ID: 906608980

View in Genome Browser
Species Human (GRCh38)
Location 1:47189327-47189349
Sequence CCCTGGGAGGTGGGCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1019
Summary {0: 1, 1: 1, 2: 28, 3: 138, 4: 851}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906608965_906608980 17 Left 906608965 1:47189287-47189309 CCAGGTGCAAAGCCCTTCTTCAC 0: 1
1: 0
2: 2
3: 18
4: 196
Right 906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG 0: 1
1: 1
2: 28
3: 138
4: 851
906608968_906608980 4 Left 906608968 1:47189300-47189322 CCTTCTTCACCTCTGACCTGGCA 0: 1
1: 1
2: 3
3: 41
4: 391
Right 906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG 0: 1
1: 1
2: 28
3: 138
4: 851
906608969_906608980 -5 Left 906608969 1:47189309-47189331 CCTCTGACCTGGCAGCAGCCCTG 0: 1
1: 0
2: 5
3: 50
4: 645
Right 906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG 0: 1
1: 1
2: 28
3: 138
4: 851
906608967_906608980 5 Left 906608967 1:47189299-47189321 CCCTTCTTCACCTCTGACCTGGC 0: 1
1: 0
2: 5
3: 38
4: 327
Right 906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG 0: 1
1: 1
2: 28
3: 138
4: 851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906608980 Original CRISPR CCCTGGGAGGTGGGCAGGGT GGG Intronic
900139787 1:1134862-1134884 CCCTGGGGGCTGGGCAGCGATGG + Intergenic
900154196 1:1197581-1197603 GCCTGGCGGGTGGGCAGGGGCGG - Exonic
900290488 1:1921652-1921674 GCCTGGGTGGTGGGGAGGGCAGG - Intergenic
900404782 1:2487745-2487767 GCCCCAGAGGTGGGCAGGGTAGG + Intronic
900411100 1:2513087-2513109 GCCTGGCAGGTGTCCAGGGTGGG - Intronic
900435263 1:2628169-2628191 CCATGGGCGGTGGGCAGTGGGGG - Intronic
900480252 1:2894730-2894752 CCCAGGAAGGAGGTCAGGGTGGG - Intergenic
900739910 1:4324546-4324568 ACCTGGAAGACGGGCAGGGTGGG - Intergenic
900793261 1:4693101-4693123 CCCAGGGAGGTTGACAGGGCTGG + Intronic
900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG + Exonic
900995672 1:6122024-6122046 CCCCGGGAGGTGGGCACAGCCGG + Intronic
901424863 1:9175781-9175803 CTCTGGGAGGTAGGCAGGACAGG + Intergenic
901497621 1:9630903-9630925 CCCTGGGAGGCTGGCTGGGTTGG + Intergenic
901658243 1:10782784-10782806 CCCTGGGAGGGGGGAAGGCTGGG + Intronic
902052718 1:13577008-13577030 CCATTGGAGGGAGGCAGGGTGGG + Intergenic
902228812 1:15014336-15014358 CCCTGCAAGGTGGGCAGGGTGGG - Intronic
902238855 1:15074986-15075008 CCCTGTGAGGTAGGCAGGACAGG + Intronic
902391669 1:16110793-16110815 CCCTGGGTGGTTGGTGGGGTGGG + Intergenic
902394283 1:16124182-16124204 CCCTGGGAGCAGGGGTGGGTGGG - Intergenic
902395532 1:16130485-16130507 CCTATGGAGGTGGGCAGGGGAGG + Intronic
902400099 1:16152873-16152895 CCCTGGGAGGGGGCCGGGGTTGG - Intronic
902478015 1:16698276-16698298 CCCTGAGGGCTGGGCAGGGCAGG + Intergenic
902519094 1:17005666-17005688 CCGTGGTAAGTGGGCAGAGTGGG - Exonic
903021633 1:20399298-20399320 CCCTGGGAGGAGGCCAGAGAAGG + Intergenic
903130882 1:21279012-21279034 ACCCGGGAAGTGGGCAGCGTGGG - Intronic
903240712 1:21980953-21980975 CCCGGGCAGCTGGGGAGGGTGGG + Intronic
903355855 1:22746934-22746956 CCCTAGGAGGGAGGCAGGGCTGG - Intronic
903469121 1:23573092-23573114 CCCTGGGAGGGAGTCAGGGTTGG - Intergenic
903579019 1:24357350-24357372 CTCTGGGAGGGGAGCTGGGTGGG - Exonic
903757645 1:25673834-25673856 ACCTGTGAGTTAGGCAGGGTAGG - Intronic
904010757 1:27388848-27388870 ACCTGGTAGGTGGGAAGGGTTGG + Intergenic
904279338 1:29407886-29407908 TCCTGCAAGGTGGGCAGAGTGGG - Intergenic
904396977 1:30228507-30228529 CACTGGGAGGCGTGCAGGCTTGG + Intergenic
904491731 1:30864654-30864676 TCCTGGGAGATGGGCTGGCTGGG - Intergenic
904537400 1:31208935-31208957 CCCTGGGAGGTGAGAAGGGTAGG - Intronic
904768489 1:32868435-32868457 CACTGGGAGGTGGGCAGGAGCGG - Intronic
904880991 1:33696731-33696753 GCCTGGCAGGTGGGCAGGAGGGG + Intronic
904896836 1:33824028-33824050 TCTTGGGAGGAAGGCAGGGTAGG + Intronic
905024550 1:34840678-34840700 AGCTGGGACGTGGGCAGGGAGGG + Intronic
905137473 1:35810589-35810611 CTCTGGGAGGTAGGCAGGGCAGG + Intronic
905172431 1:36117030-36117052 CCCTGCCAGGTGGGCTGGCTGGG - Intronic
905386634 1:37608952-37608974 GCCTGGGAGGTGAGGAAGGTGGG - Intergenic
905631846 1:39523130-39523152 CCCAGGGGGCTGGGCAGGATGGG - Intronic
905655540 1:39684194-39684216 CCCTGAGATGGGGGCGGGGTGGG - Intronic
905665916 1:39763057-39763079 CCCAGGGGGCTGGGCAGGATGGG + Intronic
905734185 1:40314911-40314933 CCCTTGGTGGTGGGCAGGCAGGG + Intronic
906058267 1:42932273-42932295 CCGTGGGAGCTGGCCAGGGTGGG - Intronic
906199277 1:43948643-43948665 CCCTTGGAGCAGGGCAGTGTTGG + Intronic
906536593 1:46554302-46554324 CCTTGGGAGGGGTGGAGGGTTGG - Intergenic
906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG + Intronic
906639305 1:47432162-47432184 CACTGGGGGGTGGGGTGGGTTGG + Intergenic
907050956 1:51329833-51329855 CAGTGGGATGTGGGTAGGGTTGG + Intronic
907338870 1:53719339-53719361 CCATGCCAGGTGGGCAGGGAGGG - Intronic
907440124 1:54473858-54473880 CACTGGGAGGGTGGCAGGGCCGG - Intergenic
908253221 1:62281721-62281743 CCCTGGGAGAAAGGCAGGGATGG - Intronic
908303410 1:62784832-62784854 CCCTTAGATGTGGGTAGGGTTGG - Intronic
908441584 1:64160525-64160547 GCCTGGAGGATGGGCAGGGTAGG + Intronic
908487244 1:64606805-64606827 CATTGGATGGTGGGCAGGGTAGG + Intronic
910220474 1:84885055-84885077 CCCTGGGAGGAGGAGAGGATTGG - Intronic
910302928 1:85727877-85727899 CCCTGGGAAGAGGGGAGGGCAGG - Intergenic
910773991 1:90856622-90856644 CCCTGGGAGGTGGGGGTGGGGGG - Intergenic
911101736 1:94100960-94100982 TCCTGGGAAGTGGGCAGGGAGGG + Intronic
911144954 1:94542361-94542383 CCCCGCGAGGTGGGCAGGCCAGG - Intergenic
912301963 1:108526934-108526956 ACCTGGGCGGTGGGCTGGGGCGG - Intergenic
912391570 1:109306819-109306841 CCATGGCAGGTGGGGAGGGTGGG - Intronic
912523763 1:110265721-110265743 CCCTTGGAGGTGGGTAGGACAGG + Intronic
913294805 1:117309033-117309055 CCCTGGGAGGTAGGCAGGTCAGG - Intergenic
914802941 1:150974089-150974111 GCCTGCGAGGTGGGCACGGTGGG + Intronic
914900514 1:151708940-151708962 GCCTGGCAGGTGGGCAGGGTGGG + Intronic
915141438 1:153770948-153770970 CCCTCGGAGGTGGGGAGGTGGGG + Intronic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
915557156 1:156667233-156667255 CCCTGTGTGGGGGGTAGGGTGGG + Intergenic
915634105 1:157174369-157174391 CCGAGGGAGGAGGGCAGGGCTGG + Intergenic
916694578 1:167221823-167221845 CCCTGGGGGGTGGACTGGATTGG + Intronic
917450945 1:175146870-175146892 TCTTAGGAGGAGGGCAGGGTGGG - Intronic
917512242 1:175678222-175678244 CCATGGAAGGTGGGCTGGGGTGG + Intronic
917512294 1:175678544-175678566 ACAGGGGAGGTGGGCAGGGCAGG - Intronic
918093084 1:181314078-181314100 CCCTGGAAGGAGCACAGGGTAGG - Intergenic
920054908 1:203184641-203184663 CACAGGGAGGTGGGGAGGGCAGG + Intronic
920174367 1:204090897-204090919 CCCTGTGGGGTGGGAAGGGATGG + Intronic
920387034 1:205576505-205576527 CTCTGGGAAGTGGCCAAGGTGGG + Intronic
920404308 1:205697495-205697517 CCCTGGGAGGAGGGCTGTGCAGG + Intergenic
920434043 1:205936740-205936762 ATCTGGGAGGTGGGGAGTGTGGG + Intronic
920543197 1:206794684-206794706 ACCTGCGAGGTGGGTAGGGGTGG + Intergenic
920558645 1:206922925-206922947 CCATGTGAGGTGGGCAGGGTAGG - Intronic
920982341 1:210849775-210849797 CCCTGGGCTGTGGGCAAGTTTGG - Intronic
921675144 1:217968378-217968400 TCCTGGGAGGTGGGGAGGCCAGG - Intergenic
921838987 1:219808378-219808400 TCCTGGGAGGTGGCCAGGGTGGG + Intronic
921964508 1:221074148-221074170 GGGTGGGAGGTGGGCAGGGTTGG + Intergenic
922338536 1:224637373-224637395 ACTTGGGGGGTGGGGAGGGTGGG - Intronic
922614000 1:226950273-226950295 GGTTGGGAGCTGGGCAGGGTTGG - Intronic
922724239 1:227915061-227915083 CACTGGGCAGTGGGCAGGGAGGG + Intergenic
922783756 1:228272997-228273019 CCCTGCGTGGTGGGGAGGGCTGG + Intronic
922817355 1:228459307-228459329 CCATGGGGGGCGGGTAGGGTTGG - Exonic
922988300 1:229883906-229883928 CCCAGGGAGCTGGGCACAGTGGG + Intergenic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
923614332 1:235524427-235524449 TCCTGGGAGGCGGGGAGGGAGGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
1063057149 10:2518302-2518324 CCGTGGGGGGTGGGGAGGATGGG - Intergenic
1063065050 10:2599811-2599833 ACCTGGGGGGTGGGCAAGGCAGG + Intergenic
1063429238 10:5975392-5975414 GCCTGGGAGATGGGCGAGGTGGG + Intronic
1064072417 10:12242219-12242241 CCCTGGGAGGAGGGTGGTGTTGG - Intronic
1064227566 10:13500858-13500880 GCATGGGAGGAGGGCACGGTGGG - Intronic
1064381344 10:14844223-14844245 CCCTGTGAGGTAGGCAGGGCAGG - Intronic
1065846324 10:29746631-29746653 TCCAGGGTGGTGGGCAGGTTTGG + Intergenic
1065883865 10:30059621-30059643 CCCCGGGCGGTGGGCGGGGCGGG - Intronic
1066449977 10:35520090-35520112 CACTGGGAGCTGGGCAGGGTGGG + Intronic
1067054193 10:43041756-43041778 CTTTGGGAGGTGGGCTGAGTTGG - Intergenic
1067370638 10:45678683-45678705 CGCTGTGAGGTGGGCAGGCGAGG + Intergenic
1067389137 10:45847460-45847482 CGCTGTGAGGTGGGCAGGCGAGG - Exonic
1067445121 10:46337089-46337111 CACTGTGAGGTGGGCAGGCGAGG + Intergenic
1067469068 10:46523265-46523287 CCCTGGGTGGGAGGCAGGGAGGG + Intergenic
1067502337 10:46816381-46816403 CGCTGTGAGGTGGGCAGGCGAGG + Intergenic
1067548458 10:47214699-47214721 CCCTGGATGCTGGGCAGGGGTGG + Intergenic
1067592250 10:47523639-47523661 CACTGTGAGGTGGGCAGGCGAGG - Intronic
1067639367 10:48031712-48031734 CACTGTGAGGTGGGCAGGCGAGG - Intergenic
1067683625 10:48454957-48454979 TCCTGGGAGATGGGCTGGCTGGG - Intronic
1067874120 10:49988581-49988603 CGCTGTGAGGTGGGCAGGCGAGG + Intronic
1068204434 10:53830935-53830957 CCTTTGGAGCTGGGCAGAGTGGG + Intronic
1068845147 10:61663173-61663195 GCCTGGGAGGGCGGCAGGGCTGG + Intronic
1069557873 10:69409184-69409206 CCCTGGGAGGCGCCCAGGGTGGG - Intronic
1069680118 10:70278215-70278237 CCCTGGGACGTGGGGAGAGGGGG - Intronic
1069718042 10:70533118-70533140 CCCATGGAGGTGCTCAGGGTGGG + Intronic
1070136359 10:73697868-73697890 CGCTGTGAGGTGGGCAGGCGAGG - Exonic
1070151336 10:73807038-73807060 CCCAGGGAGGTGGACAGTGAAGG + Intronic
1070664950 10:78336291-78336313 CCCTGGGAGGTAGGCAGGGATGG + Intergenic
1070694433 10:78551657-78551679 CCCTGGGAGCTTGGTAGTGTTGG + Intergenic
1070751888 10:78968703-78968725 GCCTGGGAGCTGGCCAGGGGAGG + Intergenic
1070752440 10:78972308-78972330 GACTGGGAAGTGGCCAGGGTTGG + Intergenic
1070788784 10:79177488-79177510 CCCTGCGAGGTGAGAAGGGCCGG + Intronic
1071572001 10:86702388-86702410 CCCTTGGTGGTGGGAATGGTGGG - Intronic
1071843516 10:89498191-89498213 TACTCGGAGGTGGGTAGGGTAGG + Intronic
1072537039 10:96371700-96371722 CCCAGGCAGGTGGGGAGGGTGGG - Intronic
1073063607 10:100745978-100746000 CCCGGGGCGGTGGGCCGGGCCGG - Exonic
1073133399 10:101205394-101205416 CGCCGGGAGCTGGGCAAGGTAGG - Intergenic
1073288606 10:102402565-102402587 GCCTGGCATGTGGGCAGGGTGGG - Intergenic
1073510803 10:104041263-104041285 CACTGGGAGGTGGGAGGGGGAGG - Intronic
1073563302 10:104515390-104515412 ACCTGGGAAGTGGGGAGGGCTGG + Intergenic
1073608988 10:104924627-104924649 CCCTGGGAGGTGGGCTATCTGGG + Intronic
1074370965 10:112900541-112900563 ACCTTGGAGGTGGACTGGGTAGG - Intergenic
1074868745 10:117560949-117560971 TCAGGGGAGCTGGGCAGGGTGGG - Intergenic
1074985248 10:118652540-118652562 ACCTGGGAAGTGCACAGGGTCGG - Intergenic
1075706712 10:124506635-124506657 CTTAGGGAGGTGGGGAGGGTAGG + Intronic
1076067466 10:127460067-127460089 CCATGGGAGGTGTGCAGGGGAGG - Intergenic
1076433687 10:130425169-130425191 CCCTGGGTGGTCTGCAGGGCAGG + Intergenic
1076546080 10:131246438-131246460 GGCTGGGAGGTGGGCAGGGCAGG + Intronic
1076843376 10:133057355-133057377 CACAGGGAGGAGGGCAGGGCAGG + Intergenic
1077111516 11:864166-864188 CCCAGGGATGGGGGCAGGGGAGG + Intronic
1077155726 11:1090065-1090087 ACCTGGAGGGTGAGCAGGGTGGG + Intergenic
1077160322 11:1109703-1109725 GCCTGGGGGGTAGGCAGGGTGGG + Intergenic
1077164943 11:1130753-1130775 AGGTGGGAGGTGGGCAGAGTGGG - Intergenic
1077236930 11:1486361-1486383 CCCAGGAAGGAGGTCAGGGTGGG - Intronic
1077323019 11:1950820-1950842 CACTCGGAGGTCTGCAGGGTTGG + Intronic
1077340036 11:2022129-2022151 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1077376094 11:2205667-2205689 GGCTGGGAGGTGGGGAGGCTGGG - Intergenic
1077376272 11:2206186-2206208 GGCTGGGAGGTGGGGAGGCTGGG - Intergenic
1077459328 11:2700760-2700782 GGATGGGAGGTGGGCAGGGCGGG - Intronic
1078085622 11:8231661-8231683 GCCGGGGAGGTGGGGAGGGGTGG - Intronic
1078110267 11:8386553-8386575 GCCTGGGAGGTGGGCAGCCAGGG + Intergenic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1078715682 11:13836905-13836927 CCCTGGGAAGTGGACAGGGAGGG + Intergenic
1078763168 11:14268329-14268351 CGCTGGGAGGTGGGCCTAGTGGG + Intergenic
1078916519 11:15783734-15783756 CCCAGGGAGGTGTGCAGTGCAGG - Intergenic
1079355167 11:19724618-19724640 CTATGGGAGGTGGTCAGTGTTGG - Intronic
1080508224 11:32939891-32939913 CCCTGGGATCTGGACAGTGTAGG - Intronic
1080600547 11:33817818-33817840 CCCTGGGAACTGGGCAGAGGTGG + Intergenic
1081651940 11:44830034-44830056 CCTTGTGAGGAGGGCAGGGGTGG - Intronic
1081733642 11:45388807-45388829 TCCTGGGAGGTGGGCAAGGCAGG + Intergenic
1081778851 11:45695994-45696016 CCCTGTGAGGTAGGCAGGATGGG - Intergenic
1081808167 11:45901123-45901145 TCCTGGGAGGTGGGGCGGCTGGG + Intronic
1081967826 11:47180147-47180169 CCCTGGGCGGGGGCCAGGGCTGG + Intronic
1083222785 11:61264509-61264531 CCCAGGAAGCAGGGCAGGGTCGG + Exonic
1083388653 11:62332228-62332250 CACTGGGAGGTGGGGGGAGTAGG + Intergenic
1083474680 11:62908408-62908430 TGCAGGGATGTGGGCAGGGTTGG + Intergenic
1083528952 11:63398689-63398711 TGCTGGGAGATGGGCAGGGTTGG + Intronic
1083612025 11:64008829-64008851 CCCTGGCAGGCGGGCAGGAGAGG - Intronic
1083614317 11:64018841-64018863 CCCTTTGAGGTGGGCATGTTGGG - Intronic
1083642667 11:64153833-64153855 CTCTGGGAGGTGGGCTTGGCAGG - Intronic
1083781957 11:64923383-64923405 GCCTGGGAGGTGGGCAAGGAGGG + Intronic
1083827617 11:65212177-65212199 CCCTGGGAGGTTGGGAAGGAGGG + Intergenic
1084103716 11:66966933-66966955 CTTTGGGAGGTGGGCGGTGTGGG - Intergenic
1084153207 11:67300792-67300814 CCCAGGGAGGAGGGCAGCTTGGG + Intronic
1084180027 11:67441583-67441605 CCCAGGGTGGTGGGCAGAGTGGG - Intronic
1084214328 11:67639394-67639416 CCAGGGTGGGTGGGCAGGGTGGG - Intronic
1084323413 11:68385863-68385885 CCCTGCAAGGTGGGCATGCTGGG + Intronic
1084420393 11:69057810-69057832 CCATGGGAGGTGGGCAGTGCTGG - Intronic
1084621346 11:70271807-70271829 CCCAGTGGGGTGGGGAGGGTGGG - Intronic
1085154256 11:74278893-74278915 CAGTGGGGGGTGGGCAGGGCTGG + Intronic
1085170114 11:74442534-74442556 CCCTCTGAGGTGGACAGGGTAGG + Intergenic
1085254932 11:75167051-75167073 CCTTGGGAGGTGGCCAGAGGAGG + Intronic
1085296941 11:75436666-75436688 CCATGGTTGGTGGGCAGGGGTGG - Intronic
1085511396 11:77090039-77090061 CCCTGTGAGATGGGCACTGTTGG - Intronic
1085522675 11:77147551-77147573 ACCTAAGAGGTGGGCAGGGCAGG - Intronic
1085750376 11:79155923-79155945 GGCTGGCAGGTGGGAAGGGTGGG - Intronic
1085836883 11:79966556-79966578 CCCTGCGTGGTGAGCAGGATAGG + Intergenic
1087149130 11:94842838-94842860 CCCTGGGAGAGGGACAGGGAAGG - Intronic
1087377949 11:97367823-97367845 CCTTGGGTGGTGGGCAGGGTGGG + Intergenic
1087490654 11:98822935-98822957 CTTGGGGCGGTGGGCAGGGTGGG + Intergenic
1088583202 11:111334912-111334934 CCCGGGGAGCTGTGCAGGGCAGG + Intergenic
1088693551 11:112347743-112347765 CCCTGGGAATTGGGGAGGATGGG - Intergenic
1088810500 11:113388448-113388470 CCCTGAGAGCTGGGGTGGGTAGG - Intronic
1088847168 11:113678293-113678315 TCCTGGGAGGTGGGCAGGCATGG - Intergenic
1088888307 11:114024882-114024904 GCCTGGGAAGAGGGCATGGTGGG + Intergenic
1089305616 11:117524502-117524524 CTCTGGGAGGTAGGAAGGCTGGG + Intronic
1089399403 11:118155816-118155838 CCCTTGGGGGAGGGCAGGGGTGG + Intergenic
1089497554 11:118915486-118915508 CTCTGAGAGGAGGGCAGGGGAGG - Intronic
1089509554 11:118987638-118987660 AACTGGGAGAGGGGCAGGGTAGG + Intergenic
1089543880 11:119206979-119207001 GCCTGGGAGGTTAGCAGGGAGGG + Intronic
1089565605 11:119369678-119369700 GCTTGAGAGGTGGGCAGGGCGGG + Intronic
1089586334 11:119512139-119512161 CGTGGGGAGGTGGGCAGGGGCGG + Intergenic
1089607053 11:119647551-119647573 CCAGAGGAGGTGGGCAGGCTGGG - Intronic
1090227974 11:125083001-125083023 TCCTGGGGGCTGGGCAGGGCGGG - Intronic
1090805142 11:130197986-130198008 CCATGGGACGCGGGCAGGGTGGG - Intronic
1091280617 11:134379778-134379800 CGGTGGGTGGTGGGCAAGGTGGG - Intronic
1091353521 11:134916191-134916213 CCTCAGGAGGAGGGCAGGGTGGG - Intergenic
1202806004 11_KI270721v1_random:6015-6037 CACTCGGAGGTCTGCAGGGTTGG + Intergenic
1202823021 11_KI270721v1_random:77318-77340 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1091588182 12:1827885-1827907 CCCTGGGATGGGGGCGGGGCAGG - Intronic
1091657319 12:2355070-2355092 CCCGGGGAAGCGGGCAGAGTTGG - Intronic
1091705738 12:2691752-2691774 CCGTCGCAGGTGGGCAGGGACGG - Intronic
1091821686 12:3480258-3480280 ACCTGGAAGGTAGGTAGGGTTGG + Intronic
1091911956 12:4240116-4240138 TCCTGGGTGGTGGGCATGGAAGG + Intergenic
1092154272 12:6272330-6272352 CTGTGGGAGGTGGGGAAGGTGGG + Intergenic
1092523652 12:9296407-9296429 ACCTTGGAGGTGGGCAGGAACGG - Intergenic
1092543645 12:9435492-9435514 ACCTTGGAGGTGGGCAGGAACGG + Intergenic
1092810333 12:12266667-12266689 TCCTGAGAGGTGGGAAGAGTGGG - Exonic
1095766339 12:45899779-45899801 CCCTTGGAGGTGGGAGGGGGGGG - Intronic
1095983109 12:47983806-47983828 CCAGGGGAGGTCAGCAGGGTGGG + Intronic
1096102615 12:48978807-48978829 GCGTGGGAGCTGGGTAGGGTTGG - Intronic
1096217030 12:49803470-49803492 CCCTGGGAGACGGGCAGAGGAGG + Intronic
1096347834 12:50866214-50866236 CTCTGGGAGGTGGGTAGCCTGGG + Intronic
1096778182 12:53976342-53976364 CTCTGGGAAGGGAGCAGGGTGGG - Exonic
1096788645 12:54031852-54031874 ACCTGGGGGGTGGGCAGGGCAGG - Intronic
1097140123 12:56895321-56895343 CTCTGGGAGGAGGCCAAGGTGGG - Intergenic
1097249988 12:57627239-57627261 CCCTGGGAGTAGAGCAGGGGTGG + Intronic
1097262653 12:57728178-57728200 CCCTGGGAGTGGGGCAGTGGGGG + Intronic
1097280808 12:57844902-57844924 AGCTGGGAGGGGGGAAGGGTGGG - Intronic
1101211577 12:102540080-102540102 CCCTGGGAGGTCAGAAGGGCAGG - Intergenic
1101376752 12:104177945-104177967 CCCAGTGAGGAGGTCAGGGTGGG - Intergenic
1101398433 12:104367988-104368010 CCATGGCAAGTGGGCAGGGGAGG - Intergenic
1101443910 12:104723608-104723630 CCCTGGGAGGTGGTAAGAGTTGG + Intronic
1101444292 12:104726543-104726565 CACTGGGAGGTGGACAGAGGAGG + Intronic
1101587996 12:106101758-106101780 ACCTGTGAGGTGGGCAGGCCAGG - Intronic
1101672486 12:106888902-106888924 TCCTGGGAGGCAGGCAGGGCAGG + Intronic
1102029822 12:109733779-109733801 CCCTGGGGTGGGGACAGGGTTGG + Intronic
1102418867 12:112788146-112788168 ACCAGGGAGGTGGGCAGGATGGG + Intronic
1102869477 12:116402393-116402415 CATTGGGAGGTGGTGAGGGTGGG + Intergenic
1102887478 12:116533065-116533087 CCCTAGGAGGTAGCCAGGGCAGG - Intergenic
1102960110 12:117086987-117087009 CCTTGGGAGGGAGGCAGGGAGGG + Intronic
1102960855 12:117092473-117092495 CCCAGAGAGGAGGGCAGGGGAGG + Intronic
1103554366 12:121757130-121757152 CCCTGGGCGGTGGGGGGGGGGGG + Intronic
1103559749 12:121787300-121787322 CCCTGGGAGGTGCGCTGGGTGGG + Intronic
1103603271 12:122067899-122067921 CCCTGGGAGGTGGGCAGGTCAGG - Intergenic
1103715928 12:122945314-122945336 ACATGGGAGGTGGGCAGGTCAGG - Intronic
1103843647 12:123886295-123886317 CCCTAGGAAGTGGCGAGGGTTGG + Intronic
1104111883 12:125711817-125711839 CACTGGTAGGTGCCCAGGGTTGG - Intergenic
1104270861 12:127281001-127281023 CCCTGGGCACTGGGCAGGGCTGG + Intergenic
1104278461 12:127352223-127352245 CCCAGGGAGGTCAGCAGGGAAGG + Intergenic
1104568477 12:129904568-129904590 CCCTGGGAGATGCGCAGGGCGGG - Intergenic
1104754128 12:131258376-131258398 CCTGGGGAGCTGGGCGGGGTAGG + Intergenic
1104778734 12:131406066-131406088 CCTGGGGAGGTAGGTAGGGTCGG - Intergenic
1104810370 12:131616897-131616919 GGCTGGGAGGTGGACAGGGCGGG - Intergenic
1104810388 12:131616952-131616974 TCCTGGGAGGCGGACAGGGTGGG - Intergenic
1104898319 12:132175091-132175113 CTCTGGGAGGTGAGGAGGGCTGG + Intergenic
1104986443 12:132600249-132600271 CCCCGGCAGGTGGGCATGGCAGG + Intergenic
1105441610 13:20419919-20419941 CCCTGGAAGGTGGCGTGGGTGGG - Intronic
1106157544 13:27171928-27171950 CCCTGTGCGCTGGGCGGGGTGGG - Intergenic
1109638063 13:65149672-65149694 CCCTCGGCGGTGGGGAGGCTCGG + Intergenic
1111144051 13:84157462-84157484 TCCTGGGAGTTGGGCAGAGAGGG + Intergenic
1112200521 13:97269580-97269602 CCCTGGGTGGGAAGCAGGGTTGG - Intronic
1112783772 13:102929642-102929664 CCCTGGGAGGTGGGGAGAGGAGG + Intergenic
1112898661 13:104333369-104333391 AACTGGAAGGTGGGTAGGGTTGG + Intergenic
1113200755 13:107866190-107866212 CCCGGGGAGGGGGGCAGGGTGGG + Exonic
1113444740 13:110356544-110356566 CCCAGAGAGGTGGGCAGGAGTGG - Intronic
1113608846 13:111629088-111629110 CACAGGAAAGTGGGCAGGGTGGG + Intronic
1113682785 13:112255898-112255920 CCCTGGGCGGTGGGTGGGGATGG - Intergenic
1113697099 13:112354468-112354490 CCCAGGGAGGGAGGCCGGGTCGG - Intergenic
1114420387 14:22577430-22577452 ATCTGGGAGGTTGGGAGGGTGGG + Intronic
1114517024 14:23306907-23306929 ACCTGGCAGGCGGGCGGGGTTGG + Intronic
1114557917 14:23572246-23572268 CACTGGGAAGGGGGCAGGATAGG - Intronic
1114616462 14:24071394-24071416 CCGGGGGAGGAGGGCAGGCTGGG - Intronic
1114657805 14:24326357-24326379 CAGGGGGAGGTGGGCATGGTGGG + Intronic
1114671946 14:24416095-24416117 CCCAGGGGGGTGGGCAGTGGTGG + Exonic
1114672603 14:24419559-24419581 GTCTTGGAAGTGGGCAGGGTTGG + Intergenic
1118761920 14:68885320-68885342 CCGTGGAAGATGGGGAGGGTGGG - Intronic
1119206429 14:72797883-72797905 CCCTGTGAGGTTGACAGGGAAGG - Intronic
1119421417 14:74509914-74509936 CACTGGCAGGTAGGCAGGGGTGG + Intronic
1119473201 14:74911900-74911922 ACCTGGGAGGGGGTCAGGCTGGG - Intronic
1119642943 14:76328541-76328563 CCCTGGGAGGTGTGTGGGGCGGG - Intronic
1120780189 14:88479711-88479733 GCCTGGGGGGCGGGTAGGGTGGG + Exonic
1121583009 14:95044851-95044873 CACTGGGAGGAGGGCGGGATCGG + Intergenic
1121629928 14:95414445-95414467 CCCTGGGAGGTGCCCAGTGGTGG - Intronic
1122064208 14:99160256-99160278 GCCTGGCAGCTGGGCAGGGGTGG - Intergenic
1122151331 14:99727638-99727660 ACCTGGCAGGGGGGCAGGGCAGG + Intergenic
1122217666 14:100214614-100214636 CCCGGGGAGGAGGGCGGGGCGGG - Intergenic
1122290533 14:100678304-100678326 CCCCGGCAGCTGGGCAGGGGTGG + Intergenic
1122319502 14:100845355-100845377 CTCTGGGGGGCGGGCAGGGGTGG - Intergenic
1122321612 14:100858973-100858995 CCCTTGGAGGTGGGCGGGGCTGG + Intergenic
1122501285 14:102201899-102201921 CACTGAGAGATGGGCAGGGCAGG - Intronic
1122719062 14:103712152-103712174 CCCCGTGAGGCGGGCAGGGCAGG + Intronic
1122774912 14:104112841-104112863 GCGTGTGAGCTGGGCAGGGTGGG + Exonic
1122798102 14:104216460-104216482 CCCTGGGGAGTTGGCAGGGGTGG + Intergenic
1122813415 14:104300225-104300247 CCGGTGGAGGAGGGCAGGGTGGG + Intergenic
1122880294 14:104687807-104687829 CCCAGGCAGGTGGACAGGGGAGG + Intergenic
1122901818 14:104785204-104785226 TCCTGGCAGGCGGGGAGGGTGGG - Intronic
1123019597 14:105391513-105391535 CTCCTGGGGGTGGGCAGGGTGGG - Intronic
1123471923 15:20562144-20562166 CTCTGGGAGAGGGGCAGGGCCGG - Intergenic
1123646083 15:22438209-22438231 CTCTGGGAGAGGGGCAGGGCCGG + Intergenic
1123732226 15:23157135-23157157 CTCTGGGAGAGGGGCAGGGCCGG - Intergenic
1123750361 15:23354517-23354539 CTCTGGGAGAGGGGCAGGGCCGG - Intergenic
1124282731 15:28378433-28378455 CTCTGGGAGAGGGGCAGGGCCGG - Intergenic
1124299971 15:28533180-28533202 CTCTGGGAGAGGGGCAGGGCCGG + Intergenic
1124710237 15:32003728-32003750 CACTGGGTGGTGGGTGGGGTGGG - Intergenic
1124720891 15:32110022-32110044 CCCTGGAAAGTGGGCATGGTAGG - Intronic
1126309571 15:47300425-47300447 CCTGGGGGGGTGGGCAGTGTTGG + Intronic
1126684886 15:51240045-51240067 CCGGGGGAGGGGGGCGGGGTTGG - Intronic
1127867325 15:63043044-63043066 CCCTGGGTGGTGGTGGGGGTAGG - Intronic
1127974605 15:63987895-63987917 CCCTGGGAAGTGGGCAGGGCAGG - Intronic
1128141023 15:65301156-65301178 CCATGGCGGGTGGGCAGGGTAGG + Intergenic
1128222611 15:65979790-65979812 CCATGGCAGCTGGGCAGGGCAGG + Intronic
1128336267 15:66787529-66787551 TGGTGGGAGGTGGGCGGGGTGGG + Intergenic
1128441577 15:67714392-67714414 CCCTGGCAGCTGGGTAGGGGTGG - Intronic
1128578185 15:68790371-68790393 CCTTGGGCTGTGGGCAGGGGTGG - Intronic
1128608808 15:69057962-69057984 CCCTGGGCAGAGGACAGGGTGGG + Intronic
1128801060 15:70497412-70497434 TCCTGGGAGGAGGACTGGGTTGG - Intergenic
1129186685 15:73911593-73911615 GACTGGGAGGTGGGCTGGGGTGG + Intergenic
1129336281 15:74854019-74854041 ACCTGGGGGGTCGGCTGGGTTGG + Exonic
1129392502 15:75227550-75227572 CCCTGGGTGGAGGTCATGGTGGG + Intergenic
1129456880 15:75680846-75680868 CTCTGGGAGGAGGGCAGGACTGG - Intronic
1129471890 15:75760634-75760656 CCCTGGGAGGAGGTCATGGTGGG - Intergenic
1129604333 15:77017499-77017521 TCCAGGGAGGTGGGCATGGAGGG - Intronic
1129672084 15:77613097-77613119 CCCTGTGAGGTAGGCAGGGCAGG + Exonic
1129738084 15:77976715-77976737 GACAGGGAGGGGGGCAGGGTGGG + Intergenic
1129772140 15:78209107-78209129 TCCTGGGAACTGGGCAGGGATGG - Intronic
1129847992 15:78776894-78776916 GACAGGGAGGGGGGCAGGGTGGG - Intronic
1129965223 15:79729043-79729065 TCCTGTGAGCTGGGGAGGGTGGG - Intergenic
1130253923 15:82317041-82317063 GACAGGGAGGGGGGCAGGGTGGG + Intergenic
1130905132 15:88234870-88234892 CCCTGGGAGCAGGGCTGAGTAGG - Intronic
1130967906 15:88710678-88710700 CTTGGGGAGGAGGGCAGGGTTGG + Intergenic
1130989868 15:88869896-88869918 CTCTGGGAGGTGGGTATGGGAGG - Intronic
1131401348 15:92128092-92128114 GCTTGGGTGGTGGGCTGGGTGGG - Intronic
1131431879 15:92394427-92394449 GCCAGGCAGGGGGGCAGGGTGGG - Intronic
1131667681 15:94587683-94587705 CTTTGGGAAGTGGGAAGGGTGGG + Intergenic
1131667918 15:94590090-94590112 CCCTGGGAAGTGGGTAGGAAAGG + Intergenic
1132225354 15:100136577-100136599 CCCTGGGAGGCAGGCAGGAGGGG + Intronic
1132338628 15:101064465-101064487 CCCTGGGAGGTGCCCCGGGGCGG + Intronic
1132615421 16:839121-839143 CCCTGGGAGCTGGAAAGGGCAGG - Intergenic
1132632708 16:927579-927601 CCCTGGGAGCTGGGAAGGGGAGG + Intronic
1132684970 16:1158437-1158459 CCCGGGGATGATGGCAGGGTAGG + Intronic
1132755303 16:1481587-1481609 GGCTGGGGGGTGGGTAGGGTGGG + Intergenic
1132760397 16:1506088-1506110 GCCTGGGAGCTGGGCGGGGCCGG + Intronic
1132779404 16:1614435-1614457 CCCGGGCTGGTGGGCAGGGCCGG + Intronic
1132786251 16:1658416-1658438 CCCAGGGAAGGGGCCAGGGTGGG + Intronic
1132887699 16:2189769-2189791 CCCTGGGAGGTGGGAATGCTGGG + Intronic
1132994732 16:2817185-2817207 CCCTGGGGGCGGGGCGGGGTGGG - Intronic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1133204383 16:4224278-4224300 GTCTGAGGGGTGGGCAGGGTTGG - Intronic
1133236614 16:4390208-4390230 CCAAGGGAGGTGGCCAGGCTGGG - Intronic
1133270822 16:4610107-4610129 CCCTGGGCGGCGGACAGGCTTGG - Intronic
1133314702 16:4875455-4875477 CCCTGTGAGTGGGGCAGGGCAGG - Intronic
1133339090 16:5025301-5025323 CCCTGGCAGGTGGCCAGGTGAGG + Exonic
1133772269 16:8874126-8874148 CTTTGGGAGGAGGCCAGGGTGGG - Intergenic
1134023632 16:10938745-10938767 CCCTGGGAAGTGGGGAGGCCTGG - Intronic
1134191886 16:12127934-12127956 CCCTGGGACGTGGGGAGAGGGGG + Intronic
1134440793 16:14298610-14298632 TCCTGGGAGAAGGCCAGGGTGGG + Intergenic
1134641522 16:15832884-15832906 CACTGGAAGGTGGGCAGAGCTGG - Intronic
1134685437 16:16155018-16155040 CCCGGGCAGGTGGGCATCGTTGG - Exonic
1134781015 16:16895693-16895715 CCGGGGGAGGGGGGCGGGGTGGG - Intergenic
1135005611 16:18819364-18819386 CCCTGGGAGGAGGGACGGATGGG - Intronic
1135048483 16:19173370-19173392 AGAGGGGAGGTGGGCAGGGTGGG - Intronic
1135819012 16:25663435-25663457 TCCTTGGGGGTGGGTAGGGTAGG + Intergenic
1135976624 16:27112704-27112726 CCCTGTGAAGTGGTGAGGGTAGG + Intergenic
1136136672 16:28260466-28260488 CCCTGGGTGGGGAGAAGGGTAGG + Intergenic
1136185445 16:28585798-28585820 CCATGGGAGGAAGGCAGGCTGGG - Intronic
1136284869 16:29234747-29234769 TCCTGGGAACTGGGCAGAGTGGG + Intergenic
1136366231 16:29810471-29810493 CCCTGGACAGTGGGCAGGGGTGG + Exonic
