ID: 906598613

View in Genome Browser
Species Human (GRCh38)
Location 1:47104391-47104413
Sequence GCACCAGTGTTAGCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906598610_906598613 9 Left 906598610 1:47104359-47104381 CCCGTTCTTGGGCACCAAGGTGA 0: 1
1: 1
2: 2
3: 16
4: 150
Right 906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG 0: 1
1: 0
2: 3
3: 21
4: 85
906598612_906598613 -5 Left 906598612 1:47104373-47104395 CCAAGGTGATGTATACTAGCACC 0: 1
1: 1
2: 0
3: 7
4: 55
Right 906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG 0: 1
1: 0
2: 3
3: 21
4: 85
906598611_906598613 8 Left 906598611 1:47104360-47104382 CCGTTCTTGGGCACCAAGGTGAT 0: 1
1: 0
2: 0
3: 13
4: 172
Right 906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG 0: 1
1: 0
2: 3
3: 21
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906598613 Original CRISPR GCACCAGTGTTAGCTACTCC AGG Intronic
900950596 1:5856276-5856298 GCGCCAGTGTGAGTTTCTCCTGG - Intergenic
903752966 1:25640832-25640854 GCACCATTTTTAGTTACTCAAGG - Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG + Intronic
918570631 1:185987790-185987812 GCAGCAGTGTAAGCTTCTCTGGG - Intronic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
1064265924 10:13825425-13825447 GCAGCAGTATTAGATTCTCCCGG + Intronic
1066620495 10:37344646-37344668 GCACCTGTGTTGGTGACTCCAGG + Intronic
1067328535 10:45292786-45292808 TCACCAGTGTTGCCTACTCTGGG - Intergenic
1067941649 10:50661671-50661693 ACCTCAGTGTTAGCTCCTCCAGG + Intergenic
1070862887 10:79686630-79686652 ACCTCAGTGTTAGCTCCTCCAGG + Intergenic
1071666641 10:87564638-87564660 GCACCAGTGTCAGCAAGTCCAGG - Intergenic
1077450901 11:2644989-2645011 GTACCAGTGTTAGCAAGTCCAGG + Intronic
1079683806 11:23331665-23331687 ACACCAGTGTTAGTCAATCCAGG + Intergenic
1080219693 11:29887011-29887033 TCATTAGTGTTAACTACTCCTGG - Intergenic
1084400192 11:68938953-68938975 GCTCCAGTGTTACTTCCTCCAGG - Intronic
1085560592 11:77469725-77469747 ACACCAGTGTTTGCTCCTTCTGG - Intronic
1097511452 12:60547078-60547100 GCTCCAGTGTTAGATTCTCATGG + Intergenic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1100670223 12:96803437-96803459 GCTCCAGTGTTAGTGAATCCTGG - Intronic
1100787989 12:98099051-98099073 GCATCATTGTAAGCTACTCCGGG + Intergenic
1102041668 12:109804995-109805017 GCTCAAGTGTTACCTCCTCCAGG + Intronic
1103161649 12:118734249-118734271 GCATTAGTGTTTGGTACTCCTGG - Intergenic
1103885729 12:124198818-124198840 GCACCCGAGGGAGCTACTCCAGG + Intronic
1108308793 13:49165609-49165631 GTACCAGTGTTAGCAAATCCAGG + Intronic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1122979419 14:105184978-105185000 GCACCAGTGTCAGCTCCCCAGGG + Intergenic
1128551398 15:68600273-68600295 GCTCCAGTGTCACCTCCTCCAGG + Intronic
1128896576 15:71379142-71379164 ACACCAGTGCTACCTAATCCTGG - Intronic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1132006607 15:98233194-98233216 GCACCAGCATTAGCTTCACCTGG + Intergenic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1133614799 16:7466077-7466099 GCCCCAGGGCTAGCTAATCCTGG - Intronic
1134878259 16:17721443-17721465 GCTCTAGAGTTGGCTACTCCTGG + Intergenic
1137445545 16:48529695-48529717 GCTCCTGTGTTAGCTTCTCTTGG + Intergenic
1144263442 17:13545592-13545614 ACACCAGTGTTTGCTGATCCTGG + Intronic
1146841075 17:36154629-36154651 GCACCAGGAATAGCTACTCCTGG - Intergenic
1146853321 17:36242275-36242297 GCACCAGGAATAGCTACTCCTGG - Intronic
1146869230 17:36366165-36366187 GCACCAGGAATAGCTACTCCTGG - Intronic
1147072104 17:37966796-37966818 GCACCAGGAATAGCTACTCCTGG - Intergenic
1147083630 17:38046328-38046350 GCACCAGGAATAGCTACTCCTGG - Intronic
1147099576 17:38170295-38170317 GCACCAGGAATAGCTACTCCTGG - Intergenic
1150082583 17:62253589-62253611 GCACCAGGAATAGCTACTCCTGG - Intergenic
