ID: 906583408

View in Genome Browser
Species Human (GRCh38)
Location 1:46955107-46955129
Sequence CTTTCTGCAGAAACTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906583403_906583408 14 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583408 1:46955107-46955129 CTTTCTGCAGAAACTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906583408 Original CRISPR CTTTCTGCAGAAACTAAGGG AGG Intergenic
No off target data available for this crispr