ID: 906595030

View in Genome Browser
Species Human (GRCh38)
Location 1:47068442-47068464
Sequence CGAAGATTCTGTGGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906595024_906595030 -1 Left 906595024 1:47068420-47068442 CCTGAGCACTTGCCCAGGGCCAC 0: 1
1: 1
2: 4
3: 34
4: 344
Right 906595030 1:47068442-47068464 CGAAGATTCTGTGGAGGTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 127
906595021_906595030 19 Left 906595021 1:47068400-47068422 CCAATCGCTCAGCAACAGGTCCT 0: 2
1: 0
2: 0
3: 4
4: 73
Right 906595030 1:47068442-47068464 CGAAGATTCTGTGGAGGTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906595030 Original CRISPR CGAAGATTCTGTGGAGGTGC TGG Intronic
901036570 1:6339463-6339485 CAAGCACTCTGTGGAGGTGCAGG - Exonic
901687619 1:10952211-10952233 GGAAGCTGCTGGGGAGGTGCAGG + Intronic
906023955 1:42657397-42657419 CGAAGATAATGTGGAAGTGGGGG + Intergenic
906198917 1:43947055-43947077 CGAAGAGTCCGTGGAGTTGAGGG - Exonic
906576888 1:46899142-46899164 GGAAGATTCCGTGGAGGTGCCGG - Intergenic
906595030 1:47068442-47068464 CGAAGATTCTGTGGAGGTGCTGG + Intronic
907766597 1:57418616-57418638 CGAAAATTTTGTGGTGGTGAAGG - Intronic
910446196 1:87301003-87301025 GGAAGATACTGTGGAGTTGTCGG + Intergenic
911551883 1:99292509-99292531 TGGAGGTTCTGTGGAGATGCAGG - Intronic
912174451 1:107140032-107140054 CGGCGCTTCTGTGGAGGAGCCGG + Intronic
912558423 1:110533023-110533045 CCAAGATTCTTTGCAGATGCTGG - Intergenic
915028821 1:152858564-152858586 GTCAGATTCTGTGTAGGTGCTGG + Intergenic
915123809 1:153649443-153649465 CGAAGCTTCAGTGGAGGAACTGG - Intergenic
918768372 1:188518760-188518782 CCAACATTTTGTGGTGGTGCTGG - Intergenic
920336550 1:205249012-205249034 AGGAGACTCTGTGGAGGTGCTGG + Intronic
922766005 1:228157102-228157124 GGAGGATTTTGTGGAGGTGGAGG + Intronic
923303675 1:232667861-232667883 TGCAGACTCTGAGGAGGTGCAGG - Intergenic
924437398 1:244054445-244054467 CAAAGACTCTGTTGAGCTGCAGG - Exonic
1063441248 10:6075146-6075168 TGGAGATGCTGTAGAGGTGCTGG + Intergenic
1065483345 10:26215513-26215535 CGAAGATTCTCTGGGGGCGAGGG + Intergenic
1065515821 10:26523471-26523493 GTAAGATTCTGTGTGGGTGCAGG + Intronic
1067206497 10:44219617-44219639 AGAAGATTCAGTAGAGCTGCAGG + Intergenic
1069918327 10:71800740-71800762 CGAAAATTCAGTGCAGGTGAGGG + Exonic
1071472447 10:85993244-85993266 GGCAGAATCTGTGCAGGTGCAGG + Intronic
1078040356 11:7855867-7855889 CTGAGATTCTGTGGAGATGCTGG + Intergenic
1078475294 11:11624010-11624032 AGAATTTTCTCTGGAGGTGCAGG + Intergenic
1080945442 11:36968191-36968213 CTAAGATTCTGTGGTGGGGTGGG + Intergenic
1081043949 11:38249385-38249407 TGAAGATTCTCTGGGGATGCAGG + Intergenic
1081396700 11:42594679-42594701 ATAAGATTCTGTGGAAGTGAAGG - Intergenic
1081787296 11:45756599-45756621 CGGAGACTGTGTGAAGGTGCAGG - Intergenic
1083638053 11:64130772-64130794 AGAAGGTCCTCTGGAGGTGCTGG - Intronic
1084982590 11:72838837-72838859 CGGTGATTCTGTGTAGGTGGAGG + Exonic
1086367289 11:86120427-86120449 TGAAGATTCTCTGGAGGTCTAGG - Intergenic
1089287493 11:117417076-117417098 CATAGTGTCTGTGGAGGTGCTGG + Intergenic
1089332129 11:117696947-117696969 TGAAGAGTCTGTGGAGGAGGTGG - Intronic
1091215854 11:133901137-133901159 TGAAGGTTGTGTGGAGCTGCAGG - Intergenic
1091351745 11:134903369-134903391 CCAATATTCTAGGGAGGTGCTGG - Intergenic
1093632435 12:21425272-21425294 CGAAGATTTTGTGGAAGAGAAGG - Intergenic
1094777433 12:33746386-33746408 CCAAGATACAGTGGAGGTACAGG - Intergenic
