ID: 906583404

View in Genome Browser
Species Human (GRCh38)
Location 1:46955099-46955121
Sequence AGTTTCTGCAGAAAGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906583404_906583411 28 Left 906583404 1:46955099-46955121 CCTACTGCCTTTCTGCAGAAACT No data
Right 906583411 1:46955150-46955172 CTGTCACCTGACTCTATTGAAGG No data
906583404_906583409 -7 Left 906583404 1:46955099-46955121 CCTACTGCCTTTCTGCAGAAACT No data
Right 906583409 1:46955115-46955137 AGAAACTAAGGGAGGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906583404 Original CRISPR AGTTTCTGCAGAAAGGCAGT AGG (reversed) Intergenic