)
Location 1:46941344-46941366
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 2, 1: 0, 2: 8, 3: 53, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906581831_906581835 16 Left 906581831 1:46941305-46941327 CCACTGCCTGTGCAGGTAGAGCT 0: 1
1: 1
2: 2
3: 20
4: 178
Right 906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG 0: 2
1: 0
2: 8
3: 53
4: 596
906581832_906581835 10 Left 906581832 1:46941311-46941333 CCTGTGCAGGTAGAGCTGAACTG 0: 1
1: 0
2: 1
3: 8
4: 124
Right 906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG 0: 2
1: 0
2: 8
3: 53
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900696630 1:4016170-4016192 CCGCAGCAGAAGAATGGGCAAGG + Intergenic
900700232 1:4043735-4043757 GAGGAGAAGCAGCATCAGCATGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902680284 1:18038931-18038953 CAGCAGAAACACAATGACCTTGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903502918 1:23811669-23811691 CAGCTGAGGCAGACAGAGCAAGG + Intronic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
903561567 1:24231914-24231936 CAGCTGAATCAGAATGTCCAGGG - Intergenic
904115790 1:28160834-28160856 CAGCAGAAGTAGGAAGAGCCAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905003309 1:34690539-34690561 CACAAGCTGCAGAATGAGCAAGG + Intergenic
905369111 1:37473919-37473941 CAGCAGATGCACAATGACCGAGG - Intergenic
905520249 1:38593541-38593563 CACCAGAAGCTGGAAGAGCAAGG - Intergenic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
905799140 1:40832278-40832300 CAGCACAGGCAGAAACAGCATGG - Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906513314 1:46423854-46423876 CAGCAGAAGTAGCATCATCAGGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907649613 1:56282560-56282582 CAGCAGAAGCAGCAAAGGCAAGG + Intergenic
907655319 1:56336251-56336273 GAGCAGAGGCAAAATGGGCAGGG + Intergenic
907745124 1:57205461-57205483 CAGCAGAATCACAATTACCAAGG + Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908543922 1:65146983-65147005 CAGCACCAGCATAATGCGCATGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
910351312 1:86301346-86301368 CAGCAAAAGCAGTATTAACAGGG - Intergenic
910510180 1:87994710-87994732 CAGAAGACGAAGAATAAGCAAGG - Intergenic
910620815 1:89252044-89252066 CAGCAAAAGCAGTACTAGCAGGG + Intergenic
910903479 1:92148258-92148280 CGGCAGAAACATTATGAGCAAGG - Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
913231275 1:116742506-116742528 CAGCACAAGCAGAAGGCGCTCGG - Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913339482 1:117744403-117744425 CAGCAGAAGGAAAATAACCAAGG - Intergenic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915054920 1:153119383-153119405 CAGGAGAACCAGAAAGACCACGG + Intergenic
915287015 1:154859532-154859554 CAGATGGACCAGAATGAGCAAGG + Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
916007306 1:160674302-160674324 CATCAGAGGCAGAATTGGCATGG + Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
918410498 1:184253626-184253648 CAGCAGAAGCTGAATCCACAAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919151257 1:193702139-193702161 CAGCAGTAAAAGAATCAGCAGGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
921636328 1:217499002-217499024 CAGCTGAAGCAAAATGGGCTGGG - Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922525873 1:226303384-226303406 CAGAAGAAGAAGAATACGCAGGG + Intronic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923268424 1:232334286-232334308 CAGCCAAAGCAGAAAGACCATGG + Intergenic
923861708 1:237898285-237898307 CAGCAGGAGCAGAATGGCCTGGG + Intergenic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
1062795885 10:344939-344961 CAGCAGATCCAGCCTGAGCAAGG + Intronic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1064735484 10:18378017-18378039 CAGCTGAAGCAGAATGTTCCTGG - Intronic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067277651 10:44849403-44849425 CAGCAGAGAGTGAATGAGCAAGG - Intergenic
1067786826 10:49256351-49256373 CAGCTAATGCAGAATGAACAAGG + Intergenic
1069022438 10:63503980-63504002 CAGCTCAAGTGGAATGAGCAAGG - Intergenic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070690719 10:78522829-78522851 CAGCAGAAGCACAATTACAAAGG - Intergenic
1070718898 10:78742949-78742971 CAGCAGCAGCAAAATAAACAAGG + Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071480145 10:86058969-86058991 CAGCAGATGGAGTTTGAGCAGGG + Intronic
1071669864 10:87598306-87598328 CAGAAAAAGCAGACTGGGCATGG + Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1072819108 10:98538627-98538649 CAGCAAAAGCAGAGTTGGCAGGG - Intronic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1073283861 10:102375369-102375391 CATCAGTAGCAAAATGCGCAGGG - Exonic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG + Intergenic
