ID: 906583403

View in Genome Browser
Species Human (GRCh38)
Location 1:46955070-46955092
Sequence TTCCTTTCTCTGTGTTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906583403_906583408 14 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583408 1:46955107-46955129 CTTTCTGCAGAAACTAAGGGAGG No data
906583403_906583405 10 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583405 1:46955103-46955125 CTGCCTTTCTGCAGAAACTAAGG No data
906583403_906583409 22 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583409 1:46955115-46955137 AGAAACTAAGGGAGGCATTGAGG No data
906583403_906583406 11 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583406 1:46955104-46955126 TGCCTTTCTGCAGAAACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906583403 Original CRISPR TTCCTTTCTCTGTGTTACAG TGG (reversed) Intergenic