ID: 906593079

View in Genome Browser
Species Human (GRCh38)
Location 1:47046528-47046550
Sequence CTGGAAATGGACGGGACTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906593079_906593084 10 Left 906593079 1:47046528-47046550 CCTGCAGTCCCGTCCATTTCCAG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 906593084 1:47046561-47046583 AAGCCACTTACCTTCCCAGATGG 0: 1
1: 0
2: 2
3: 11
4: 174
906593079_906593089 28 Left 906593079 1:47046528-47046550 CCTGCAGTCCCGTCCATTTCCAG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 906593089 1:47046579-47046601 GATGGATGCACATTGCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906593079 Original CRISPR CTGGAAATGGACGGGACTGC AGG (reversed) Exonic
900238794 1:1605052-1605074 CTGGAAGTGGAGGGACCTGCAGG + Intergenic
900488105 1:2933084-2933106 CTGGGGATGGAAGGGAATGCAGG + Intergenic
903021364 1:20397555-20397577 CTGGAAATGGATGGGAGTAGGGG + Intergenic
903917330 1:26773912-26773934 CTGGGAATGGACTGGCATGCAGG + Intronic
905260357 1:36713297-36713319 ATGGAAATGCAAGGGACTCCAGG + Intergenic
906593079 1:47046528-47046550 CTGGAAATGGACGGGACTGCAGG - Exonic
907538370 1:55186829-55186851 CTGAAGATGGATGGGACTGATGG + Intronic
908273307 1:62442365-62442387 CTGGAAATGAAGAGGACTGGGGG + Intronic
910934394 1:92475697-92475719 CTGGAAATGGGAAGGACTGTGGG + Exonic
919779377 1:201212533-201212555 CTGGATATGAACGGGACATCTGG + Exonic
924010775 1:239663214-239663236 CTGGAAAAGGAGGGGGGTGCAGG - Intronic
1062910768 10:1210590-1210612 CTGGAAGTTGAAAGGACTGCAGG - Intronic
1066296350 10:34057175-34057197 CTGCACATGGTCGGGACAGCAGG - Intergenic
1072082558 10:92045996-92046018 CTGGAAGAGGACGGGGCCGCTGG - Intergenic
1073230475 10:101965081-101965103 CTGGAAATGGAAGGTAGTGATGG + Intronic
1073432862 10:103497924-103497946 CTGGACATGGAGGGAACTGCAGG + Intronic
1074976897 10:118588329-118588351 GTGGAAATGGTCGGGACTAGGGG - Intergenic
1076546061 10:131246387-131246409 CTGGACCTGGAGGGGTCTGCTGG + Intronic
1076711538 10:132338443-132338465 GTGGAAATGGACAGGACACCTGG - Intronic
1076993669 11:288568-288590 CTGGAAACGAAGGGGACTTCAGG - Intergenic
1077025653 11:438767-438789 CTGGAAGTGGAGGTGACTTCAGG - Intronic
1083265660 11:61545791-61545813 CTGGCAAAGGAAGGGACTGATGG + Intronic
1083855549 11:65391247-65391269 CTGGAAGTGTCTGGGACTGCGGG + Intronic
1085024372 11:73228081-73228103 CTGGACCTGGACCGGGCTGCAGG - Exonic
1087416776 11:97866638-97866660 TTGCAAATGGACGGAACTGGAGG - Intergenic
1089008855 11:115115907-115115929 CTGGAAATGGATAGCACTGATGG + Intergenic
1090112864 11:123934325-123934347 CTGGAAAAGGACAGGATTTCAGG + Intergenic
1092555528 12:9557139-9557161 CGGGAACTGCACGGGAGTGCAGG - Intergenic
1096439689 12:51630194-51630216 CTGGAAATGGATGGTGCTGATGG - Intronic
1096648343 12:53050017-53050039 CTGGAAGTGGAGGGAAGTGCAGG - Intronic
1097986348 12:65786761-65786783 CTGGCAATGGATGGGACATCTGG - Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106080049 13:26492785-26492807 CTGCAAATGGAGGGGAAAGCGGG - Intergenic
1108268474 13:48735224-48735246 CTGGGAAGGGCTGGGACTGCAGG + Intergenic
1108495757 13:51023596-51023618 CTGGAAATGGATGGTAGTGAAGG + Intergenic