1074274476 10:111988317-111988339 CATCAGCAGCCCAATGAGCAAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1076297746 10:129400323-129400345 CAGCAGAAGGTGAATGACAATGG - Intergenic
1077109722 11:856759-856781 AATCAAAAGCAGGATGAGCAGGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080229452 11:30002488-30002510 CAGCAGCAGCTAAATCAGCAAGG + Intergenic
1080445835 11:32336238-32336260 CAGTAGAAGAAAAATGGGCAGGG - Intergenic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1081598560 11:44476165-44476187 CAACACAAGGAAAATGAGCAGGG + Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083264095 11:61538153-61538175 CAGCAGAACCAGAACGCTCAGGG - Intronic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1086586014 11:88452043-88452065 CAGCAGAAGCAAAATAAGCATGG - Intergenic
1086630814 11:89017602-89017624 AAGCAGAAGCTGAATGGCCAAGG + Intronic
1086738903 11:90342156-90342178 CAGCAGAAACAGAATTCTCAGGG - Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090861068 11:130652850-130652872 CAGCAGTAAATGAATGAGCATGG + Intergenic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091495938 12:972850-972872 CAACTGGAGCAGAATGAGCTAGG + Intronic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1092655763 12:10683405-10683427 CAGCAAAAGCAAAATTAGCTGGG - Intergenic
1092791672 12:12076057-12076079 CAGTACAAGCAGAATGGACAGGG + Intronic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1097492160 12:60283438-60283460 CTGCCAAAGCTGAATGAGCAAGG - Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097961289 12:65534140-65534162 CAGCACTACCTGAATGAGCAAGG - Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100501977 12:95183160-95183182 CAGCAGAAGCATAGTGGGAAGGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101980154 12:109399051-109399073 GAGCAGCAGCTGTATGAGCACGG + Intronic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102865938 12:116374009-116374031 CAGGAGAAGCGGACTGAGCCAGG + Intergenic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104924502 12:132306833-132306855 CCGTAAAAGCAGAATGACCACGG - Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1106449474 13:29866983-29867005 CAGCAGAAGGGGAAAGAACATGG + Intergenic
1106477249 13:30109168-30109190 CAGCAGAAGCAGACTCACCTTGG + Intergenic
1106523094 13:30515260-30515282 CAACAGAACCTGAATGAGCTTGG + Intronic
1106651994 13:31701071-31701093 CAGTAGGAGCAACATGAGCAAGG - Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1113220228 13:108092465-108092487 CCGCAGTGGCAGAAAGAGCAAGG - Intergenic
1113569989 13:111346686-111346708 CAGCAGAAGTACTGTGAGCAGGG + Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1114995605 14:28348109-28348131 CAGCATAAGCAAAATGAGTGTGG - Intergenic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1118433178 14:65742879-65742901 CAACAGATTCAGAATGAGAATGG + Exonic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1120853963 14:89196779-89196801 CAGAGGAAGCGGAATGAACATGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121458147 14:94052359-94052381 CAGCAGAGGCAGTTTGTGCAGGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122307572 14:100775668-100775690 CAGCAGGAGAAGAGTGGGCAGGG - Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124176779 15:27433433-27433455 CAGCTGAAGGAGAATGTCCAGGG - Intronic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1125214070 15:37249409-37249431 CAGCAGATTCAAAATGTGCAGGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126680426 15:51196963-51196985 CAGCAGATGCGGAATGACCATGG - Intergenic
1126878861 15:53072947-53072969 AAGCAGAGGCAGAAACAGCATGG + Intergenic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130075455 15:80685349-80685371 CAGCAGAAGCCGAAGAAGTATGG + Intronic
1131024877 15:89131893-89131915 CAGCATAAGCAGGATAAGCATGG + Intronic
1131938910 15:97539156-97539178 CATCAAAAAAAGAATGAGCATGG + Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132659141 16:1053831-1053853 CAGCAGGTGCAGACTGGGCAGGG + Intergenic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133621492 16:7530923-7530945 CAGCAGCAGCAGAATGTACCTGG + Intronic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136231374 16:28887542-28887564 CAGCAGAAGCTGGATGAGTTTGG + Exonic
