ID: 906607665

View in Genome Browser
Species Human (GRCh38)
Location 1:47183071-47183093
Sequence GATGAAGGATGTTTGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906607658_906607665 -9 Left 906607658 1:47183057-47183079 CCCAGAGTCTCAGGGATGAAGGA 0: 1
1: 0
2: 0
3: 21
4: 293
Right 906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 298
906607659_906607665 -10 Left 906607659 1:47183058-47183080 CCAGAGTCTCAGGGATGAAGGAT 0: 1
1: 0
2: 1
3: 13
4: 200
Right 906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906607665 Original CRISPR GATGAAGGATGTTTGGGGGC GGG Intergenic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900900628 1:5513432-5513454 GGTGCAGGATGGTCGGGGGCTGG + Intergenic
901006644 1:6174926-6174948 GATGAAGGATGGATGGTGGGTGG + Intronic
902228158 1:15009793-15009815 GTTGATGAATGTTTGGGGTCAGG - Intronic
902360080 1:15937574-15937596 GAGGAATCTTGTTTGGGGGCTGG - Exonic
903329028 1:22587732-22587754 GGTGATGGATGTATGGGAGCGGG - Intronic
903370045 1:22829557-22829579 GATGAATGATGGATGGGGGAAGG - Intronic
903614832 1:24643850-24643872 GAGGGAGGACGTTGGGGGGCGGG - Intronic
904336492 1:29801597-29801619 GATGAGGGCTGTTTGAGGGCCGG - Intergenic
905360420 1:37415567-37415589 GATGAAGGGTTTCTGGGGCCAGG - Intergenic
905487477 1:38313466-38313488 GATGGAGGATGTTGGGGGCCAGG - Intergenic
905719412 1:40184346-40184368 GATGAGGGATATTGGGGGCCTGG + Intronic
905990857 1:42335599-42335621 GGTGGCGGATGTTGGGGGGCGGG - Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906810021 1:48817203-48817225 GATAAAGGATCTTTAGGGGCAGG - Intronic
906966902 1:50466759-50466781 GCTGAAGGGGGTTTGGGGACAGG - Intronic
907931464 1:59004967-59004989 GATGAAGAATGTTCTGGGGATGG + Intergenic
908037724 1:60073868-60073890 GCTGAAGGCTGTTTCTGGGCGGG + Intergenic
908108626 1:60873006-60873028 GTTGAAGGATATTTGGGAGTTGG - Intronic
909425738 1:75522652-75522674 GTTCAAGGTTGTTTGGGGACAGG - Intronic
909457698 1:75869154-75869176 GATGAGGGATTTTTGGGAACTGG + Intronic
910106975 1:83642278-83642300 GATGAAGGGTTTGTGAGGGCAGG + Intergenic
912566808 1:110593271-110593293 GCTGGAGGATGTGTGGGGGCGGG - Intergenic
915491032 1:156250183-156250205 GATGCAGGGTGGTTGGGGCCAGG - Exonic
915551641 1:156638673-156638695 GATGGGGGATGTTGGGGGTCCGG + Intergenic
917532906 1:175853065-175853087 GAAGAAGGCTGATTGAGGGCTGG + Intergenic
917931482 1:179825697-179825719 GATGAAAAATCTTTGGAGGCCGG - Intergenic
918340319 1:183563236-183563258 CATGAAGGATGCCTGGGGCCAGG - Exonic
920333417 1:205228234-205228256 GAAGCAGAAAGTTTGGGGGCCGG + Exonic
920672990 1:208018710-208018732 AAAGAAGGATGTATGGTGGCTGG + Intergenic
920757328 1:208745713-208745735 GATTATGCATGTGTGGGGGCAGG + Intergenic
920817860 1:209352107-209352129 TATGAAGGATTTTTGGTGACTGG - Intergenic