1108575255 13:51784861-51784883 TGAGAAATGGAAGGGACTGCTGG - Intronic
1116150577 14:41136489-41136511 CTGGAAATGGAAGAGAGAGCTGG - Intergenic
1116574014 14:46550849-46550871 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1123802115 15:23832212-23832234 CTGGAAATGGATGGCAGTGATGG - Intergenic
1123892788 15:24798206-24798228 CTGGAAAGGGAGGGGATTTCAGG + Intergenic
1125295618 15:38199988-38200010 CTGGAAAATGAAGGGATTGCTGG - Intergenic
1128240639 15:66098928-66098950 CTGGCTATGGAGGGGACTGAGGG - Intronic
1128311172 15:66632490-66632512 CCGGGAAGGGAGGGGACTGCAGG - Intronic
1129118545 15:73380482-73380504 CTGGGAAGGGAAGGGACTGAAGG - Intergenic
1129518834 15:76172970-76172992 CAGGAAAAGGGCGGGACAGCTGG - Intronic
1132380985 15:101366644-101366666 CAGGAAATTGTCGGGACTGGGGG - Intronic
1132758118 16:1495838-1495860 CTGGAAACCCAAGGGACTGCAGG - Intronic
1133040968 16:3059514-3059536 CTGGAAAAGGAAGGTCCTGCGGG - Exonic
1134150395 16:11800315-11800337 CTGGAAAGGGAGGGGATTTCAGG + Intergenic
1134853431 16:17500357-17500379 CTGGAAGTGGACTGGACCTCTGG - Intergenic
1135075880 16:19393184-19393206 CTGGAAAAGGAGGGGACTTCAGG - Intergenic
1135387632 16:22057818-22057840 CTGGAAATGAAAGGAAGTGCAGG + Intronic
1135861831 16:26063330-26063352 CTGAAAATGGATAGGACAGCAGG - Intronic
1135918788 16:26629348-26629370 CTTGAAATGAACGCCACTGCAGG - Intergenic
1140037986 16:71385509-71385531 CTGGAATGGGTCGGGACAGCAGG + Intronic
1141618537 16:85223970-85223992 CTGGAAATGGAGGGAAGTGGTGG - Intergenic
1144769644 17:17752455-17752477 CTGGAAAGGGGCGGGGCTTCCGG + Intronic
1145036663 17:19545613-19545635 CTGGAAATAGCTGGGACTACAGG + Intronic
1145968188 17:28936300-28936322 CTGGAATTGGAGGGGAGAGCGGG + Intronic
1148342489 17:46881643-46881665 CTGGAGGTGGAGGGGTCTGCGGG - Intronic
1150582748 17:66490318-66490340 CTGGAAATGGATGGTAGTGATGG - Intronic
1152029180 17:77831066-77831088 CCGGAAATGGAATGGGCTGCGGG - Intergenic
1152298838 17:79483884-79483906 CGGGATATGGAGGGGACTGAAGG + Intronic
1152599294 17:81253534-81253556 ATGGTAATGGAGGGGACTGTGGG - Intronic
1154135276 18:11772438-11772460 CTGGAACAGGACGGCACTGGGGG - Intronic
1154350688 18:13580670-13580692 CTGGGAAAGGAAGTGACTGCTGG - Intronic
1160337057 18:78051477-78051499 CTCGAAATGCACTTGACTGCAGG + Intergenic
1160453149 18:78979191-78979213 CAGGAAAGGGAGGGGACCGCAGG - Intergenic
1161310556 19:3591693-3591715 CTGGAGCTGGACTGGGCTGCAGG - Exonic
1161987846 19:7667180-7667202 CTGGAGATGGACGGCAGTGGTGG + Intergenic
1162513045 19:11131324-11131346 CTGGGCAGGGACGGGACTCCAGG - Exonic
1162517812 19:11159895-11159917 CTGGAGATGGATGGTAGTGCTGG + Intergenic
1168408705 19:56124813-56124835 CTGGAAATGGATGGGGGTGATGG + Intergenic
1168675500 19:58275083-58275105 CTGGAAAAGGAGGGGATTTCAGG - Intronic
925364984 2:3305289-3305311 GTTGAACTGGACGGGACTGGAGG - Intronic
927498657 2:23567051-23567073 CTGTAAATGGTCAGGACCGCAGG + Intronic
927591983 2:24364523-24364545 CTGAAAATGGATGGCACTGGAGG + Intergenic
930002369 2:46869888-46869910 CTGGACATGGACTGATCTGCTGG - Intergenic
931497155 2:62820444-62820466 CTGGAAATGGACAGTAGTGATGG - Intronic
932236391 2:70124245-70124267 CGGGCAGTGGAGGGGACTGCTGG + Intergenic
