ID: 906603131

View in Genome Browser
Species Human (GRCh38)
Location 1:47146308-47146330
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906603128_906603131 -9 Left 906603128 1:47146294-47146316 CCTGGTGTGGGCGTCTCTGTGTA 0: 2
1: 0
2: 0
3: 13
4: 157
Right 906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG 0: 2
1: 0
2: 1
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900385280 1:2407769-2407791 CTCTAGGGACAAAAGGAAGGGGG + Intronic
902105756 1:14034801-14034823 CTCTGTGTAATCAAGGAATGAGG + Intergenic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903345365 1:22680921-22680943 CTCTTTGTAAATAAGGAAGCAGG - Intergenic
904580874 1:31543416-31543438 CTATGTGTTCAAATGAAAGGAGG - Intergenic
904976792 1:34462651-34462673 CCCTCTGTAAAGAAGGAAGGGGG + Intergenic
905993792 1:42363436-42363458 CTGTGTGTCCAAAAAGAAAGTGG - Intergenic
906380518 1:45329436-45329458 CCCTGTGAAAAAATGGAAGGAGG + Exonic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
907359988 1:53906558-53906580 ATCTGGGTTCAAAAGGAAGCCGG - Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
908467288 1:64409173-64409195 CTCTGTTATCAAAAGAAAGGTGG + Intergenic
910368374 1:86489966-86489988 CTCTTAGGAGAAAAGGAAGGAGG + Intronic
910714094 1:90211395-90211417 CACTGTATACAAAAGGAATGAGG + Intergenic
912467112 1:109881893-109881915 CTGTCTGTTCAAAAGGATGGGGG - Intergenic
914435442 1:147655312-147655334 CTCTGTAGACAAAGAGAAGGGGG - Intronic
914701859 1:150141621-150141643 CTCCATGTATAGAAGGAAGGTGG - Intronic
915589376 1:156861829-156861851 CTTCGTGTACCAAAGGGAGGAGG - Intronic
916214983 1:162386443-162386465 CTCTGTCCACATAAGGAAGTTGG + Intronic
916386002 1:164271053-164271075 GTCTGTGTACAAAGAAAAGGAGG + Intergenic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
920399209 1:205666725-205666747 TACTGTCTCCAAAAGGAAGGTGG + Intronic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
922246175 1:223799939-223799961 CTCAGAGTACCAAAGGAAGGTGG + Exonic
923202764 1:231727942-231727964 CTCTGTCTAAAAAAAAAAGGAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063115942 10:3071925-3071947 CTCTGTGAACTCAGGGAAGGTGG - Intronic
1064165087 10:12978955-12978977 ATTTGGGAACAAAAGGAAGGCGG - Intronic
1066706099 10:38179637-38179659 CCTTGTGTACAAAAGAAAAGGGG - Intergenic
1067443013 10:46322214-46322236 GTAAGTGTCCAAAAGGAAGGTGG + Intronic
1068680037 10:59809602-59809624 TTCTGTGTGCAAGAGGAAGGAGG - Intronic
1069737412 10:70666023-70666045 CCCTCTGTACAATAGGCAGGTGG + Intergenic
1070448153 10:76528949-76528971 CTCTGTGTATAAGATGAAAGAGG + Intronic
1070485624 10:76928075-76928097 CCCTGTTTACAAAAGGGAGTTGG + Intronic
1070787478 10:79170386-79170408 CTCTGTGGCTAAAAGGAATGGGG - Intronic
1071852218 10:89585388-89585410 ATCTGTTTCCAAAAGGCAGGAGG + Intronic
1072119276 10:92392133-92392155 CTCTGTCTCCAAAAAAAAGGGGG - Intergenic