920997271 1:211006565-211006587 GATGAGGGATGTCTGGGAGTTGG + Intronic
924002151 1:239566207-239566229 AATTAAGGATGCTTGGAGGCCGG - Intronic
1064941110 10:20736547-20736569 GATGAAGGGTCTTTGTGGGGTGG + Intergenic
1065142561 10:22733373-22733395 GATGAAGCATGATTGGGAGAAGG - Intergenic
1065371050 10:24987008-24987030 GGTGGAGAATGTTTGGGGGTGGG - Intronic
1066052804 10:31650794-31650816 AATGGGGGATGTTTGGGGGCAGG - Intergenic
1069637376 10:69933495-69933517 GAGACAGGATGTTTGGTGGCGGG + Intronic
1070230522 10:74561742-74561764 GATGATGGAAGTATGGAGGCTGG + Intronic
1070814033 10:79312199-79312221 GAAGAGGGATGTTGGGGGGTTGG + Intronic
1071793977 10:88985797-88985819 TCTGGAGGTTGTTTGGGGGCAGG + Intronic
1072094130 10:92160414-92160436 GATGAAGCAAATTTGGGGGAGGG - Intronic
1072634609 10:97169756-97169778 GATGAAGCATGCTTAGGGTCAGG - Intronic
1073329328 10:102660520-102660542 GGTGCAGGATGCCTGGGGGCAGG + Intergenic
1075400621 10:122159054-122159076 GAAGAAAGAAGTCTGGGGGCTGG + Intronic
1075587003 10:123665645-123665667 GATGGAGGATGTTGGGGGAAGGG + Intergenic
1075637606 10:124040226-124040248 GACGAAGGATGGATGGTGGCTGG - Intronic
1077280535 11:1743044-1743066 GATGAAGGATGGATGGAGGGCGG + Intronic
1078008503 11:7550894-7550916 GAAGTCTGATGTTTGGGGGCAGG - Intronic
1078192237 11:9100658-9100680 GATGAAGGAAGTTCTGGGGATGG - Intronic
1079595256 11:22236856-22236878 GAAGAACGTTTTTTGGGGGCTGG + Intronic
1081687300 11:45051958-45051980 GAGGACGGATGTTTTGGGCCCGG + Intergenic
1083103532 11:60335093-60335115 GATGATGTATGTTTTGGGACTGG + Intronic
1083743384 11:64722707-64722729 GAGGAAGGGTCTTTGGGGGAAGG - Intronic
1084091356 11:66881164-66881186 GGTGAAGGATCTTTGGGTGATGG - Intronic
1084528711 11:69713862-69713884 GATAAAGGGAGTTTGGGGGAAGG + Intergenic
1085278294 11:75314053-75314075 GCTGGAGGGTGTGTGGGGGCAGG - Intronic
1088855292 11:113744849-113744871 GATTAAGAATGCTTGGGGCCGGG - Intronic
1089086235 11:115819233-115819255 GTTGGAGGATGTTTAGGGGAAGG + Intergenic
1089266220 11:117264024-117264046 GATGAAAATTGTTTTGGGGCCGG + Intronic
1090011283 11:123047947-123047969 GAGGAAGGATGTCGGGGAGCAGG + Intergenic
1090253435 11:125266492-125266514 GATTATGGATGTGTGGAGGCAGG + Intronic
1090609912 11:128461890-128461912 GATGAAACATGTTTTGGGGGGGG - Exonic
1091154255 11:133358980-133359002 GATGAGGGATGATTTGGGGGAGG + Intronic
1091404026 12:197852-197874 GGTGAAGGAGGGTTGGGGCCTGG - Intronic
1091596921 12:1884561-1884583 GATGTAGGAAGTTTGGGGTAAGG - Intronic
1091808578 12:3376171-3376193 TATGAATGATTCTTGGGGGCTGG - Intergenic
1091851266 12:3699021-3699043 GATGAAGTATGCTAGGGGCCTGG - Intronic
1094151243 12:27286253-27286275 AGTGCTGGATGTTTGGGGGCAGG - Intronic
1095176269 12:39095744-39095766 GATGCAGGCTGTGTGGGAGCTGG + Intergenic
1095699812 12:45179418-45179440 TATAAAAGATGTTTGTGGGCTGG + Intergenic