1136749357 16:32619235-32619257 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137893441 16:52185780-52185802 CAGCAGAAGCAGTGGAAGCATGG - Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1138420987 16:56898941-56898963 CAGCCGAATCAGAATCAGCGTGG + Intronic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1140970494 16:80007796-80007818 CAGCAGAAGGCGAATGGACACGG - Intergenic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141640469 16:85338081-85338103 CAGCAAGAGCAGGACGAGCAGGG - Intergenic
1141667340 16:85472676-85472698 CAGCAGGGTCAGACTGAGCAAGG - Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1203051489 16_KI270728v1_random:878449-878471 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1143341342 17:6213750-6213772 AAGCAGAAGAAGACTGGGCACGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143912711 17:10265160-10265182 CAGCAGAGGCTGAATGGTCAAGG + Intergenic
1145901262 17:28491792-28491814 CAGCAGCAGCAAGATGACCATGG - Exonic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1152460669 17:80440623-80440645 CACCAGCAGCAACATGAGCATGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153748621 18:8206969-8206991 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153749043 18:8210443-8210465 CACCAGAAGCTGAAAGAACAAGG + Intronic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156044733 18:32864845-32864867 CCACTGGAGCAGAATGAGCAAGG - Intergenic
1156794653 18:41029055-41029077 CAGTAGAAGAGGAATGAGCTTGG + Intergenic
1157267279 18:46237151-46237173 TAACAGAAGCTGACTGAGCATGG - Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1159973020 18:74676911-74676933 GAGCAGAGGCTGACTGAGCAAGG + Intronic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160444107 18:78914016-78914038 CAGCTGGAGAAGAATGAGCCTGG - Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1161084903 19:2330483-2330505 CACCAGAAGCAGCATAAGCGGGG + Intronic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161527318 19:4764574-4764596 GAGCAGAGCCTGAATGAGCAAGG + Intergenic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164934675 19:32201559-32201581 AAGCAAAAGGAGAATCAGCAGGG + Intergenic
1164948812 19:32318836-32318858 CAGCAGAAGCAGTCTGTCCATGG + Intergenic
1165923904 19:39315265-39315287 GAGCAGCAGCAGAAAGGGCAGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166348226 19:42179950-42179972 CAGCAGATGCATAATGGACATGG + Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1168312217 19:55466067-55466089 GAGCAGAAGAGGAACGAGCAAGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168673670 19:58260583-58260605 CAGAAGAATAAGAATAAGCAGGG - Intronic
1168691442 19:58380018-58380040 CAACAAAAACAGAATGTGCAGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926572220 2:14542207-14542229 CAGCAGAAGTGCAATGAGCCAGG + Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929678042 2:43957726-43957748 CAGCAGAATCAGAGTCAGCCTGG + Intronic
930303853 2:49652880-49652902 CAGCAGAAGTAAAATGTGTAGGG + Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
930837067 2:55805692-55805714 AAGCAGCAGCAGAATTAACATGG - Intergenic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
931572632 2:63684966-63684988 CAGCAAAAGCAGTACTAGCAGGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932110018 2:68990255-68990277 CACCAGAAGCTGAAGAAGCAAGG - Intergenic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
933780242 2:85796033-85796055 CAGCTGAGGCAGAATGGGCCAGG - Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937244788 2:120485656-120485678 CACCAGGAAAAGAATGAGCAGGG - Intergenic
937345472 2:121122930-121122952 CAACAAAAGCAGAATTAGCTGGG - Intergenic
937884464 2:126890376-126890398 CAGCAGAGACAGAAACAGCAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
938936253 2:136130180-136130202 CAATAGTATCAGAATGAGCAGGG + Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942122328 2:172790662-172790684 CAGCAGAAGCATTTTAAGCAGGG - Intronic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942504461 2:176626905-176626927 GGGCTGAAGCAGAAAGAGCAAGG - Intergenic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943778120 2:191790188-191790210 AAACATAAGCAGAAAGAGCAAGG - Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947904197 2:233747884-233747906 CATAAGGAGCAGAAAGAGCATGG - Intronic
948861620 2:240755315-240755337 CAGCAGAGGCAGACAGAGCGAGG + Intronic
1169734343 20:8821894-8821916 CAGCAGAAACAGGAGAAGCATGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170099167 20:12679632-12679654 TAGCAGAATCAGAATGTGCGTGG + Intergenic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175913287 20:62414565-62414587 GAGGAGAAGCCGAATGACCATGG + Intronic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177671706 21:24239216-24239238 CACAAGAAGCTGAATGAGAATGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179265409 21:39798391-39798413 CGGCAGAGGGAGAAAGAGCATGG - Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180885287 22:19239177-19239199 CAGCAGAAGCAGACTAAAAATGG + Intronic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183079893 22:35449609-35449631 CAGCAGGGGCAGAAAGACCACGG - Intergenic
