ID: 906602647

View in Genome Browser
Species Human (GRCh38)
Location 1:47143367-47143389
Sequence CCACCTGGATGCTGCCCTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 2, 1: 0, 2: 2, 3: 24, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906602647_906602651 7 Left 906602647 1:47143367-47143389 CCATCAGGGCAGCATCCAGGTGG 0: 2
1: 0
2: 2
3: 24
4: 269
Right 906602651 1:47143397-47143419 AGTGACAACCCTCCAGCTGCAGG 0: 2
1: 0
2: 0
3: 16
4: 158
906602647_906602652 8 Left 906602647 1:47143367-47143389 CCATCAGGGCAGCATCCAGGTGG 0: 2
1: 0
2: 2
3: 24
4: 269
Right 906602652 1:47143398-47143420 GTGACAACCCTCCAGCTGCAGGG 0: 2
1: 0
2: 0
3: 9
4: 126
906602647_906602656 28 Left 906602647 1:47143367-47143389 CCATCAGGGCAGCATCCAGGTGG 0: 2
1: 0
2: 2
3: 24
4: 269
Right 906602656 1:47143418-47143440 GGGCCCTTGTTCTTATCAAGTGG 0: 2
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906602647 Original CRISPR CCACCTGGATGCTGCCCTGA TGG (reversed) Exonic