1096217658 12:49807194-49807216 GCAGCTGGATGTTTGGGGGCTGG + Intronic
1096311136 12:50521937-50521959 AATAAAAAATGTTTGGGGGCTGG - Intronic
1096795018 12:54071349-54071371 ACTGAAGGATGCTGGGGGGCAGG + Intergenic
1097007454 12:55929459-55929481 GAGGCAGGATGTCTGGGGGTGGG - Intronic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1103219002 12:119227514-119227536 GATGAATGATGTTGGGGGAGGGG - Intergenic
1103953822 12:124566132-124566154 GAGGAAGGATGTGTGAGGGAGGG - Intronic
1104272188 12:127292746-127292768 GATGAGGGAGGTTTGGTGGGAGG - Intergenic
1105458821 13:20565669-20565691 GCTGAAGGCAGTCTGGGGGCAGG + Intergenic
1106856867 13:33863415-33863437 GAGGAAGGGTGTTTGGGAGAAGG + Intronic
1107445624 13:40468035-40468057 GATGATGGAGGTATGGGAGCGGG - Intergenic
1108436874 13:50409633-50409655 GATGAAGGCTATCTGGGGGTCGG - Intronic
1109328471 13:60899403-60899425 GAAGAAGGAAGGTTGGGTGCAGG + Intergenic
1109931923 13:69227009-69227031 GCAGACTGATGTTTGGGGGCAGG - Intergenic
1112054678 13:95678625-95678647 GATGAGGGATGGTGGGGTGCGGG - Intronic
1114271455 14:21102770-21102792 GCTGCAGGAGGTATGGGGGCAGG + Exonic
1114648781 14:24270214-24270236 GATGGAGGATAGTAGGGGGCTGG - Intronic
1114896709 14:27000035-27000057 GAAGGAAGATGTTTGGTGGCGGG - Intergenic
1116869690 14:50059643-50059665 TGTGAAGGATGGATGGGGGCAGG + Intergenic
1117770113 14:59125553-59125575 GTTGAAGGATCTTTGGGGATGGG + Intergenic
1118073382 14:62271083-62271105 GATGGAGGATGGATGGGGGAGGG - Intergenic
1119702564 14:76765278-76765300 GATGAAGGAAGTCTAGGGGTGGG + Intronic
1119770104 14:77215228-77215250 GATGTTGGATGTTTGGTGACAGG - Intronic
1120150010 14:81022525-81022547 GATGTGGGGTGTTTGGGGCCGGG + Intronic
1121103866 14:91268021-91268043 GATGAAGTATGATCAGGGGCTGG + Intergenic
1121179341 14:91916821-91916843 GATGAAGGAAGTTTGGATGGTGG - Intronic
1121501683 14:94443045-94443067 GAACATGGATGTTTGTGGGCAGG - Intronic
1122015354 14:98790369-98790391 AATGAAGGTTGTTTGTGAGCAGG + Intergenic
1122632617 14:103113938-103113960 AAGGAAGGAAGTTTGGGGACGGG - Intergenic
1125604856 15:40934409-40934431 GAGGAAGGATGTTTGGGCCTGGG + Intronic
1128464064 15:67893836-67893858 GATGTAGGATGTTTATGGACTGG - Intergenic
1129164417 15:73768205-73768227 GAAGAGGGAAGGTTGGGGGCTGG + Intergenic
1131532398 15:93204988-93205010 GGTGAAGATTGTTTGGGGGAGGG + Intergenic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1133339856 16:5029127-5029149 GATGAGACATGCTTGGGGGCGGG - Intronic
1133669076 16:7999912-7999934 TAGGAAGGATGGTAGGGGGCTGG + Intergenic
1137913193 16:52399623-52399645 AATGAAAGATCTTTGGGGACAGG + Intergenic
1139264876 16:65629269-65629291 GAGGAAGGATGGGTTGGGGCTGG - Intergenic
1140287908 16:73622069-73622091 GTTGAAGGAAGTTTTGGGTCAGG - Intergenic
1141679413 16:85535602-85535624 GAGGAAGGCTGCTTGGGGGTTGG + Intergenic