1183270319 22:36858219-36858241 CAGCAGGAGCAGCAAGAGCCCGG + Intergenic
1183303168 22:37068528-37068550 GAGCAGTAGCAGGAAGAGCAGGG + Intronic
1183548372 22:38467525-38467547 CAGCAGAATCAGACTGACCTCGG - Intergenic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184574314 22:45350065-45350087 CAGCAGACTCAGAAAAAGCAGGG - Intronic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950519345 3:13487323-13487345 CAGCACACACAGAATGACCAGGG - Intronic
950668783 3:14512922-14512944 CAGCACAGCCAGAATGGGCATGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951462528 3:22966947-22966969 CACCATAAGCAGACTGATCAGGG + Intergenic
952188964 3:31001800-31001822 CAGCAGAAGCAGGAACAACAGGG + Intergenic
953013319 3:39049428-39049450 CAGCGGAAGTACAGTGAGCAGGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953753231 3:45625361-45625383 CAGTAGATGCCGAATAAGCATGG + Intronic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956508215 3:69965203-69965225 CCGGAGGAGCAGTATGAGCATGG + Exonic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959637127 3:108588178-108588200 CAGAAGCCGCAGAATAAGCAGGG - Intronic
959809255 3:110595586-110595608 CAGCATAACCAGAATGACCTTGG + Intergenic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
960262815 3:115587956-115587978 CATCATTAGGAGAATGAGCAGGG - Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960847844 3:122021447-122021469 CACCTGATGCAGGATGAGCAAGG + Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961112729 3:124298748-124298770 CAGCATAATCAGAATGGTCATGG - Intronic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961823467 3:129586884-129586906 CAGCAGAGGCAGAAGCATCAAGG - Intronic
963422531 3:145078324-145078346 CACCAGAAGCTGAAGGAACAAGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964130142 3:153277539-153277561 CACCAAAACCAAAATGAGCAGGG - Intergenic
964429044 3:156584736-156584758 CAGCAAAAGCATAAAGAACAAGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
965122039 3:164572538-164572560 CAGCAGAGGCTGAATTAGTAGGG - Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966732072 3:183159579-183159601 CAGCAGAAGCAGCCCCAGCAGGG + Intronic
966763655 3:183439080-183439102 CAGCAGAAGCATTGTGTGCATGG - Intergenic
967255901 3:187591545-187591567 CAGCTGTGGCAGAAAGAGCAGGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970223209 4:13831468-13831490 CAGCTGCAGGAGAATGAGTAAGG - Intergenic
971565933 4:28141608-28141630 CAGCAGAAGCAGCAAGAGTTAGG - Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972373930 4:38452705-38452727 CAGCAGAAGAAGAAAGAATATGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977529341 4:98181894-98181916 CAGCAAAAGGAAAATGTGCATGG + Intergenic
978247738 4:106595292-106595314 CAGAAGAAGCAGAGTGAATAGGG - Intergenic
978255647 4:106689577-106689599 CAGCAGAGGAAGAGAGAGCAAGG - Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979551829 4:121999641-121999663 CAGCAGGAGTAAAAAGAGCATGG + Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980279000 4:130693618-130693640 CAGCAAAAGTAGAGGGAGCAAGG + Intergenic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982080805 4:151787668-151787690 CACCAGGAACAGAATTAGCATGG - Intergenic
982204794 4:152989671-152989693 CAGCAGAAGAAGGAAGAACAGGG + Intergenic
982410146 4:155066198-155066220 CGTAAGAAGGAGAATGAGCAAGG - Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983380413 4:166984628-166984650 CAGCAGAAACTGAATAAACAGGG + Intronic
984836190 4:184023939-184023961 CAGCTGAAGGAGAATAAACATGG - Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986885556 5:12230460-12230482 CACCAGAATCATAATGATCATGG - Intergenic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988492896 5:31719950-31719972 CAGCAGAGGCAGAATTGGCCTGG + Intronic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990095917 5:52112679-52112701 CAGCAAAAGCAGTACTAGCAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998987527 5:147777131-147777153 CAGCAGACAAAGAATGACCAAGG + Intronic
999297409 5:150468412-150468434 CAGCAGTGGCAGATGGAGCAGGG - Intergenic
999963461 5:156782962-156782984 CAGCCCATGGAGAATGAGCAGGG + Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001997042 5:176170410-176170432 CAGCAGTACCAGAATGTGCCTGG - Intergenic
