ID: 906583406 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:46955104-46955126 |
Sequence | TGCCTTTCTGCAGAAACTAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906583403_906583406 | 11 | Left | 906583403 | 1:46955070-46955092 | CCACTGTAACACAGAGAAAGGAA | No data | ||
Right | 906583406 | 1:46955104-46955126 | TGCCTTTCTGCAGAAACTAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906583406 | Original CRISPR | TGCCTTTCTGCAGAAACTAA GGG | Intergenic | ||