1072540370 10:96393968-96393990 CTCTCTGTAAAATAGGAAGAAGG - Intronic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1075773396 10:124960430-124960452 CTCTGTTTAAAAAACGAAGCAGG - Intronic
1078575321 11:12497034-12497056 CTCTTTCTAGAAAATGAAGGGGG - Intronic
1078751286 11:14166081-14166103 CTCTGTGTACACAAGGTATGAGG + Intronic
1079210282 11:18455182-18455204 CTCTGTATGCAAAAGGAATTTGG - Intergenic
1080400997 11:31935375-31935397 CTCTGTCTAAAAAAAAAAGGTGG - Intronic
1080688585 11:34536359-34536381 CTCTGTATACAATAGCAAGTAGG - Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081237402 11:40661956-40661978 TTCTGTGGAGAAAAGGAATGAGG + Intronic
1081534014 11:43984467-43984489 CTCTGGGTACAAACAGAAGATGG + Intergenic
1083237776 11:61362565-61362587 CCCTAGGTACAAAGGGAAGGCGG + Intronic
1083911700 11:65713583-65713605 CTCTCTGCAGAAACGGAAGGTGG + Exonic
1083928085 11:65821283-65821305 CTCTGAGGACCAGAGGAAGGAGG + Intergenic
1084343663 11:68527812-68527834 CCCTGAGGACAACAGGAAGGAGG - Intronic
1084379335 11:68801100-68801122 CTCTGTCTCCAAAAAAAAGGGGG + Intronic
1085758916 11:79224943-79224965 CTCTGTCTAAAAAAAAAAGGGGG + Intronic
1086737327 11:90322504-90322526 CTCTGTAAACAAAATGCAGGGGG - Intergenic
1087621561 11:100548861-100548883 CTGTCTGTAAACAAGGAAGGGGG - Intergenic
1088386858 11:109268042-109268064 TTCTGTTCAGAAAAGGAAGGTGG + Intergenic
1090465467 11:126929419-126929441 TTTTGTGTACAGAAAGAAGGAGG + Intronic
1091049790 11:132356901-132356923 CTCAGTCCACAAAAGGAAGGAGG - Intergenic
1091243832 11:134074636-134074658 CAGTGTGTTCAAAAAGAAGGGGG - Intronic
1091744129 12:2980414-2980436 TTCTGTTGACAATAGGAAGGGGG - Intronic
1093045909 12:14444378-14444400 CTCTGTCTACAAAAAAAAAGAGG - Intronic
1093101187 12:15031106-15031128 CTCTGTGTAGACAAGGTATGGGG + Intergenic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1097643396 12:62207967-62207989 CTCAGTGTTCACAAGGAATGAGG - Intronic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1099642106 12:85303670-85303692 CACTGTGTAAAAAAGGAAGTTGG - Intergenic
1100165343 12:91911483-91911505 GTCTATGAACAAAAGGAAGATGG + Intergenic
1101355336 12:103972123-103972145 CTCTGTCTAAAAAAAAAAGGGGG - Intronic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1103120411 12:118375643-118375665 CTCTGAGTAGAAAAGGAACACGG - Intergenic
1104054105 12:125216255-125216277 CTCTGTGTCCTAAAGGTAGAGGG + Intronic
1104201001 12:126588745-126588767 TTGTGGTTACAAAAGGAAGGTGG + Intergenic
1106881878 13:34140325-34140347 TTGGGAGTACAAAAGGAAGGAGG + Intergenic
1108075838 13:46678946-46678968 CTCTGAATAAATAAGGAAGGAGG - Intronic
1110449796 13:75628811-75628833 CTCTGTGTTGTAAAGGAAGAAGG - Intronic
1112593093 13:100782455-100782477 CTCTGCTTACAAAGGGAAGGAGG + Intergenic
1112751407 13:102587556-102587578 ATTTGTGTAAAAAAGGAAAGAGG + Intergenic
1113127627 13:106997852-106997874 CTGTGTGTACAAAAGTAAACGGG - Intergenic
1114203633 14:20547154-20547176 CTCTGCAAACAAAGGGAAGGAGG + Intergenic
1115402256 14:32975325-32975347 CTCAGTCTAAAAAGGGAAGGAGG - Intronic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1118835466 14:69474852-69474874 CTCTTTTTAAAAAAAGAAGGGGG - Intergenic
1119550160 14:75503969-75503991 TTCTATGTTCAAAAGGATGGCGG + Intergenic
1120202673 14:81554401-81554423 CTCTGTCTAAAAAAAAAAGGGGG + Intergenic
1120237417 14:81908666-81908688 TTCTGTCTAAAAGAGGAAGGAGG + Intergenic
1120526520 14:85583240-85583262 CACAGTATACAAAATGAAGGTGG - Intronic
1120867540 14:89308815-89308837 CACTGTGAACAAATGGAAGGAGG + Intronic
1121579820 14:95021124-95021146 CTCTGTGTGCACATGGAAGGAGG + Intergenic
1122073746 14:99222282-99222304 TCCTGTGTACAAAAACAAGGAGG + Intronic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1125155158 15:36577738-36577760 CACTCTGTACAAAAGGGAAGAGG + Intergenic
1125433718 15:39624657-39624679 CTCAGTGTAAGAGAGGAAGGTGG - Intronic
1125970296 15:43905947-43905969 CTCCGCTTTCAAAAGGAAGGTGG + Exonic
1127180672 15:56413757-56413779 ATCTGTGTATATAATGAAGGTGG - Intronic
1127597159 15:60497174-60497196 CTCTGTTTACAACAGGAGGAGGG - Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1132927635 16:2439533-2439555 TTCTGTCCACAAAAGGGAGGTGG + Intronic
1137892092 16:52173531-52173553 CTCTGCTTAAAGAAGGAAGGAGG + Intergenic
1138697800 16:58831866-58831888 CTCCGTCTCGAAAAGGAAGGAGG - Intergenic
1139368094 16:66446188-66446210 CTCTGTCTAAAAAAAAAAGGGGG + Intronic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1144244841 17:13352707-13352729 CTCTCAGTCCAAAAGGAAAGTGG + Intergenic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1147986720 17:44311173-44311195 CTCCAAGTTCAAAAGGAAGGGGG + Intronic
1148099797 17:45082112-45082134 CTCTGTCTCAAAAAGAAAGGGGG - Intronic
1149295957 17:55263186-55263208 CTCTGTCTCCAAAAGGATAGCGG + Intergenic
1150180693 17:63117483-63117505 CTCTGGATACAAAAAGAAGCAGG + Intronic
1150318423 17:64189263-64189285 CTCTCTGGGCAAAAAGAAGGGGG + Intronic
1150488224 17:65558735-65558757 CTCTGGAAAGAAAAGGAAGGGGG + Exonic
1151053289 17:71004030-71004052 GTCTTTGTATAAACGGAAGGTGG - Intergenic
1154123292 18:11669057-11669079 GTCTGGGAACAAAAGAAAGGTGG + Intergenic
1155271682 18:24148030-24148052 CTGTGTTTACATCAGGAAGGAGG + Intronic
1156289280 18:35731679-35731701 ATCTGCCTGCAAAAGGAAGGTGG + Intergenic
1157908073 18:51587249-51587271 GTGTGTGTAAAAAAGGGAGGGGG + Intergenic
1158423045 18:57313100-57313122 CTCTGTGTAGCAAAGTGAGGGGG - Intergenic
1158604713 18:58885470-58885492 TTATGTGCACAAAAGGCAGGAGG - Intronic
1159586222 18:70286167-70286189 CTCTGTCTACAAAAAGAACCAGG - Intergenic
1160926071 19:1546483-1546505 CTCTGTCTCCAAAAAAAAGGGGG - Intergenic
1161076742 19:2289577-2289599 ATCTGTGTACAAAGGGCTGGGGG + Intronic
1161865923 19:6832216-6832238 CTCTGTGGACAGAAAGAGGGAGG - Intronic
1163019451 19:14474662-14474684 CTGGGTGTAAAAATGGAAGGTGG - Intronic
1163171415 19:15534019-15534041 CTCTGTGGAAAACAGCAAGGTGG - Intronic
1163177511 19:15574728-15574750 CTCTGCCTGCAAATGGAAGGAGG + Intergenic
1164414753 19:28037750-28037772 TCCTGAGTTCAAAAGGAAGGTGG + Intergenic
1164519331 19:28966382-28966404 ATTTGAGTTCAAAAGGAAGGTGG + Intergenic
1167231442 19:48286867-48286889 CCCTGTGAATGAAAGGAAGGTGG + Exonic
925587666 2:5479480-5479502 CTCTGGGTAGGAAATGAAGGAGG + Intergenic
928203724 2:29269191-29269213 CCCTGTGTTCAGATGGAAGGAGG + Intronic
932114472 2:69033816-69033838 ATCTGTGTGCAAAAGAAGGGAGG + Intronic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932729240 2:74206468-74206490 CTCTGTGGACAAGAGGTGGGTGG + Intronic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
934114323 2:88770759-88770781 TTTTGTGTACAAAAAAAAGGTGG + Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934611802 2:95743911-95743933 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
935966025 2:108476852-108476874 TACTGTGTAGAAAAGTAAGGTGG + Intronic
936157055 2:110054599-110054621 CTCTGTGAACAAAAGTGTGGAGG + Intergenic
936187639 2:110316845-110316867 CTCTGTGAACAAAAGTGTGGAGG - Intergenic
936545138 2:113385529-113385551 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
936844181 2:116810523-116810545 CAATGTGTACAAAAGGAAATTGG - Intergenic
936946986 2:117940055-117940077 CTCTGAGCAGCAAAGGAAGGTGG + Intronic
937295839 2:120809528-120809550 CTCTGTTTAAAAAAGAAGGGAGG + Intronic
938866266 2:135424055-135424077 CTCTGTTTAAAAAAGCAAGTCGG + Intronic
940092445 2:149935951-149935973 CTCTCTGGAAAAAAGAAAGGAGG + Intergenic
940198462 2:151123076-151123098 CTTTGTCTCCAAAAGAAAGGGGG + Intergenic
945160247 2:206883126-206883148 CTCTGCACTCAAAAGGAAGGAGG + Intergenic
947202914 2:227631242-227631264 CTCTTTCTTCAAAAGGCAGGGGG - Intronic
947936585 2:234009727-234009749 CTCTGTGAGTAAAAAGAAGGAGG - Intronic
948526322 2:238573164-238573186 CTCTGCCTTCAAAAGGAAAGAGG - Intergenic
948876715 2:240833306-240833328 CTCTGTGGACACCAGGATGGAGG + Intergenic
1169114538 20:3055061-3055083 CTCAGCCTTCAAAAGGAAGGAGG - Intergenic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1173177986 20:40779064-40779086 CTTTGTGTAAAAAGGGAAGGAGG + Intergenic
1173566098 20:44039655-44039677 CTCTGTGGGCAACAGGAACGGGG + Intronic
1175268261 20:57715381-57715403 CTCTGTGGACTAAATGCAGGAGG + Intergenic
1175476744 20:59280898-59280920 CTCTCTCTTCAAAATGAAGGAGG + Intergenic
1175681868 20:60995062-60995084 CTCTCAGTACACAAGGAGGGAGG + Intergenic
1177430078 21:20981501-20981523 CTCTGTCTAAAAAAAAAAGGGGG - Intergenic
1177675516 21:24293936-24293958 CTCTGTGTATAAAATGGAAGAGG + Intergenic
1178451314 21:32704034-32704056 CTCTGTTTTCTAAAGGAAGGTGG - Intronic
1179137348 21:38691739-38691761 CACTGTTTTTAAAAGGAAGGAGG + Intergenic
1179958330 21:44753552-44753574 CTCTGTGTCCACAAGCACGGCGG + Intergenic
1180756860 22:18168401-18168423 CTCTGTCTCCAAAAAAAAGGGGG - Intronic
1181716937 22:24737858-24737880 CTATGTGTAGAAAGAGAAGGGGG + Intronic