1002199836 5:177521509-177521531 CAGCTGAAGCAGTATAAGAAGGG - Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1005283901 6:24303529-24303551 AAGCGCAAGAAGAATGAGCAGGG - Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1008465755 6:51828960-51828982 CAGGAGAGGGACAATGAGCAAGG + Intronic
1008487262 6:52049892-52049914 CAGCAGAATCAGCATCACCAAGG + Intronic
1009034144 6:58096105-58096127 AGGCAGAAGAAGCATGAGCAAGG - Intergenic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1014066714 6:117135483-117135505 CAGCAGCATCAGAATCACCAGGG - Intergenic
1014220514 6:118794479-118794501 TAGCAGACACTGAATGAGCAAGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1015947321 6:138516098-138516120 CAGCCGAAGCCGCAGGAGCATGG - Intronic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016550841 6:145278283-145278305 CAGCTGAAGCAAAAAGAGAAAGG + Intergenic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017549597 6:155491950-155491972 CAGCAGAAGCAGAAGAAACAAGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018345441 6:162894044-162894066 CAGCAAAACCAGAATGAAAAAGG - Intronic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1022073126 7:26937467-26937489 CAGAAGCAGCAGAATGGTCATGG + Intronic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023930955 7:44706285-44706307 CAGCAGAAACAGAGTAAACATGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024282587 7:47731716-47731738 CAGCAGAAGCATGATGAGCTAGG - Intronic
1024717286 7:52093774-52093796 CATCAGAACCAGACTGACCAGGG + Intergenic
1024955523 7:54915282-54915304 CAGCTTAAGCAAAATGAGCAAGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1028110570 7:86935574-86935596 CAGCAGAATCAGAATTACCCGGG + Intronic
1029104788 7:98166087-98166109 CAGCCGAGGCAGACTCAGCAAGG - Intronic
1029665571 7:101992948-101992970 GACCAGCAGCAGAATGACCAGGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035165257 7:156985584-156985606 CAGCAGATGCAGGAGCAGCAGGG - Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041047029 8:53897264-53897286 CAGCACAAGCAGACTGGGCTAGG + Intronic
1041212603 8:55568101-55568123 CAGCAGGAGCACCAAGAGCAAGG - Intergenic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041508171 8:58624413-58624435 CAGCAAAAGCAGTATAAACAGGG - Intronic
1042522842 8:69732633-69732655 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042522984 8:69733980-69734002 CAGCAGAAAGACCATGAGCAGGG + Intronic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1047412420 8:124634770-124634792 CAGCAGCAGCAGAATCACCTGGG + Intronic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048720997 8:137324877-137324899 CAGCAGAAGCCATATGAACATGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050183049 9:2941215-2941237 CAGCAGGAGCCAAATGAACATGG + Intergenic
1050686600 9:8177339-8177361 CACCAAAAGCATTATGAGCATGG + Intergenic
1051013543 9:12448087-12448109 CTGCAGAAGCAGAACGCTCATGG + Intergenic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058509319 9:105699535-105699557 CACCAGAAGCAAAATGATAAAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058644995 9:107123143-107123165 AAGCAGAAGGAGTATGAGCTTGG + Intergenic
1058832918 9:108835398-108835420 AAGCATAGGCAGAATGGGCATGG + Intergenic
1060833450 9:126735318-126735340 CATCAGAAGTAGACTCAGCATGG + Intergenic
1060900753 9:127255839-127255861 CAGCAGAATCACAATGACCTTGG + Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185922040 X:4104109-4104131 CACCAGAAGCTGCAGGAGCAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186687913 X:11944865-11944887 CAGCAGTAGCACACTGAGAATGG - Intergenic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187263676 X:17710782-17710804 CAGTAAAGGCAGAATGTGCATGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1190151172 X:47950280-47950302 CAGCAAAAGCAGTACTAGCAGGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1191666239 X:63705718-63705740 CAGCAGCATCAGAATCACCAGGG + Intronic
1192015809 X:67329420-67329442 CAGCAAAAGCAGAACCAGTATGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197129684 X:122990748-122990770 CAGCAGAAGCTCAATGAAAATGG - Intergenic
1197687630 X:129458754-129458776 CAAAAGCAGCTGAATGAGCAAGG + Intronic
1198283254 X:135163867-135163889 CAGCAGAAGCATAATAGGCCAGG + Intronic
1198287704 X:135208608-135208630 CAGCAGAAGCGGAATAGGCCAGG - Intergenic
1198415804 X:136418600-136418622 CAGCAGCAGCAGAACAATCAAGG - Intergenic
1198971804 X:142289926-142289948 CAACAGAAGCAGAAAGGACATGG - Intergenic
1199235607 X:145488803-145488825 CAGGTGAGGGAGAATGAGCAAGG + Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic
1200980390 Y:9258642-9258664 CAGCAACAGCCCAATGAGCAAGG - Intergenic