935870612 2:107444458-107444480 ATGGAAATGAACTGGGCTGCAGG + Intergenic
937037568 2:118794489-118794511 CTGAAGCTGGACAGGACTGCTGG - Intergenic
937229569 2:120389657-120389679 TGGGAAATGGACGGGTGTGCAGG - Intergenic
937917827 2:127107521-127107543 CTGGAAAAGGAGGGGGCTCCGGG - Intergenic
939265149 2:139863305-139863327 CTGGAAATGGATGGCAGTGATGG + Intergenic
942292617 2:174487184-174487206 CTGGAAATGGGCGGGGCTCGAGG - Intergenic
942381577 2:175396988-175397010 CTACAAATGGAGGGAACTGCAGG + Intergenic
944884313 2:204047430-204047452 TTGGAACTGGACGGCACAGCAGG - Intergenic
947285702 2:228511962-228511984 GTGGAAATGGACTGAACTGGCGG + Intergenic
1169092856 20:2872219-2872241 CTGGAGATGGTGGGGGCTGCTGG + Intronic
1169734388 20:8822398-8822420 CTGGGAATGGACAGGCCTCCAGG + Intronic
1173262987 20:41452943-41452965 CTAGAAATGGAGAGGACTACTGG + Intronic
1173504469 20:43576068-43576090 CTGGAAAGAGACAGGACTCCAGG - Intronic
1173884148 20:46441967-46441989 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1176084902 20:63291426-63291448 CTGGCCATGGCCAGGACTGCAGG + Intergenic
1176156042 20:63621308-63621330 CTGGAAATGGACGGCGGTGATGG + Intronic
1181886620 22:26026905-26026927 CTGGAAATCGAAGGGGCCGCTGG + Exonic
1182158653 22:28099822-28099844 CCGGAAATGGACGAGCCTGAGGG + Intronic
1182809342 22:33102812-33102834 GTGGAAAGGGCCGGGAGTGCAGG - Intergenic
1183037062 22:35148473-35148495 CTGGGATTGGAAGGGACTGCAGG + Intergenic
1183086569 22:35490678-35490700 CTGGGAAAGGAGGGGACAGCAGG - Intergenic
1184334233 22:43844015-43844037 CTGGAATTGAACTGGACTGGGGG + Intronic
1184361235 22:44020086-44020108 CTGGAATTGAACTGGACTGGGGG - Intronic
1185070972 22:48655533-48655555 CTGTAAAAGGACTTGACTGCGGG - Intronic
951105969 3:18743471-18743493 CTGAAAATGGAATGGACAGCTGG + Intergenic
952905507 3:38137183-38137205 CTGGAGGTGGACGGGACTTTTGG - Exonic
953777072 3:45828780-45828802 CTGACAATGGACTGGCCTGCTGG - Intronic
954584518 3:51721559-51721581 AGGGAAATGGAGGGGACTGAGGG + Intergenic
956919689 3:73913883-73913905 CTGGAAAAGGAGGGGATTTCAGG + Intergenic
960986847 3:123286437-123286459 CTGGGCATGGAAGGGACTGGGGG - Intronic
966918882 3:184599662-184599684 CAGGAAATGGAGGGGACTGTTGG + Intronic
967073700 3:185983658-185983680 CTGGGAAGGGACGGGACACCGGG - Intergenic
968536577 4:1134465-1134487 CTGGAAATGGATGGTAGTGATGG - Intergenic
971503772 4:27344304-27344326 CTGCCCATGGAAGGGACTGCTGG - Intergenic
974095272 4:57356862-57356884 CTTGGAATGAACTGGACTGCAGG - Intergenic
975473450 4:74795082-74795104 CAGGGAATGGATGGGACTGCAGG - Intergenic
976675940 4:87703537-87703559 CTGGAATTGGAAGAGATTGCTGG - Intergenic
982982763 4:162162448-162162470 CTGGAAAAGGACGGGGGTGGGGG - Intronic
985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG + Intergenic
986069421 5:4267430-4267452 CTGAAGAGGGACAGGACTGCTGG - Intergenic
990388374 5:55291601-55291623 CTGGAAATGGATGGTGGTGCTGG - Intronic
990733023 5:58830288-58830310 CTGGAAGTGGAAGGTAGTGCAGG + Intronic
992529679 5:77642322-77642344 CTGGAACTGGACGGCAAAGCAGG - Intergenic
998542801 5:142998861-142998883 CTGGAAAGGAAAGGGACAGCAGG - Intronic
1000287684 5:159841336-159841358 ATGGACATGGATGGGGCTGCTGG - Intergenic
