ID: 906599366

View in Genome Browser
Species Human (GRCh38)
Location 1:47111062-47111084
Sequence GTAAGCTAGCTGGCCATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906599361_906599366 12 Left 906599361 1:47111027-47111049 CCATTCTAACCCAAATTAGGTCT 0: 2
1: 0
2: 1
3: 7
4: 124
Right 906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 58
906599363_906599366 2 Left 906599363 1:47111037-47111059 CCAAATTAGGTCTTTACCTCAGT 0: 2
1: 0
2: 0
3: 9
4: 104
Right 906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 58
906599359_906599366 19 Left 906599359 1:47111020-47111042 CCAGTTGCCATTCTAACCCAAAT 0: 2
1: 0
2: 1
3: 5
4: 110
Right 906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 58
906599362_906599366 3 Left 906599362 1:47111036-47111058 CCCAAATTAGGTCTTTACCTCAG 0: 2
1: 0
2: 0
3: 12
4: 137
Right 906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906599366 Original CRISPR GTAAGCTAGCTGGCCATGTC AGG Intronic
906247003 1:44283331-44283353 GTGATCCAGATGGCCATGTCTGG + Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
906572407 1:46854824-46854846 GTTAGCTAGCTGGTCATAACAGG - Intergenic
906599366 1:47111062-47111084 GTAAGCTAGCTGGCCATGTCAGG + Intronic
906819915 1:48918595-48918617 GAGAGCTAGCTAGCCATGTTGGG + Intronic
911154726 1:94626386-94626408 GTAAGCTAATTGGCCAAGTGAGG + Intergenic
912728372 1:112079164-112079186 GTTAGCAAGATGGCCATGTCAGG - Intergenic
1063233056 10:4085146-4085168 GAAAGTTAGCTGGGCATGGCGGG - Intergenic
1072069105 10:91899486-91899508 TGTAGCTAGCTGACCATGTCCGG + Intergenic
1075097306 10:119480891-119480913 GTAAGCCAGCTGGCAATGACGGG + Intergenic
1077495131 11:2883371-2883393 GCAAGCTAGATGGGCATGTATGG + Exonic
1078297403 11:10087523-10087545 GTTAGCTAACTGCCCATATCTGG + Intronic
1081229983 11:40574346-40574368 TTAAGCCAGCTTCCCATGTCAGG - Intronic
1081854777 11:46296386-46296408 GTGAGCGAGCTGGTGATGTCCGG - Intronic
1083454528 11:62769834-62769856 GTCAGCCAGCTGCCCAGGTCTGG + Intergenic
1086943025 11:92817527-92817549 GTAAGCTTGCTGTCTATGTTGGG + Intronic
1088801705 11:113312999-113313021 TAGAGCTAGCTGGCCATGCCTGG + Intergenic
1099079609 12:78160278-78160300 GTAAGCTAACTGGTCATCACAGG - Intronic
1109021186 13:57094898-57094920 GAAAATTAGCTGGCCATGCCAGG + Intergenic
1109021215 13:57095043-57095065 GGAAATTAGCTGGCCATGCCAGG + Intergenic
1113133557 13:107063841-107063863 TTCAGGTAGCTGGCCATGTCTGG + Intergenic
1122090416 14:99334760-99334782 GTCTGCTTGCTGACCATGTCTGG + Intergenic
1124427782 15:29577095-29577117 ATAATATAGCTGGCCAGGTCTGG - Intergenic
1126492645 15:49256361-49256383 GGCAGCTATCTGCCCATGTCAGG - Intronic
1138116106 16:54361955-54361977 GTGAGCTATCTGGCAATGTCAGG - Intergenic
1149482759 17:57017018-57017040 GAAAGCTAGCTGGGCGTTTCTGG - Intergenic
1151109313 17:71656022-71656044 GTAAGGTACCTGTCCATTTCTGG - Intergenic
1154486424 18:14875280-14875302 AGAAGCTACATGGCCATGTCAGG + Intergenic
1156451262 18:37267634-37267656 CTAAGCTAAGTGGCCATGCCAGG + Intronic
926926831 2:17995824-17995846 GCTGGCTAGCTGGCCATGTGGGG - Intronic
1169632094 20:7645540-7645562 TTAATATAGTTGGCCATGTCAGG + Intergenic
1176794875 21:13364099-13364121 AGAAGCTACATGGCCATGTCAGG - Intergenic
1184886689 22:47350896-47350918 GTAGGGTACCTGGCCATGTAAGG + Intergenic
951272128 3:20638991-20639013 TTTAGCTAGCAGGACATGTCTGG - Intergenic
959816535 3:110680444-110680466 AAAACCTAGCTAGCCATGTCTGG - Intergenic
964655717 3:159064094-159064116 AGAAGCTGGCAGGCCATGTCAGG - Intronic
964938379 3:162123032-162123054 GTAAGCTAGGGGGCAATGACTGG + Intergenic
969955104 4:10881197-10881219 GTAAGCTAGGAAGCCATGCCAGG - Intergenic
971552740 4:27976703-27976725 ATAAGGTAGCTGGGCATGTGGGG - Intergenic
986722167 5:10567092-10567114 CTAAGTTAGCAGGCTATGTCCGG - Intronic
992162101 5:74013816-74013838 CTTAGATAGCTGGCCATTTCAGG - Intergenic
993693498 5:91032181-91032203 GGGAGCAAGCTGGGCATGTCTGG + Intronic
995744523 5:115390021-115390043 GTAGGCCAGCAGGCCAAGTCAGG + Intergenic
997438447 5:133891779-133891801 CTAAGCTACCTGGGCATGTAGGG - Intergenic
997610923 5:135215242-135215264 GTAAGATAGATGGCTATCTCTGG - Intronic
997771430 5:136557688-136557710 GGAAGCTAGCTGTCCACGACAGG - Intergenic
1000257195 5:159551221-159551243 GTAAGCCAGCTGTTCATGACTGG + Intergenic
1000980194 5:167808540-167808562 GTAAGCCACCTTGCCATGCCTGG + Intronic
1004504026 6:16233064-16233086 GTAAGCTGGCTGGCCAGGTGCGG + Intergenic
1007722905 6:43896005-43896027 GTAAGATAAGTGGCCAGGTCGGG + Intergenic
1016118980 6:140324479-140324501 TTCAGATAGCTGGACATGTCCGG - Intergenic
1020834593 7:13133387-13133409 GTAACCTAGCTGTCCATATTAGG - Intergenic
1029598585 7:101550692-101550714 GTCAGCTGGGTGGCGATGTCAGG + Intronic
1033148973 7:138896745-138896767 ATAAGCTAGCTGGGCATGGTGGG - Intronic
1038813408 8:30875962-30875984 AAAAGCTAGCTGGGCATGTTGGG - Intronic
1047749252 8:127867443-127867465 GTCAGCAAGCTGGCCAAGCCCGG - Intergenic
1052091009 9:24327556-24327578 GTAAACTCGCTTGCCATCTCTGG - Intergenic
1057775271 9:98002990-98003012 GTATGCTAGCTAGCCATCTGGGG + Intronic
1189154776 X:38745933-38745955 GTAAGCTAGGAGGCTATGACAGG + Intergenic
1189181803 X:39011722-39011744 ACAAGCTCGCTGGCCATGTGTGG + Intergenic
1195840535 X:109171872-109171894 GTAATCTAGCAGGCAATGACTGG + Intergenic
1200090177 X:153632356-153632378 GTGAGGAAGCTGGCCCTGTCCGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201231328 Y:11867624-11867646 GTCAGCAAGCTGGCCTTGGCAGG + Intergenic