1150415905 17:64988694-64988716 GCACCAGTGTTCTGTCCTCCTGG + Intergenic
1150795799 17:68235676-68235698 GCACCAGTGTTCTGTCCTCCTGG - Intergenic
1153640837 18:7155690-7155712 GCTCCAGAGGTAGCTAGTCCAGG + Intergenic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1161056897 19:2195225-2195247 GCAGGAGTGGTGGCTACTCCTGG - Intronic
1161077128 19:2291230-2291252 GCTCCAGGGTCAGCTCCTCCAGG + Exonic
1161502398 19:4623635-4623657 GCTCCAATGTTACCTCCTCCAGG + Intergenic
1164617154 19:29674082-29674104 GCTCCAGTGTGACCTCCTCCAGG - Exonic
1166039885 19:40195439-40195461 GCTTCAGTGTTACCTCCTCCTGG - Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167986506 19:53322833-53322855 GCACCAATGTTAGTGAGTCCAGG + Intergenic
924963447 2:55692-55714 GCACCAGTGTCAACTTCACCTGG - Intergenic
925535470 2:4911688-4911710 CCACCAGTGTTAGCTACCAAAGG + Intergenic
928063518 2:28139072-28139094 GGACCAGGGATAGGTACTCCTGG + Intronic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
932791540 2:74657989-74658011 GCACCAGTGTGAGTTACTTGGGG + Intronic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
938812149 2:134863450-134863472 GCACCGTTGTGAGCTACCCCAGG + Exonic
940844283 2:158623296-158623318 CCTGCAGTCTTAGCTACTCCAGG - Intronic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1172195982 20:33091907-33091929 GCTCAAGTGTTACCTCCTCCAGG - Intronic
1172934545 20:38610287-38610309 GCACCAGAGTTTACAACTCCTGG - Intronic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1177398892 21:20575885-20575907 TCACCATTTTAAGCTACTCCTGG - Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1179922111 21:44512976-44512998 GCACCAGATTTAGCAAATCCAGG + Intronic
1180186502 21:46142518-46142540 GCACAGCTGTTAGCTCCTCCCGG + Intronic
1182549024 22:31091177-31091199 GCCCCAGTGATACCTCCTCCCGG + Exonic
1185153795 22:49181426-49181448 GAACCAGTGTTCCCTCCTCCGGG + Intergenic
952409512 3:33034527-33034549 GCACCATTGCCAGCTGCTCCTGG + Intronic
954540436 3:51390201-51390223 GCACCTGCCTGAGCTACTCCAGG + Intergenic
956772695 3:72539932-72539954 GCACCACTATCAGCTACTCAAGG + Intergenic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
962796652 3:138855446-138855468 GCTTAAATGTTAGCTACTCCAGG - Intergenic
968485573 4:859388-859410 GTGCCAGTGTCAGCAACTCCCGG + Intronic
980623872 4:135345525-135345547 GCATCAGTGGTAGCTAGTCTAGG - Intergenic
986891152 5:12308169-12308191 GCACCTGTCACAGCTACTCCAGG + Intergenic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
999674731 5:153987618-153987640 GCACGAGTGTGAGCTCCTCTGGG + Intergenic
1000403652 5:160862344-160862366 ATAGCAGTGTTAGCTACTGCTGG + Intergenic
1002319884 5:178368762-178368784 GCAGCAGTGCTAGCTGCACCTGG - Intronic
1003599342 6:7503020-7503042 GCGGCAGTGTTTGCTACACCTGG - Intergenic
1013111346 6:107067674-107067696 ACCTCAGTGTTAGCTACTCCAGG - Exonic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1027498194 7:78914516-78914538 AAACCATTGTTAGTTACTCCAGG - Intronic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1042173967 8:66021073-66021095 GGACCAGAGCCAGCTACTCCTGG + Intergenic
1044072482 8:87778947-87778969 GCATCAGTGTTAGTGAGTCCAGG - Intergenic
1046431513 8:114134676-114134698 GCACCAGTGTTAGAAAGTCTAGG + Intergenic
1049681884 8:143922635-143922657 GCACCAGGGTCACCTTCTCCTGG + Exonic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050534007 9:6615537-6615559 GCACCACTGTACGCTAGTCCAGG + Intronic
1050560909 9:6833703-6833725 GAATCAGTGTTAGCTGCTGCAGG + Intronic
1055477463 9:76677586-76677608 GCACCAGTGTTCGCTCCTTTGGG + Intronic
1188051472 X:25492180-25492202 ACAGCAGTGTTAGCTCCTCTAGG + Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1189725033 X:43959707-43959729 GCACCAGTGTTGGCTATGCCTGG - Intronic
1193442310 X:81557281-81557303 ACACCAGTGTTAGCTAATCTAGG - Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic