ID: 906604883

View in Genome Browser
Species Human (GRCh38)
Location 1:47161525-47161547
Sequence CAGCCACAGCTCTTACCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906604880_906604883 0 Left 906604880 1:47161502-47161524 CCTGACTGTCTGGGTTACAATCC No data
Right 906604883 1:47161525-47161547 CAGCCACAGCTCTTACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906604883 Original CRISPR CAGCCACAGCTCTTACCAAC TGG Intergenic
No off target data available for this crispr