ID: 906583405

View in Genome Browser
Species Human (GRCh38)
Location 1:46955103-46955125
Sequence CTGCCTTTCTGCAGAAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906583403_906583405 10 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583405 1:46955103-46955125 CTGCCTTTCTGCAGAAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906583405 Original CRISPR CTGCCTTTCTGCAGAAACTA AGG Intergenic