1142718280 17:1759516-1759538 GGGGAAGGATCTTTGAGGGCCGG + Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1144352397 17:14409904-14409926 GATGATTGAATTTTGGGGGCAGG - Intergenic
1148144409 17:45353705-45353727 GTTGAAGAATGAATGGGGGCTGG + Intergenic
1150001389 17:61443063-61443085 GGTCAAGGATGCTTGGGGGAGGG + Intergenic
1152110170 17:78353382-78353404 GAGTAAGGATGTTTGGGAGGGGG - Intergenic
1153137151 18:1929868-1929890 TGTGGAGGATGTGTGGGGGCAGG - Intergenic
1153632354 18:7083773-7083795 GATGAAAGAAGGTTGGGGCCGGG + Intronic
1154386004 18:13892337-13892359 GATGAAGTATGGTGGGGGGCGGG + Intronic
1154933316 18:21024136-21024158 GCTGAAGGATAGTTGGGTGCAGG - Intronic
1155071394 18:22319960-22319982 TATGAAAGATATTTGTGGGCAGG - Intergenic
1156387482 18:36619189-36619211 AATGGAGGTTCTTTGGGGGCAGG - Intronic
1156423412 18:36980733-36980755 GATGAATGAATTATGGGGGCTGG + Intronic
1156632212 18:38983883-38983905 GATGCAGGATGGTTGGGTTCTGG - Intergenic
1157501979 18:48197247-48197269 GAGGCAGGATGATTGGAGGCAGG - Intronic
1158520555 18:58168944-58168966 GATGCAGGATGGTCAGGGGCGGG + Intronic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1159652030 18:70988772-70988794 GAAGAAGCATGGTGGGGGGCTGG - Intergenic
1160319264 18:77875113-77875135 GGGGATGGATGTTTGGGGGTGGG - Intergenic
1161285358 19:3465715-3465737 GGTGAATGGTGTCTGGGGGCCGG - Intronic
1163505037 19:17700568-17700590 GAGCAAGGATGGCTGGGGGCAGG + Intergenic
1164619738 19:29687445-29687467 GATGAAGGATCTTGGTGGGGTGG + Intergenic
1164925056 19:32124052-32124074 GATGAGGGATTTTCGGAGGCTGG + Intergenic
1165188116 19:34039479-34039501 GCAGAAGGATGGCTGGGGGCTGG - Intergenic
1165391163 19:35539716-35539738 GGTGCAGGAAGTTTGTGGGCAGG + Intronic
1165480425 19:36060302-36060324 GATGGAGGATGTCTTCGGGCAGG + Intronic
1165796731 19:38524050-38524072 GAAGGAGGATGGGTGGGGGCTGG - Intronic
1167041963 19:47027819-47027841 GATGAGTGATGTTTGGGTTCTGG + Intronic
1168355327 19:55696550-55696572 GGTGAAGGCTGTGTGGGGCCAGG + Intronic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
928590888 2:32813910-32813932 GTAGAAGGATGTTTTGGGGGTGG + Intronic
930714150 2:54576957-54576979 GATGATGGGTGCTTGGGGGTAGG + Intronic
931092407 2:58900216-58900238 GATGAAGGATGGTGCAGGGCAGG - Intergenic
931160235 2:59681661-59681683 GATGAATGATTTCTGGGGGTGGG - Intergenic
931447193 2:62336579-62336601 GAGCAGGGATGTTGGGGGGCGGG - Intergenic
931638597 2:64362162-64362184 GAGGGAGGACGTTTGGGGGAAGG + Intergenic
931787763 2:65635939-65635961 GAGGAAGGATGTTTGTGTGGTGG + Intergenic
932416815 2:71578605-71578627 GAAGAAGGATGTTGGGAGGCAGG + Intronic
933875941 2:86622673-86622695 GAAGAAGGATGTCCGGGAGCTGG - Exonic
933891958 2:86780292-86780314 GATGAAGGGTGGTTGGGGAGGGG + Intergenic
934916915 2:98307879-98307901 GATGGAGGCTGTTTGGGCCCAGG - Intronic