1136395821 16:29991862-29991884 CCCTGGGGGAGGGGAAGGGTGGG + Intronic
1136429376 16:30187852-30187874 GGGTGGGAGGTGGGCAGGATGGG + Intronic
1137001704 16:35235091-35235113 CCTTGGGAGGTGGGGAAGATGGG - Intergenic
1137494283 16:48957779-48957801 TGCTGGGAGGTGGGATGGGTGGG - Intergenic
1137676470 16:50305984-50306006 TCCTGGGCGGGGGGCAGGGGCGG + Intronic
1137757973 16:50917888-50917910 ACCTGGGATGTGGGCTGGCTAGG - Intergenic
1138229346 16:55325998-55326020 TCCTGGGAGGAGGGTAGGGAAGG + Intronic
1138328045 16:56191636-56191658 CCCCGCGCGCTGGGCAGGGTTGG - Intronic
1138428417 16:56951710-56951732 CCCTGTGCGGTGGGCAGAGCAGG - Intergenic
1138508911 16:57496653-57496675 CCCTTGGGTGTGGGCAGGGCCGG + Intergenic
1138638549 16:58364044-58364066 ACCTGTGGAGTGGGCAGGGTGGG + Intronic
1139471276 16:67179364-67179386 GCCTGGGAGCTGGGAGGGGTGGG - Intronic
1139655269 16:68383610-68383632 CCCTAGGAAGTGGGCAGGGAAGG - Intronic
1139677060 16:68530801-68530823 CCCTGGGAGGAGAGGCGGGTGGG + Intronic
1139914748 16:70421104-70421126 CCCTGGGAGGTGGGCTGGGGAGG + Intronic
1139923073 16:70471576-70471598 CTCTGCCAGGTGGGCTGGGTGGG + Intronic
1141551397 16:84808994-84809016 CTCTGGGTGGAGCGCAGGGTTGG - Intergenic
1141557248 16:84844285-84844307 TGCTGGGAGGTGAGCAGGGCTGG + Intronic
1141695356 16:85616478-85616500 CCCTGGGATCGGGCCAGGGTTGG + Intronic
1141722067 16:85761896-85761918 CCCTGAGACGTGGGGTGGGTGGG + Intergenic
1142012765 16:87725163-87725185 CTCTGGGCGGAGGGGAGGGTGGG + Intronic
1142089930 16:88204371-88204393 TCCTGGGAACTGGGCAGAGTGGG + Intergenic
1142303128 16:89270449-89270471 GCCAGGGCGGTGGGCAGGGGCGG - Intronic
1142427340 16:90008130-90008152 TCCTGGGAGGTGTGCGTGGTGGG - Intronic
1142427413 16:90008333-90008355 TCCTGGGAGGTGTGCGTGGTGGG - Intronic
1142496840 17:310494-310516 CCCTGGGAGGTGTGTGGGCTTGG - Intronic
1142961329 17:3554089-3554111 CCCTGGGAACTGGGCAGGGCTGG - Intronic
1143352358 17:6298079-6298101 CCCTGGGAGGGAGGCTGGGAGGG - Intergenic
1143514871 17:7414529-7414551 GTCTGGGAGGTGGGCCTGGTGGG + Intronic
1143739531 17:8942247-8942269 TCCTGGGAGGTGGCCAAGATAGG - Intronic
1144065238 17:11618774-11618796 CCCTGCAAGGTGGGCAGGGAAGG + Intronic
1144140279 17:12341245-12341267 CCGTGGGGGTTGGGCTGGGTGGG + Intergenic
1144316727 17:14069253-14069275 CCGGGTGAGGTGGGCAGGGTTGG - Intergenic
1144509340 17:15861941-15861963 TTCTGGCAGGTGGGCAGGGGTGG - Intergenic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1144729389 17:17517906-17517928 CTCTGGAAGGTGGTCTGGGTGGG - Intronic
1144758512 17:17694433-17694455 CTCTGAGAGGTGGGCCAGGTTGG - Intronic
1144854741 17:18261552-18261574 CCCTGGGAGCTGAGAAGGGCTGG - Intronic
1145173452 17:20679588-20679610 TTCTGGCAGGTGGGCAGGGGTGG - Intergenic
1145252236 17:21302940-21302962 CCCTGGGAGGTGAGCCCGGGAGG + Intronic
1146123055 17:30211608-30211630 TCCTGGGAGGCAGGAAGGGTGGG + Intronic
1146162206 17:30566085-30566107 TTCTGTGCGGTGGGCAGGGTGGG + Intergenic
1146462625 17:33058211-33058233 CCCTGGGAGGTAGGTAAGGCAGG + Intronic
1146656877 17:34639722-34639744 CTCTGAGAGGTGGGCAGTGAAGG - Intergenic
1146678365 17:34789455-34789477 TCCTTGGAGGTGGGCAAGCTGGG + Intergenic
1146939336 17:36833225-36833247 TCCTGGGAGGTGGGTGGGATGGG + Intergenic
1147158319 17:38556603-38556625 CTATGGGAGCTGGGCAGGGAGGG + Intronic
1147255115 17:39176733-39176755 CCATGGGAGGAGGGCAAGGCAGG + Intronic
1147359410 17:39921732-39921754 CTTTGGGATGTGGGCAGGGAGGG - Intronic
1147393308 17:40122781-40122803 CCCTGGGAGGAGGCCAGCGGGGG - Intronic
1147567877 17:41548692-41548714 CCCGGTGAGGTGGGCAGGGCAGG - Intergenic
1147595278 17:41712646-41712668 CCCTGGGAGGTGAGGAGGACTGG + Intronic
1147652481 17:42070486-42070508 GCCTGGGAGAAAGGCAGGGTGGG + Intergenic
1147965323 17:44191614-44191636 TCCTTGGAGTTGGGCAGGGTAGG - Exonic
1147994110 17:44351994-44352016 GCCTGGGGGGTGGGCAGGAAAGG - Exonic
1148027790 17:44600384-44600406 AGGAGGGAGGTGGGCAGGGTGGG - Intergenic
1148040530 17:44703252-44703274 CGGTGGGGGGTGGGCAGGGTGGG + Intergenic
1148331699 17:46817512-46817534 CCCTGGGACCTGCGGAGGGTGGG + Intronic
1148575018 17:48704395-48704417 CTCTGGGAGGAGGCCATGGTGGG - Intergenic
1148856128 17:50580211-50580233 CCCTGGGAGGCTGGCAGAGTTGG - Intronic
1148901850 17:50884507-50884529 GCCTGGGAGGTGGGGAAGGCAGG + Intergenic
1148952171 17:51322881-51322903 CCTTGGGAGATAGGCAGGGCAGG + Intergenic
1149029876 17:52070485-52070507 CCCAGGGAGCTGAGCTGGGTAGG + Intronic
1150223311 17:63509254-63509276 ACCCAGGAGGTGGGCAGGGATGG - Intronic
1150732062 17:67704324-67704346 GGCTGGGAGGAGGGCAGGATGGG - Intergenic
1151426263 17:74032818-74032840 ACCAGGGAGGCCGGCAGGGTAGG + Intergenic
1151535882 17:74738496-74738518 GCCTAGGAGGTGGCCAGGCTAGG + Intronic
1151574652 17:74946640-74946662 GCCTGGGAGGGAGGCAGGGTGGG - Exonic
1151674893 17:75592321-75592343 CTCTGGGAACTGGGCAGGGGTGG - Intergenic
1151702680 17:75751831-75751853 TCCTGGAAGGGAGGCAGGGTGGG + Intronic
1151727761 17:75894493-75894515 CCCAGGGAGATGGGGAAGGTCGG - Intronic
1151743891 17:76001293-76001315 CCTTGGGAGCTGGGCAGTCTGGG + Intronic
1151785795 17:76274319-76274341 CCCTGGGCATTGGGCAGGCTGGG - Intronic
1151827701 17:76532424-76532446 CGCTGGAAGGAGGGCAGGGAAGG - Intronic
1151875745 17:76867471-76867493 GGCCGGGAGGTGGGCAGGGCAGG + Intergenic
1151980924 17:77507933-77507955 GCCTGGGAATGGGGCAGGGTGGG + Intergenic
1151994365 17:77599273-77599295 CCCTGTTTGGTGGGCAGTGTCGG - Intergenic
1152125680 17:78445197-78445219 CGCTGGGAGGAGGGGAGGCTGGG + Intronic
1152234588 17:79132154-79132176 CCCTGGGAGCTGGGAACTGTTGG - Intronic
