ID: 906584130

View in Genome Browser
Species Human (GRCh38)
Location 1:46961552-46961574
Sequence CTGCTCTTCCTGAGAACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906584121_906584130 30 Left 906584121 1:46961499-46961521 CCAACTATGTCAAAGCTGTGTGT No data
Right 906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG No data
906584126_906584130 5 Left 906584126 1:46961524-46961546 CCACAGGGGTGAGGTGTTCTTGG No data
Right 906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906584130 Original CRISPR CTGCTCTTCCTGAGAACAAA GGG Intergenic
No off target data available for this crispr