935727174 2:106033783-106033805 GATGATGGATGGTGGGAGGCAGG + Intergenic
936013400 2:108940346-108940368 GAGGGAGGACGTATGGGGGCTGG + Intronic
936903761 2:117513462-117513484 GATTAAGGATGTTTGGTAGAGGG - Intergenic
937252418 2:120533361-120533383 GATGAAGGCCCTGTGGGGGCTGG + Intergenic
942489273 2:176473769-176473791 GGAGGAGGATGGTTGGGGGCGGG - Intergenic
944775236 2:202957190-202957212 GGTCAAAGATGTTAGGGGGCAGG - Intronic
945070284 2:205982380-205982402 CATTAAGAATGTTTGGGGCCGGG - Intergenic
945239042 2:207659842-207659864 GATGAAGAAAGTTTGGTGGGTGG - Intergenic
946066049 2:216988130-216988152 GATGATGGGAGTGTGGGGGCTGG - Intergenic
947974116 2:234349636-234349658 CATAAAGTATGTGTGGGGGCTGG - Intergenic
948654043 2:239465810-239465832 GCTGAAGGCTGTGTTGGGGCAGG - Intergenic
1169419937 20:5451891-5451913 TATGAATGATCTGTGGGGGCAGG + Intergenic
1169608806 20:7355152-7355174 TATTAAGGATGGTAGGGGGCAGG - Intergenic
1169889130 20:10433974-10433996 ACTGAAGGATATTTGAGGGCGGG - Intronic
1171943078 20:31349593-31349615 GATGAAGGAAATTTAGGGGATGG + Intergenic
1174256031 20:49255836-49255858 GATCGAGGATGTTTGGCAGCTGG - Exonic
1176842961 21:13855208-13855230 AATCATGGATGTTCGGGGGCCGG - Intergenic
1177602241 21:23330426-23330448 GATGATGGTTGTTTGGTGGAAGG + Intergenic
1178351069 21:31873431-31873453 GAGGAAGAACTTTTGGGGGCGGG + Exonic
1178387736 21:32167986-32168008 AATGAATGATGTTTGGAGGTGGG + Intergenic
1179145565 21:38764698-38764720 GATGAAAGTTGTTTGGGGGCCGG - Intergenic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG + Intronic
1183625615 22:38999650-38999672 GCTGAAGGGTGGTTGGGAGCCGG + Intergenic
1183701795 22:39455133-39455155 ATTGAAGGTTCTTTGGGGGCCGG + Intergenic
1183861889 22:40676352-40676374 GAGGAAGCATGTTTGGTGGGAGG - Intergenic
1184459829 22:44630852-44630874 GAGGAGGGATGGGTGGGGGCTGG + Intergenic
949815953 3:8058014-8058036 AATGAAGGATGTTAGGGAGGAGG + Intergenic
951300789 3:20994239-20994261 AATGAATGCTGTTTGTGGGCAGG + Intergenic
951324939 3:21290282-21290304 GATGGAGGATTATTGGGGCCAGG + Intergenic
952893369 3:38059663-38059685 GATGAAGAAAGTTTGGGTGTGGG + Intronic
954661631 3:52229775-52229797 GATGAACACTGTTGGGGGGCAGG + Exonic
957034449 3:75281085-75281107 GCTGAAGGAGGTGGGGGGGCTGG - Intergenic
957199323 3:77112225-77112247 GATCAAGGAGTTTTGGGGGGTGG + Intronic
959660635 3:108864133-108864155 TTTGAAAGATGTTTGGGGACTGG - Intergenic
961105582 3:124238200-124238222 AATGAGGGATGTTTGCTGGCAGG + Intronic
961326409 3:126111901-126111923 GATGAAGGATGGCTGAGGCCTGG + Intronic
961469947 3:127105315-127105337 GATGAGGCATTTTTGGGGGTTGG + Intergenic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
962169866 3:133089617-133089639 GAGAAAAGATGTTTGGGAGCAGG + Intronic
963125035 3:141808232-141808254 GATGAAGGGAAATTGGGGGCTGG + Intronic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
964641520 3:158914365-158914387 GATTAAGGATGATTGTTGGCAGG + Intergenic
965459044 3:168938922-168938944 GATTATGTATGTGTGGGGGCAGG + Intergenic
968289011 3:197524728-197524750 TAGGAGGGATGTTTGGGGGTTGG + Intronic
968454580 4:690467-690489 GAGGAAGGTTGTGAGGGGGCTGG - Intergenic
968470132 4:776878-776900 GGTGAAGGAAGGTTGGGGGAAGG - Intergenic
968544777 4:1193314-1193336 GATGAAGGGTGTGTGGGGCAGGG - Intronic
970689359 4:18604385-18604407 GATGGGGGATGTGTGGGGACAGG - Intergenic
971573253 4:28241081-28241103 GAAGAAGGATGTTTGAGGGAGGG + Intergenic
972302369 4:37797049-37797071 GATGAAGGATGGATGAGGCCTGG + Intergenic
972559829 4:40216833-40216855 GATGACTGAAATTTGGGGGCAGG + Intronic
973392230 4:49566534-49566556 GAGGATGGATGGTTGGGGGGCGG + Intergenic
974434364 4:61838021-61838043 GATAAAGTTTGTTTGGGGGAGGG + Intronic
974942879 4:68489876-68489898 GATGTATGATATTTGGGGGATGG + Intronic
975351342 4:73350779-73350801 GATGAGAGATGTTTTGGGTCAGG - Intergenic
975883309 4:78937238-78937260 GATGGAGGTTGTTAGGGGGAAGG + Intronic
976548652 4:86367822-86367844 GATGACTGATGTTTGGCGACTGG - Intronic
976812088 4:89108998-89109020 GGTTATGGATGTGTGGGGGCAGG - Intronic
976882447 4:89944594-89944616 GATGAGGGTTGTTTAGAGGCAGG + Intronic
978379090 4:108107780-108107802 GAAGCAGCATGTTGGGGGGCGGG - Intronic
979596289 4:122538111-122538133 GATGAATGATGTTTGTTAGCAGG + Intergenic
979963527 4:127050062-127050084 GATGGACAATGGTTGGGGGCTGG - Intergenic
980692534 4:136313777-136313799 GATGAATGAGGTATGGGGGAAGG - Intergenic
981515827 4:145608580-145608602 GATTAAGGATGTTGGGGGGGGGG - Intergenic
981843958 4:149145300-149145322 GGGAAAGCATGTTTGGGGGCCGG + Intergenic
984480281 4:180291983-180292005 GAAGTAGGATGTTTGAGAGCTGG - Intergenic
984570243 4:181383404-181383426 GAAGAAGCAAGTTTGGGGGGTGG - Intergenic
985827971 5:2206797-2206819 AAAGAAGGCTGTTTGGGGCCTGG - Intergenic
988703558 5:33700573-33700595 CATGAGGAATCTTTGGGGGCTGG + Intronic
990277407 5:54212754-54212776 GATTAAGCATGTTTGGTGGTAGG + Intronic
990661421 5:58019858-58019880 GATGCAGGATTTATGGGGGTTGG + Intergenic
991034035 5:62109738-62109760 GATGTCTGATGTTTGAGGGCAGG - Intergenic
991986609 5:72293873-72293895 GATGAAGGGTGTATTTGGGCTGG - Intronic
994030430 5:95135645-95135667 GGAGAATGATGTTTGAGGGCAGG - Intronic
995064450 5:107844208-107844230 GAAGAAGGAGATCTGGGGGCTGG + Intergenic
995765283 5:115608929-115608951 GGTGAAGTGTGTTTGGGGCCTGG - Intronic
997263984 5:132484286-132484308 GATGGAGAAAGCTTGGGGGCAGG - Intronic
998261233 5:140633306-140633328 AATGAAGGATGTTTCAGGGAGGG + Exonic
998429004 5:142054478-142054500 GTAGAAGGATATTTGGGGACAGG - Intergenic
999109978 5:149110733-149110755 GTTGAAAGATGTCAGGGGGCTGG + Intergenic
999694146 5:154173397-154173419 GAGGAAGGATGGATGGGTGCTGG - Intronic