1152325477 17:79633432-79633454 CGTAGGGAGGTGGGCTGGGTGGG + Intergenic
1152386708 17:79979177-79979199 CCATAGGAGCTGGGCAGGGAAGG + Intronic
1152437935 17:80287622-80287644 AAGTGGGGGGTGGGCAGGGTCGG - Intronic
1152550216 17:81026030-81026052 GGCTAGGAGGCGGGCAGGGTGGG - Intergenic
1152610946 17:81314774-81314796 GCCAGGGAGGTCGGCAGGCTCGG + Intronic
1152627744 17:81396099-81396121 TCCGGGGAGGGGAGCAGGGTAGG - Intronic
1152628843 17:81400563-81400585 CCCGGGGAGGAGGGCAGCGCGGG + Intronic
1152748353 17:82051441-82051463 CCCTGGGAGGCGGGGCGGGTGGG + Intronic
1152755694 17:82086138-82086160 CCCTGGGCGGTGGGTGGGGCCGG - Intronic
1152787992 17:82261711-82261733 CCCTCTCAGGTGGGCAGGGCAGG + Intronic
1152792930 17:82292014-82292036 TGCTGGGCCGTGGGCAGGGTGGG + Intergenic
1152892935 17:82892691-82892713 GCCTCGGAGGTGGGCAGGCTTGG + Intronic
1152926388 17:83089639-83089661 TCCAGGGCGGTGGGGAGGGTCGG - Intronic
1153457141 18:5294967-5294989 GCCTGGGAGGTGGGGAGTGGAGG + Intronic
1153624563 18:7011929-7011951 CCCTGGGAGGTGGGTGGGGGTGG - Intronic
1153913771 18:9727128-9727150 CCTGGGGAGATGGGCTGGGTAGG + Intronic
1153931790 18:9885593-9885615 GCCTGGGAGGTGGGGGAGGTGGG + Intergenic
1154328098 18:13406659-13406681 TCCTGGGACCTGGACAGGGTGGG + Intronic
1155187396 18:23399276-23399298 CCCGTGGAGATGGGCAGAGTGGG - Intronic
1155314712 18:24559998-24560020 CTCTATGAGGTGGGCAGGGTGGG - Intergenic
1157240936 18:46008869-46008891 CCCCAGGGGGTTGGCAGGGTAGG - Intronic
1157329527 18:46693207-46693229 CCCTGGGGGGTGGGCACGTGAGG - Intronic
1157356674 18:46941483-46941505 GCCTTGGAGGTGGGGAGGGGTGG + Intronic
1157673544 18:49550839-49550861 CCCTGGGAGTGAGGCAGGATAGG + Intergenic
1158395752 18:57077394-57077416 CCGTGGGGATTGGGCAGGGTAGG + Intergenic
1158405470 18:57155838-57155860 CCCTGGGTGGTGAACAGGGCTGG + Intergenic
1158550511 18:58431642-58431664 GGTTGGGAGGTGGGGAGGGTAGG - Intergenic
1160082743 18:75744961-75744983 CCTTGGGAACTGTGCAGGGTCGG - Intergenic
1160223267 18:76992548-76992570 CCCTGAAGGGTGGGCAGGGCAGG - Intronic
1160447119 18:78936625-78936647 GCCGGGGAGGTGGGCAGGGAGGG + Intergenic
1160447138 18:78936671-78936693 GCCAGGGAGGTGGGCGGGGCGGG + Intergenic
1160447155 18:78936717-78936739 GCCAGGGAGGTGGGCAGGGCAGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160535875 18:79591059-79591081 CCCTTGGTGGTGGGGGGGGTGGG + Intergenic
1160689185 19:453177-453199 CCTTGGAAGCTGAGCAGGGTCGG + Intronic
1160691413 19:461972-461994 CGCTGGCAGGTGGGGAGGGAGGG + Intergenic
1160704610 19:524200-524222 CCCGGGGAGCTGGGCGGGGCAGG - Intergenic
1160821773 19:1062330-1062352 CCCTGGGAGGTGAGAGCGGTGGG - Intronic
1161030861 19:2057105-2057127 ACCTGGGACCTGGCCAGGGTGGG + Intergenic
1161036708 19:2089081-2089103 CCCTGTGAGGCTGGCAGGGCAGG + Intronic
1161201113 19:3015302-3015324 CTCTAGGAGGTGGTCAGGGAAGG + Intronic
1161241967 19:3227793-3227815 GCCTGGGAGGAAGGCAGGGGGGG - Intronic
1161249673 19:3273768-3273790 TGGTGGGAGGTGGGCAGGGCTGG + Intronic
1161265929 19:3364597-3364619 TCTTGGGAGGTGGGGAAGGTTGG - Intronic
1161268200 19:3374961-3374983 GCCAGGGAGGCGGGCAGGGGTGG - Intronic
1161510906 19:4670446-4670468 CCCCGGGCGGTGGACAGGGCGGG - Intergenic
1161513101 19:4682660-4682682 CCCGGGGAGGAGCGCAGGGCAGG + Intronic
1161722856 19:5913351-5913373 CCCTTGGAGGTGGGCCTGGGTGG + Intronic
1162086933 19:8254844-8254866 CCCAGGGAGGCTGGAAGGGTGGG - Intronic
1162478850 19:10916386-10916408 TCCTGGGAGTGGGGCAGGGAGGG - Exonic
1162796262 19:13089172-13089194 TCATTGGAGGTGGGCAGGGTGGG + Intronic
1162806346 19:13139671-13139693 TCCTGGGGGCTGGGCAGGGCAGG + Exonic
1162925845 19:13930180-13930202 CACTGGGCAGCGGGCAGGGTGGG + Intronic
1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG + Intronic
1163779397 19:19238439-19238461 GCCTGGAGGGTGGGCAGGGGTGG + Intronic
1163832782 19:19554960-19554982 CCCAGGTAGGTGGTCAAGGTGGG + Intergenic
1164145375 19:22509679-22509701 CCCTGGGATGGGGGCAGCCTGGG + Intronic
1164531055 19:29048500-29048522 TCATGGGAGGTGGCCAGGGTGGG + Intergenic
1164574967 19:29400672-29400694 ACTGGGGAGGTGGGCAGGGCAGG + Intergenic
1164907831 19:31981977-31981999 CCCTGGGAGGAGGGCATCATGGG - Intergenic
1165022228 19:32934481-32934503 CCCTGGGAGGTGCGCTGGCCAGG - Intronic
1165149449 19:33752202-33752224 CCCTAGGCGGCGGGCAGGTTGGG - Intronic
1165906833 19:39199388-39199410 GCCAGGGAGGTGGGCAGGGCAGG - Intronic
1165994445 19:39833965-39833987 CGCAGGGAGGTGGGCAGGACGGG - Intronic
1166103233 19:40583524-40583546 CCCTGGGAGAGGGGAAGGGAGGG + Intronic
1166317266 19:41996240-41996262 CCCTAGGAAGAGGGCAGAGTTGG - Intronic
1167038519 19:47008482-47008504 TCCTGGGAGGTGGGCGGGGTCGG - Intergenic
1167270175 19:48501953-48501975 CCAGGGGAGGGGGGCAGGGGAGG - Intronic
1167593762 19:50417300-50417322 GCCTGGGAGCTGGGAAGGGGCGG - Intronic
1167682121 19:50930068-50930090 TCCTGGGAGGCTTGCAGGGTGGG + Intergenic
1167802838 19:51756396-51756418 CCCTGGAACCTGGGTAGGGTTGG + Intronic
1168177994 19:54638815-54638837 CCCCGGGAGCTGGGCTGGGGTGG - Intronic
1168340704 19:55621680-55621702 CCCGGGGAGGGGGACGGGGTGGG - Exonic
1168340903 19:55622429-55622451 CCGAGGGAGGCGGGCAGGGTGGG - Exonic
1168707777 19:58479744-58479766 CCCAGGGAGAGGGGCGGGGTGGG - Intronic
1202712035 1_KI270714v1_random:24103-24125 CCCTGAGGGCTGGGCAGGGCAGG + Intergenic
925129230 2:1482491-1482513 ACCTGGGAGGTGAGCAGGAGGGG + Intronic
925251431 2:2442187-2442209 CTCAGGGAGGTGGGCATGCTGGG + Intergenic
925883277 2:8370441-8370463 CCCTGGGAGAGGGCCAGGCTTGG + Intergenic