1002104774 5:176874609-176874631 CTGGAGGAGGACGGGACAGCCGG + Intronic
1002687097 5:181021261-181021283 CTGCAGTTGGACAGGACTGCAGG - Intergenic
1004458779 6:15816671-15816693 CTGGAAATGGGGGAGACTGATGG + Intergenic
1004883327 6:20029713-20029735 CTGGAGATGGACAGTACTGTTGG - Intergenic
1008584173 6:52933957-52933979 CTGGAGATGGATGGGAATGGTGG + Intergenic
1008683892 6:53903269-53903291 TTGGAAGTGGAGGGGACTGGAGG + Intronic
1015863913 6:137708499-137708521 TTGGAACTGGAAGGAACTGCAGG - Intergenic
1016318465 6:142816335-142816357 CTGGAAATGGGCTGAACTGGGGG - Intronic
1017551734 6:155516970-155516992 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1019276780 7:180035-180057 CTCCAAATGGAGGGGCCTGCGGG + Intergenic
1019961157 7:4461005-4461027 CTACAAATGGACAGAACTGCAGG - Intergenic
1021738730 7:23664166-23664188 CTGGAAATGGAGGGGATTTCAGG + Intergenic
1024053420 7:45644572-45644594 CTTGAAAGGGACAGGACTACAGG - Intronic
1024710714 7:52011710-52011732 CTGGAAGTGGGCGGGAGTGAGGG + Intergenic
1024836766 7:53529854-53529876 CTGGAAATGGAGGGAAGTGATGG - Intergenic
1025176053 7:56803018-56803040 CTGGAAATGGAGAGGACTTCAGG + Intergenic
1025695741 7:63773404-63773426 CTGGAAATGGAGAGGACTTCAGG - Intergenic
1031019765 7:116614417-116614439 CTGGACATGGAAGGGATGGCTGG - Intergenic
1032076548 7:128838771-128838793 ATGGACAGGGAAGGGACTGCGGG - Exonic
1032443130 7:131957662-131957684 CTGTAAAAGGAGGGGACTGTAGG + Intergenic
1032496675 7:132368115-132368137 TTGGAAATGGGCTGGACAGCAGG + Intronic
1033281866 7:140011743-140011765 CTGGAGATGGATGGCAGTGCTGG + Intronic
1034467407 7:151238212-151238234 CTGGAAATGGACTGGAAAGAAGG - Exonic
1034534589 7:151719075-151719097 AGGGAAATGGAGGGGACTGAAGG + Intronic
1036772834 8:11590903-11590925 CTGGAAATGGACGGTGGTGATGG + Intergenic
1037328619 8:17720485-17720507 CTGGAAATGGAAGGAACAGAAGG - Intronic
1041114103 8:54517632-54517654 CTGGAAAAGGAGGGGATTGCAGG + Intergenic
1041298108 8:56382381-56382403 CTGGAAATAGAAGAGAATGCTGG + Intergenic
1042560311 8:70069112-70069134 GTCGAATTGGACGGGAATGCAGG - Intronic
1043878493 8:85514062-85514084 CTGGAAATCTACAGAACTGCAGG + Intergenic
1052113607 9:24620558-24620580 CAGGATATGGATGAGACTGCAGG + Intergenic
1055565236 9:77561689-77561711 CTGGAAATGGACAGTAGTGATGG + Intronic
1056404455 9:86260525-86260547 CTGGAGATGGAAGGCAGTGCAGG - Intergenic
1056617147 9:88178485-88178507 CTGGAAAAGGAGGGGATTTCAGG + Intergenic
1058677387 9:107412101-107412123 CTGTGAATGGACGGGATTGTGGG + Intergenic
1061626330 9:131842704-131842726 CTGGGAATGGATGGGGCTGGAGG + Intergenic
1185734132 X:2484709-2484731 CTGGGAAAGGACGGGGCGGCGGG + Intronic
1186597883 X:11003784-11003806 CTGGAAATGGATGGGGATGGTGG + Intergenic
1187507536 X:19888762-19888784 CTGGAAATGGAGGAGGCTGAGGG + Intergenic
1187933471 X:24314062-24314084 CCGGAAATGAACGGGAGGGCCGG + Intergenic
1190493761 X:51007677-51007699 CTGGAGATGGATGGGAGTGATGG - Intergenic
1192313790 X:70036628-70036650 CTAGAAATTGAAGGGACTTCTGG - Exonic
1192363291 X:70452499-70452521 CTGGAACTGGTCGGGCCGGCTGG + Intronic
1200090399 X:153633227-153633249 CTGGGCAGGGAAGGGACTGCGGG + Intergenic