1182736880 22:32537163-32537185 CTCTGTTTAAAAAAAAAAGGGGG - Intronic
1183387209 22:37521705-37521727 CCCTGTCTGCAAAAGGCAGGCGG + Intergenic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
1185014449 22:48334955-48334977 CTCTGTGAACTGAAGGAAAGAGG + Intergenic
950196552 3:11013323-11013345 CTCTTTGTACCAAAGCAAAGAGG - Intronic
951233947 3:20212573-20212595 CTCTGTCTGCAAAAGGGAAGGGG - Intergenic
951284116 3:20788512-20788534 CTCTGTGGACAAAGGGGAGGTGG - Intergenic
953346992 3:42184668-42184690 CTCTTTCTACAAAAGGAAAGAGG - Exonic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954933254 3:54302785-54302807 CTCCGTGTACAACCGGATGGAGG - Intronic
955119904 3:56047575-56047597 CCCTGAGAACAAAATGAAGGAGG + Intronic
955792004 3:62597723-62597745 CTCTGTGTCCAATAGGATGGGGG - Intronic
957993454 3:87656402-87656424 CTCTCTGTAGAAATGGAATGTGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960463135 3:117961490-117961512 TTCTGAGTACAATAGGATGGTGG - Intergenic
961357323 3:126347324-126347346 CTCTGCCTACAGAGGGAAGGAGG + Intronic
961372476 3:126440066-126440088 CTCTGGGTACACAAGGTTGGTGG - Intronic
962231593 3:133670216-133670238 CTCTCTGTACAAAAAGAGGATGG + Intergenic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
962857153 3:139357957-139357979 CTCTGCAGACAAAAGGAAGAGGG + Exonic
963062496 3:141235799-141235821 CTCTGAGTCCAAAAGGCAGGAGG + Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964706018 3:159619417-159619439 CTCTGTTTTCATAAGCAAGGGGG - Intronic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
970300057 4:14671677-14671699 ACCTCTGTACAAAAGGAAGATGG - Intergenic
970356349 4:15257075-15257097 CTCTGTGTCAAAAATGGAGGAGG + Intergenic
970491553 4:16580259-16580281 CTTTGTGTACAAATGAAAGAAGG + Intronic
973218360 4:47697409-47697431 CTCTGAGTACAAAAGGAGTGAGG + Intronic
973298212 4:48550775-48550797 CTCTGTTTAAAAAAGGAGGACGG + Intronic
974580205 4:63788883-63788905 ATTTGTGCACAAAAGGAAAGAGG - Intergenic
975732650 4:77352971-77352993 CACTTAGTACAAAAGGAAGAGGG - Intronic
975824100 4:78301668-78301690 GTGTGTGTACAAAAGGCAAGGGG + Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
977149727 4:93495486-93495508 CTCTGTAAAGAAAAGGAAAGTGG + Intronic
977879385 4:102186836-102186858 CTGTGAGTACAAAGGGATGGTGG + Intergenic
981129952 4:141147546-141147568 CTCTATGTACACAAGGCAGAGGG + Intronic
983052542 4:163065619-163065641 CTTTCTGTAAAACAGGAAGGAGG + Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985340643 4:188949225-188949247 CTCTGTTTTAAAAAGGAAGTAGG + Intergenic
985689451 5:1299071-1299093 CTCTGTGTTCCAGAGGGAGGGGG + Intergenic
986028204 5:3870951-3870973 CTCTGTGTGGAACAGGATGGGGG + Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
986417350 5:7542550-7542572 AACTGTGTAAAAAAGGAAGATGG + Intronic
987369439 5:17179827-17179849 GGCTGTGTTCACAAGGAAGGAGG - Intronic
988125119 5:27022727-27022749 TTCTGTGTATAAAAAGAATGTGG - Intronic