999711283 5:154320728-154320750 GAGGAAGGCTGTGTGGGGACTGG + Intronic
1001381132 5:171307435-171307457 GCTGCAGGATGTCTGGGGTCTGG - Exonic
1001491406 5:172158372-172158394 GATGAAGAATATTTGGGAGGCGG + Intronic
1001891887 5:175346212-175346234 GGTGAAGGTTGCTTGGGGACAGG + Intergenic
1002095567 5:176828832-176828854 TATGAAAGATGGATGGGGGCTGG + Intronic
1002107398 5:176886942-176886964 CATGAAGGGTATGTGGGGGCAGG + Intronic
1004452100 6:15756930-15756952 GATGAAGAATGAATTGGGGCCGG + Intergenic
1006213706 6:32420068-32420090 GATGTTGGATGATTTGGGGCTGG - Intergenic
1006505731 6:34487519-34487541 GATGCAGGAGGTTTGGATGCAGG + Intronic
1006698329 6:35951081-35951103 GGTGAGGGGTGGTTGGGGGCTGG - Intronic
1006952339 6:37833333-37833355 GAAGAGGGATTCTTGGGGGCCGG - Intronic
1007430225 6:41772109-41772131 GATGAAGGATAATGGGGGGCTGG - Intronic
1008745345 6:54663250-54663272 GATTAAAGATTTTTGGGGGGTGG - Intergenic
1014848722 6:126313492-126313514 GAAGAGGGATGACTGGGGGCAGG - Intergenic
1015503042 6:133953047-133953069 GAGGAAGGAAGGGTGGGGGCGGG + Intronic
1016648100 6:146433979-146434001 GATGACGGCTGTTTGGTTGCAGG - Exonic
1017443061 6:154482362-154482384 GATTTAGGATGTTTTGTGGCAGG - Intronic
1017879341 6:158548897-158548919 GGTGAAGGGTGTTGGGAGGCTGG + Intronic
1019704593 7:2491458-2491480 GATGGATGATGGTTGGGGGATGG - Intergenic
1019895851 7:3982542-3982564 CATTAAGAATGTTTGTGGGCTGG + Intronic
1020854805 7:13405855-13405877 GATGAACCATGTTTGGGGAAAGG - Intergenic
1021517480 7:21504065-21504087 GCTTAGGGATGTTTGGGAGCAGG + Intronic
1022105097 7:27191668-27191690 AGTGAAGGATTCTTGGGGGCTGG + Intergenic
1022208213 7:28182653-28182675 GATGAAGGAAGTAAGGGGCCTGG + Intergenic
1022534481 7:31087283-31087305 GATGAAGCATGTTGAGGGGGAGG + Intronic
1023484877 7:40675618-40675640 GATGAAGGAGGTATGGGAGTTGG + Intronic
1023673963 7:42610969-42610991 GATGTAGGGTGTTTTGGTGCTGG - Intergenic
1023737564 7:43248395-43248417 GATGAAGGATGTGGTGGGGCGGG - Intronic
1025996297 7:66529581-66529603 GATGAAGGATGGTTGGGGTCAGG + Intergenic
1026988308 7:74568798-74568820 GATGAAGGACAGTTGGGGTCAGG + Intronic
1030072194 7:105707437-105707459 GATGAAGAATGAGTGGGGGATGG + Intronic
1030591906 7:111492301-111492323 GGGGAAGTATATTTGGGGGCTGG - Intronic
1031610644 7:123822729-123822751 GATGAAGGTTGCTTGAGGCCAGG + Intergenic
1032000324 7:128260925-128260947 GATGTGAGTTGTTTGGGGGCAGG - Intergenic
1032680159 7:134174167-134174189 GGGGAAGGAAGTTGGGGGGCTGG + Intronic
1032998543 7:137477125-137477147 ACTGAAGAATGTGTGGGGGCAGG - Intronic
1036293764 8:7518296-7518318 GATGAAGGAGGGGTGCGGGCAGG - Intergenic
1036328797 8:7802699-7802721 GATGAAGGAGGGGTGCGGGCAGG + Intergenic
1036570399 8:9975355-9975377 GAAGAATTAAGTTTGGGGGCAGG - Intergenic
1038791094 8:30668869-30668891 GATAAAGGAAGCTTGGGGCCAGG + Intergenic