1095957041 12:47813002-47813024 CGGAGACGCTGAGGAGGTGCTGG - Intronic
1097161274 12:57048290-57048312 GGAAGGTTCTGTGGGGGTGGAGG - Exonic
1097227381 12:57486078-57486100 AGAAAATTCTATGGAGGTTCTGG - Intronic
1097245998 12:57607919-57607941 GGTAAATTCTGTGGAGGTGGTGG + Intronic
1100164540 12:91901405-91901427 CCAAGATACAGTGAAGGTGCAGG - Intergenic
1115085702 14:29512757-29512779 CCTAGATACAGTGGAGGTGCAGG + Intergenic
1117185984 14:53241368-53241390 CGAAGAGTAAGTGGTGGTGCAGG - Intergenic
1118865602 14:69701261-69701283 CAAAGATTCTGTGGAGATGTGGG + Intronic
1122193735 14:100068773-100068795 GGAAGAATCTGTAGAGGTGTGGG + Intronic
1122341954 14:101034286-101034308 CAATTCTTCTGTGGAGGTGCGGG - Intergenic
1122448422 14:101783948-101783970 GGGGGATTCTGTGGAGGAGCTGG + Intronic
1126385234 15:48087476-48087498 CATAGATTTTGTGGAGGTGGAGG - Intergenic
1127829919 15:62741534-62741556 TCATGATTCTGTGGTGGTGCAGG + Intronic
1129260291 15:74363154-74363176 CGAAGTATCTGTGCAGCTGCTGG + Intronic
1129940736 15:79494840-79494862 CGAAGATTGTGTCAGGGTGCAGG + Intergenic
1130530500 15:84744416-84744438 CTAAGATGCTGTGGAGGGGTGGG - Intergenic
1138210303 16:55157696-55157718 GGAAGATGCTGAGGAGGAGCAGG - Intergenic
1138800031 16:60016180-60016202 CGAAGATCCAGTGGGGGTACAGG + Intergenic
1139470591 16:67176179-67176201 TGAAGGTTCCGTGGGGGTGCGGG - Exonic
1140304791 16:73792953-73792975 CGAACATTCTGGGAATGTGCAGG - Intergenic
1142251277 16:88993155-88993177 CCAAGATCCTCTGGAGGGGCTGG + Intergenic
1142572980 17:887298-887320 CGAAGGTTTGGCGGAGGTGCAGG + Intronic
1146219784 17:31008487-31008509 CGAGGATGCTGCGGAGGCGCGGG + Intergenic
1146306100 17:31730962-31730984 TGCAGCTGCTGTGGAGGTGCTGG - Intergenic
1146520875 17:33524607-33524629 CGAGGATGGTGGGGAGGTGCTGG + Intronic
1148077759 17:44948845-44948867 AGAAAATTATGTGGAGGTGCTGG + Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1157181105 18:45498901-45498923 AGAAGTTTCTGTGGAGCTGTGGG - Intronic
1157195140 18:45614757-45614779 CCAAGATACAGTGGGGGTGCAGG - Intronic
1157502377 18:48200684-48200706 CCGTGCTTCTGTGGAGGTGCAGG - Intronic
1158860537 18:61587846-61587868 CAGAGATTCTGAGGAAGTGCAGG + Intergenic
1160625848 18:80204466-80204488 CAAAGAATCTGTGGAGGTTAAGG - Intronic
1166151206 19:40876995-40877017 CAAAGAGTCTGGGGAGATGCAGG + Intronic
926702280 2:15811503-15811525 CGTGGATTCTCTGGAGGGGCTGG + Intergenic
930336946 2:50060363-50060385 CCTAGATTCCGTGGGGGTGCAGG - Intronic
933587064 2:84190810-84190832 CGAAGAGTCAGAGGAGGGGCAGG + Intergenic
934756031 2:96825380-96825402 CCATGCTTGTGTGGAGGTGCAGG - Intronic
940042152 2:149371945-149371967 GGAAGCCTCTGTGGAGGGGCAGG - Intronic
940256232 2:151733123-151733145 CGAAGACTATGAGGAGGTGGTGG - Exonic
941683010 2:168419278-168419300 GGAAGAGTCTGAGGAGTTGCAGG - Intergenic
942088997 2:172470256-172470278 TGAAGATTCTGTTGGGGTGGAGG - Intronic
1169164959 20:3415215-3415237 CCAAGATACTGTGGGGGTACAGG + Intergenic
1169464109 20:5822672-5822694 TGAAGATTAAGTGGAGGGGCTGG - Intronic
1169493976 20:6095752-6095774 CCAAGATTCTGTAGAGATGCAGG - Intronic
1170310562 20:14986798-14986820 CTAAGATTCTGAGGAGGTGACGG - Intronic
1171869556 20:30514223-30514245 CGTAGACTCTGTGGGGCTGCAGG + Intergenic
1173366066 20:42386401-42386423 TGAAGATCCTCTGGAGGTACAGG + Intronic
1174800172 20:53556973-53556995 CGAAGAGGCTGAGGAGGTGGTGG - Intergenic
1178394981 21:32235202-32235224 AGACAATTCTGTGGAGGTGGGGG - Intergenic