990683502 5:58272975-58272997 CTCTGTTTATAAAAAGATGGTGG + Intergenic
993010332 5:82475349-82475371 CCCTGTGGACAATATGAAGGGGG - Intergenic
993844906 5:92929489-92929511 CTCTGTGTAGAAAAGATTGGAGG + Intergenic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
995684956 5:114762451-114762473 CTCTGGGTACAAAATCAACGTGG - Intergenic
995940390 5:117575211-117575233 TTCTGTCTAAAAAAGGGAGGGGG + Intergenic
996969419 5:129345533-129345555 CTCTTTGTAAAACTGGAAGGTGG + Intergenic
999148821 5:149413262-149413284 CTCTGTGTACAAAGGTATGGAGG + Intergenic
1000427148 5:161104813-161104835 GTCTATGAACAAAAGGAAGAAGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1002157336 5:177293647-177293669 TTCTGTGCACAAAAAGAAGCTGG + Intronic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1007418203 6:41704370-41704392 CCATCTGTACAAAAGGATGGCGG + Intronic
1011310142 6:85972570-85972592 CTCTCTGGACAAAAAGAAAGGGG - Intergenic
1012530914 6:100235288-100235310 CTCTCTTTACAAAAGGAAGAGGG + Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013249297 6:108318179-108318201 CTCTGTGTGCCCAAGGAAAGTGG + Intronic
1013515278 6:110879499-110879521 ATCTTTGAACAAAAGGGAGGAGG + Intronic
1014392929 6:120886340-120886362 CTTTGTGTCAAAAAGGGAGGTGG + Intergenic
1015326979 6:131934172-131934194 CTAGATGTACAAGAGGAAGGAGG + Intergenic
1017245828 6:152223609-152223631 CTCTGTCTCAAAAAGGAAGGAGG + Intronic
1018721835 6:166578803-166578825 CTCTGTGTAGAAAATGCACGAGG - Intronic
1019617496 7:1972205-1972227 ATGTGTGTACAAAAGGACAGCGG - Intronic
1019812005 7:3171734-3171756 CTCTCTGGAAAAAAGGAATGGGG - Intronic
1020799619 7:12717857-12717879 CTGTTTGTAAAACAGGAAGGGGG + Intergenic
1021758162 7:23875985-23876007 GTCTGCTTAGAAAAGGAAGGTGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023264959 7:38394662-38394684 GTTTGGGAACAAAAGGAAGGTGG - Intronic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1024301783 7:47892538-47892560 ATCTGTCTCCAAAAGGAGGGAGG + Intronic
1025917404 7:65876625-65876647 CTCAGTGTACCAAACCAAGGGGG - Intronic
1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG + Intergenic
1027005651 7:74690530-74690552 CCCTCAGTACAAAAGGAGGGTGG - Intronic
1029570964 7:101369018-101369040 CTCTGTGTAAGAAAAGGAGGAGG - Intronic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033543852 7:142381808-142381830 CTCTGTGTTGGAAAGGAAGGAGG - Intergenic
1034841192 7:154399184-154399206 CTTTCTTTAAAAAAGGAAGGTGG - Intronic
1034907101 7:154959187-154959209 CTCTGTATACAATAGAAATGTGG + Intronic
1034986033 7:155516019-155516041 ATCTGTGTAAAAGAGGAGGGGGG - Intronic
1035399163 7:158553577-158553599 CTGTGTGTAGACAAGGAGGGTGG - Intronic
1035759714 8:2060888-2060910 CTCTGAGTACAGCAGGAAAGTGG + Intronic
1035861622 8:3034921-3034943 CACTGTGGAGAAAGGGAAGGAGG + Intronic
1036093018 8:5689972-5689994 CTTTGTGTACAAAGGTAAGATGG + Intergenic
1036448707 8:8846244-8846266 CTCTGTCTCCAAAAAAAAGGGGG + Intronic
