ID: 906583409

View in Genome Browser
Species Human (GRCh38)
Location 1:46955115-46955137
Sequence AGAAACTAAGGGAGGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906583403_906583409 22 Left 906583403 1:46955070-46955092 CCACTGTAACACAGAGAAAGGAA No data
Right 906583409 1:46955115-46955137 AGAAACTAAGGGAGGCATTGAGG No data
906583404_906583409 -7 Left 906583404 1:46955099-46955121 CCTACTGCCTTTCTGCAGAAACT No data
Right 906583409 1:46955115-46955137 AGAAACTAAGGGAGGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906583409 Original CRISPR AGAAACTAAGGGAGGCATTG AGG Intergenic