1038840558 8:31180857-31180879 GATGAAGAATCCTTGGGGCCAGG + Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1042053888 8:64741612-64741634 GTTTAAGAATTTTTGGGGGCTGG - Intronic
1043162404 8:76862329-76862351 GAAGAAGCATGTTTTGGGGGTGG + Intronic
1044733383 8:95251464-95251486 GATGATGGATGGATGGGAGCTGG + Intronic
1046263550 8:111802070-111802092 TATGAATTATGTTTGTGGGCTGG - Intergenic
1049464269 8:142743939-142743961 AATGAAGGATGGGTGGGGGATGG + Intergenic
1049614669 8:143570894-143570916 GCTGAAGGGTGCTTCGGGGCCGG - Exonic
1049675896 8:143888889-143888911 GCTGAAAGATGTATCGGGGCAGG + Intergenic
1051355598 9:16237292-16237314 GTGGAAGGTTGTTTGTGGGCTGG + Intronic
1052325091 9:27209034-27209056 GCTGAAGGTTCTTAGGGGGCAGG + Intronic
1055340429 9:75275965-75275987 GGTGAAGGATGTATGGTGGCAGG - Intergenic
1055501614 9:76907122-76907144 GATGTAGTGTGTTTGGGGACCGG - Intergenic
1056315895 9:85389406-85389428 TCTGAGGTATGTTTGGGGGCAGG - Intergenic
1057469470 9:95344717-95344739 GATGAAGGATGCTTAGGGCAAGG + Intergenic
1057926805 9:99159709-99159731 GATGAAGGAAGTATGGTGGGTGG - Intergenic
1058377486 9:104339963-104339985 GTTGGAGGATGTATGGGAGCTGG + Intergenic
1058433870 9:104943835-104943857 GCTAAAGAATCTTTGGGGGCCGG - Intergenic
1060863646 9:126977427-126977449 GATAAAAGTTGTTTGGGGGGTGG - Intronic
1061005584 9:127927197-127927219 GATGAAGTACGTCTGGGGGCCGG + Exonic
1061244781 9:129395898-129395920 GATGAAGGATGGATGGAGGATGG + Intergenic
1061450527 9:130664823-130664845 GGTGAAGGCTGTCTTGGGGCTGG - Exonic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062316804 9:135971410-135971432 GGTGGAGGATGCTGGGGGGCAGG + Intergenic
1062342499 9:136100010-136100032 GACGAAGGCTGCTTGGGAGCTGG - Intergenic
1062386516 9:136313889-136313911 GAGGAAGGCTGCTTTGGGGCTGG - Intergenic
1186371247 X:8949601-8949623 GAGCAGGGATGTTTGGGGACAGG + Intergenic
1186522964 X:10221894-10221916 GCTTGTGGATGTTTGGGGGCCGG + Intronic
1186760052 X:12713746-12713768 GAAGAATGTGGTTTGGGGGCTGG - Intronic
1186990343 X:15060248-15060270 AAAGAAGTAGGTTTGGGGGCAGG + Intergenic
1187498088 X:19813753-19813775 GAGGAGGTTTGTTTGGGGGCTGG - Intronic
1187869232 X:23750713-23750735 CATGAAGGAGGTGTGGGAGCAGG - Intronic
1188679214 X:32980617-32980639 TATGAAGGATACTTGGGAGCAGG - Intronic
1190825358 X:54013202-54013224 TATGAAGGATTTTTGAGGTCTGG - Intronic
1190846837 X:54200693-54200715 AATGGAGGATGTTTGGAGGAAGG - Intronic
1194932534 X:99904797-99904819 CAAGAAGGATGTTTGGGGAAAGG + Intergenic
1197962520 X:132022726-132022748 CCTGAAGCATGTTTGGGGTCAGG + Intergenic
1198252189 X:134890414-134890436 CATGATGGATGGTTGGGGGTGGG + Intronic
1198546253 X:137695715-137695737 GATGAATGAGGTTTTGGGGAGGG - Intergenic
1200782710 Y:7231400-7231422 GATAAAGGAATTTTGGGGCCAGG - Intergenic