1036475463 8:9089141-9089163 CTCAGTGAAGAAAAGGAAAGAGG - Intronic
1039344196 8:36686113-36686135 CACTCTGTCCTAAAGGAAGGAGG + Intergenic
1041289342 8:56293991-56294013 GTTTGGGAACAAAAGGAAGGCGG + Intergenic
1041564800 8:59264505-59264527 CTCTGTGCACACAAGGAATGAGG - Intergenic
1042257934 8:66825674-66825696 CTCTGTGTAAATAAGGGAGTAGG - Intronic
1042654866 8:71084988-71085010 CTCTGTCTAAGAAAGGAAGGAGG - Intergenic
1045491743 8:102675412-102675434 GACTGTGTACAGAAGCAAGGAGG + Intergenic
1045893127 8:107181674-107181696 CTCTGTGAACTAAAGGCATGAGG - Intergenic
1047993675 8:130313136-130313158 TTCTGAGAACAAATGGAAGGAGG + Intronic
1050536506 9:6635203-6635225 CTTGGTGTACAAAAGTCAGGAGG - Intronic
1051183469 9:14435774-14435796 CTCTGTGTTTAAAAGGAAGGTGG + Intergenic
1053052181 9:34971274-34971296 CTCTGTGGACAAAAAGCAGAGGG - Exonic
1054185697 9:61950289-61950311 CTCTTTCCAAAAAAGGAAGGAGG + Intergenic
1054533057 9:66201462-66201484 TTAAGTGTACAAAATGAAGGTGG - Intergenic
1056736928 9:89217822-89217844 GTTTGTGCACAACAGGAAGGAGG - Intergenic
1057298786 9:93864713-93864735 CCCTGGGTAGAAAAGGAAGGAGG - Intergenic
1057927849 9:99168962-99168984 CTCTGTGTAAGAAGGGAGGGAGG - Intergenic
1058575680 9:106398769-106398791 GGCTGTGATCAAAAGGAAGGAGG + Intergenic
1059826448 9:118034888-118034910 GTCTGTGTTCAAATGGAAAGAGG - Intergenic
1060625960 9:125111729-125111751 CTCTGAGGACAAAAGAAGGGAGG + Intronic
1061947390 9:133916382-133916404 CTCTTTGTAGAAAGGGAAGGTGG + Intronic
1186511619 X:10134129-10134151 CTCTGTGTTCAAGATCAAGGGGG - Intronic
1186839647 X:13472321-13472343 CTTTGTGTAAAAAAGGATTGGGG + Intergenic
1186906829 X:14119789-14119811 CTCTGTGTCCAAGAAGAAGAGGG + Intergenic
1188635491 X:32425646-32425668 CTCTGTGTTCCAAAGTGAGGAGG - Intronic
1190016081 X:46828460-46828482 CTCTGTCTAAAAGAAGAAGGAGG + Intergenic
1191627009 X:63280518-63280540 CTCTGTGTACAAAAGATTGTTGG + Intergenic
1191858633 X:65647941-65647963 CTTTGTGGACAAATGGATGGAGG + Intronic
1193381320 X:80819742-80819764 CTCTATGTATAAAAGAAAAGAGG + Intergenic
1194067338 X:89277477-89277499 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1194375608 X:93129106-93129128 TTTGGTGTACCAAAGGAAGGAGG + Intergenic
1195279617 X:103318350-103318372 ATCAGTGAACAAAGGGAAGGAGG + Intergenic
1195705038 X:107732388-107732410 CTCCTTATGCAAAAGGAAGGAGG + Intronic
1195917877 X:109953589-109953611 CTCTGTGTTCCATAGAAAGGTGG - Intergenic
1196990217 X:121320463-121320485 ATCTGTGTCCAAATGAAAGGAGG - Intergenic
1198148386 X:133882222-133882244 CACTGGTTACAAAAGGAAGCAGG - Intronic
1198256490 X:134928433-134928455 CTCTGTATACAAAAGTATGATGG + Intergenic
1199382063 X:147182635-147182657 TTCTGAGTGCAGAAGGAAGGAGG + Intergenic
1199752387 X:150832682-150832704 CTCTCTGTAGGAAAGGAAGAAGG + Intronic
1200721496 Y:6611691-6611713 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1201252556 Y:12074104-12074126 CTCACTATACAATAGGAAGGGGG - Intergenic