1181128815 22:20717526-20717548 GGCAGATTCTGGGGAGGGGCTGG + Intronic
1183574284 22:38677278-38677300 AGAAGATTCTGTGGACGAGAGGG + Intergenic
1184260870 22:43315177-43315199 TGTAAATTCTGTGCAGGTGCTGG - Intronic
955239116 3:57164575-57164597 CGAAGTTTCTCAGGAGGTCCCGG + Intronic
959183111 3:103007437-103007459 TGAAGATACAGTGGAGGTACAGG + Intergenic
959732030 3:109615358-109615380 TGAAGATACTGTGGTGGTCCAGG + Intergenic
961560293 3:127723995-127724017 GGAAGATTATGTGAAGATGCAGG + Intronic
961662788 3:128479172-128479194 GGAAGATACTGGGGAGGTGCAGG - Intergenic
962722553 3:138188970-138188992 GGAATATTCTGTGGGAGTGCAGG + Intronic
964743745 3:159992238-159992260 TGAAGCTTCTGAGGAGGGGCAGG - Intronic
965046427 3:163584368-163584390 CCAAGATGCAGTGGAGGTACAGG + Intergenic
969156780 4:5218348-5218370 GGAAGTTTCTGTGATGGTGCAGG + Intronic
972541601 4:40043852-40043874 CAAGCACTCTGTGGAGGTGCAGG - Intergenic
976252300 4:83064994-83065016 CTAAGCTTCTGGGGAGGTGGAGG - Intronic
976598551 4:86916719-86916741 CTATGAGTCTGTGGAGGTTCTGG - Intronic
978703531 4:111676874-111676896 GAATGATTCTGTGGTGGTGCTGG - Intergenic
978903391 4:113979494-113979516 CGGAGTTTCTGCGGAGGTGGAGG - Exonic
979018642 4:115467015-115467037 TGAAGAACCTGGGGAGGTGCAGG - Intergenic
982630229 4:157822056-157822078 CGCAGATTCTGGGTGGGTGCAGG + Intergenic
987386971 5:17339105-17339127 GACAGATACTGTGGAGGTGCTGG + Intergenic
989265998 5:39474889-39474911 CCAAGAGTCTTTGCAGGTGCTGG - Intergenic
991570527 5:68048819-68048841 GGAAGATTTTGGGGAGATGCAGG + Intergenic
992613042 5:78523918-78523940 TGTAGATGCTGTGGAGGGGCTGG + Intronic
996177700 5:120379370-120379392 CCAAGATACAATGGAGGTGCAGG - Intergenic
999158536 5:149475945-149475967 GGAAAATTGTGTGGGGGTGCTGG - Intergenic
1005597710 6:27394970-27394992 CCAAGATACAATGGAGGTGCAGG - Intronic
1006600493 6:35222310-35222332 CTAAGATTCTGAGGATGGGCAGG - Intronic
1010056847 6:71576270-71576292 TGAGGATTCTGTGGGGATGCAGG - Intergenic
1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG + Exonic
1017245906 6:152224020-152224042 GGAAGATTCTGTGGACACGCTGG + Intronic
1017717144 6:157221035-157221057 CGAAGGGACTCTGGAGGTGCGGG - Intergenic
1019480803 7:1265861-1265883 GGAAGATTGTGTGGGGTTGCAGG + Intergenic
1020158733 7:5750903-5750925 AGAAGATTCTGTGCAGTTGATGG + Intronic
1020883142 7:13788394-13788416 CTAAGAGTCTGTGGAGGTTGTGG - Intergenic
1022955520 7:35376748-35376770 CGAAGACTCTGTGGAGGCCTGGG - Intergenic
1024442805 7:49441136-49441158 CCAATATTCTCTGGAGCTGCTGG - Intergenic
1029970472 7:104783619-104783641 AGGAGATTCTGAGGAGGTACAGG + Intronic
1035494810 7:159315278-159315300 AGAAGAATCTGTGTAGTTGCTGG + Intergenic
1037698621 8:21251135-21251157 TGAAAATTCTGTGAAGGTGTAGG - Intergenic
1041456484 8:58066403-58066425 CCAAGTGTCTGTGGAGGAGCTGG + Intronic
1042173811 8:66019085-66019107 TGTACATTCTGTGGAGGTGTGGG - Intergenic
1049558159 8:143293936-143293958 GGAAGCTCCTGTGGAGGTGGGGG - Intronic
1059722601 9:116975801-116975823 ACAAGATTTTGTGGAGGTGGTGG + Intronic
1061732301 9:132625129-132625151 TGGAGATTCTGAGCAGGTGCAGG - Intronic
1062066352 9:134528662-134528684 CTAAGATTATGTTGAGGTGCTGG - Intergenic
1193139864 X:78016590-78016612 CCAAGATACAGTGGGGGTGCAGG + Intronic
1195035193 X:100965753-100965775 CCAAGATACAGTGGAGGTACAGG - Intergenic
1196903439 X:120409413-120409435 CAAAGATACAGTGGAGGTACAGG + Intergenic
1198311651 X:135430656-135430678 GGAAGATTCTGGGAAGGTGGTGG + Intergenic