925912761 2:8583946-8583968 CCCTGCGAGGCGGGCCGGGAGGG - Intergenic
925926347 2:8673574-8673596 CCCTGGGTGGTGGATGGGGTGGG - Intergenic
926251312 2:11156767-11156789 CCCTGCGGGGTGGGGAGGGGGGG + Intronic
926699022 2:15790415-15790437 CCAGGGGAGGTGGGCAGGACAGG - Intergenic
927135680 2:20094459-20094481 CCTTGGGCGGTGGGTGGGGTTGG + Intergenic
927158522 2:20236331-20236353 CCCTGGGATGGAGGCTGGGTGGG + Intergenic
927706185 2:25297849-25297871 CCCCAGGAGGTGGACAGGGCAGG + Intronic
928436255 2:31256532-31256554 CACTGGGAGCTGGACAGGGCAGG - Intronic
928436962 2:31260934-31260956 CCCTGGGAGGTGGGCAGCTTGGG + Intronic
929571267 2:43024572-43024594 GCCTGGGAGGTGGCCCTGGTTGG + Intergenic
929572638 2:43032288-43032310 CTTTGGGAGGTGGTCAGGGCTGG + Intergenic
929866326 2:45720322-45720344 ACCTGGGAGGTTGGCGGGGGCGG + Intronic
931649354 2:64454350-64454372 GCCTGGGAGGAGGGGAGGGGAGG - Exonic
931894771 2:66716497-66716519 CTCAGGGAGGTGGGCAGGGATGG + Intergenic
932092421 2:68818130-68818152 CCTTGTGAGGTAGGCAGGGCAGG + Intronic
932202643 2:69845411-69845433 GCTTGGGTGGTGGGCAGGGTGGG - Intronic
932400774 2:71479645-71479667 CCCAGTGAGGTGGGCAGGTGAGG - Intronic
932583682 2:73008924-73008946 CTCTGGGGGGCGAGCAGGGTAGG + Intronic
932797765 2:74712382-74712404 CCCTGGGAGGTTTGATGGGTAGG + Intergenic
933256469 2:80086725-80086747 CTCTGTGAGGTTGGCAGGGCAGG - Intronic
935842853 2:107132316-107132338 CACTGGGAGGTGGGCAGCGCGGG - Intergenic
936525887 2:113241515-113241537 CCCTGGGAGGTGAACAGGGTGGG - Intronic
937081225 2:119141537-119141559 CCCTCTGAGATTGGCAGGGTGGG - Intergenic
937161004 2:119760460-119760482 TCCTGGGAGGTGAGCCAGGTGGG + Intronic
937233660 2:120417580-120417602 CCCTGGGGGGTGAGTAGGGAGGG + Intergenic
937242837 2:120473690-120473712 CCCTGTGAGGTTGGCAGGGAGGG - Intergenic
937490157 2:122358419-122358441 CCATGGGAGTCGGGCAGAGTAGG - Intergenic
937840361 2:126518864-126518886 GGATGGGAGGTGGGCAGGCTAGG - Intergenic
937979860 2:127608632-127608654 CCCTGTGGGGTAGGCAGGGCTGG + Intronic
938384391 2:130854015-130854037 CCCTATGAGGTGAGCAGGGCAGG - Intronic
938406507 2:131035832-131035854 GTCTGGTAGGTGGGCAGGGTGGG + Intronic
940279892 2:151978361-151978383 CCCTTGGAGCTGGGCAATGTGGG - Intronic
941463081 2:165794013-165794035 ACCTGGCGGGTGGGCAGGGCAGG + Exonic
941584246 2:167337022-167337044 CCATGGAAGAGGGGCAGGGTAGG - Intergenic
941653075 2:168114497-168114519 CCCTTGGAGGTTGGGAAGGTGGG + Intronic
941850844 2:170178369-170178391 CCCTGGCTGGTGGGCAGTGGAGG + Intronic
941905183 2:170713059-170713081 CCCAGGGAGGCGGGCAGGGCCGG - Exonic
942502945 2:176611134-176611156 CCCTGGGAGGTGAGGTGAGTAGG + Intergenic
942990505 2:182195338-182195360 TCCTGGGAAGTAGGCAGGATGGG + Intronic
943574708 2:189617464-189617486 ACCTGTGAGGTGGGCAAAGTTGG + Intergenic
943794919 2:191980302-191980324 CCCTGGAAGGTGTGAAGGGCAGG + Intronic
944306125 2:198182223-198182245 CCCTGGGTGGCAGGCAGTGTGGG + Intronic
944615392 2:201453763-201453785 CCCTGGAAGGTTGGCAGGGCAGG + Intronic
946006020 2:216525611-216525633 CCCTCAGAGGTGGACAGGGTGGG - Intronic
946057586 2:216915706-216915728 GCCAAGGAGGTGGGCAGGGCTGG - Intergenic
946947150 2:224832957-224832979 CTCTGGAAGGTGGGGTGGGTGGG - Intronic
947104643 2:226655751-226655773 CCCTGGGAAGTTGGTAGGCTTGG - Intergenic
947526209 2:230878236-230878258 TACAGGGAGGTGGGCAGGGTTGG - Exonic
947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG + Intergenic
947632914 2:231665402-231665424 CCCTGGGAGGTGGGGTGAGGGGG + Intergenic
947949600 2:234135909-234135931 CCCAGGGTGGCGGCCAGGGTTGG - Intergenic
948064624 2:235067839-235067861 CCCTGGGAGGTATGCAGGTGAGG + Intergenic
948126442 2:235567736-235567758 CACTGGGGGGTGGGCAGGGTGGG + Intronic
948269343 2:236662388-236662410 CCCGGGGTGGAGGGAAGGGTTGG - Intergenic
948553456 2:238791465-238791487 CCGGGGTAGGGGGGCAGGGTGGG + Intergenic
948604433 2:239125996-239126018 GCCTGGGAGATGGGCACTGTGGG + Intronic
948607768 2:239146884-239146906 CCCAGGCAGGTGTGCAGGCTGGG - Intronic
948609525 2:239157961-239157983 CCCTGAGCAGTGGGCGGGGTTGG - Intronic
948779480 2:240310129-240310151 CCCTGGGAGGTAGGGGAGGTGGG - Intergenic
948861522 2:240754964-240754986 CCCTGGGAGGGGAGCAGGGCTGG - Intronic
1169021676 20:2335312-2335334 TCCTGGGAGCTGGGCTGGCTGGG - Intronic
1169083917 20:2815459-2815481 GCCTGGCAGGTGGGCATTGTAGG + Intronic
1169267490 20:4175426-4175448 CCCTCTGAGGCGGGCATGGTAGG + Intronic
1169267670 20:4176572-4176594 CCCTGGGAGCTAGGTAGGGATGG + Intronic
1169294727 20:4385174-4385196 CCCTGGGAGGGTGGAAGTGTAGG - Intergenic
1169967300 20:11232231-11232253 CCCTGAGGGTTGGGCAGGCTGGG - Intergenic
1170309379 20:14975679-14975701 CTCTAGGAGGTTGTCAGGGTGGG + Intronic
1170602220 20:17849549-17849571 GACTGGGAGGTGGGAAGGGAAGG + Intergenic
1170863202 20:20128095-20128117 AGCTGGGAGGTGGGCAGCCTGGG - Intronic
1171284095 20:23923563-23923585 CCCTGGCAGGTGGTAAGAGTTGG + Intergenic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1171358877 20:24572604-24572626 CCTTGGGTGGAGGACAGGGTTGG + Intronic
1171947625 20:31392469-31392491 CTCTGGGAGGTGGACAGGATTGG - Intergenic
1172056553 20:32158284-32158306 TCTTGAGAGGTAGGCAGGGTGGG - Intronic
1172225752 20:33304258-33304280 GCCTGGGAGGTGTCCAGAGTGGG - Intronic
1172486215 20:35299238-35299260 CCCTATGAGCTGGGCAGGGCAGG - Intergenic
1173563198 20:44020941-44020963 CAATGGGAGGTGCACAGGGTAGG - Intronic
1173572749 20:44088060-44088082 GCGGGGGAGGTGGGCAGGGGTGG - Intergenic
1174164719 20:48576650-48576672 TGCTGGGAGGGTGGCAGGGTGGG - Intergenic
1174171349 20:48619936-48619958 CACTGGGAGGGGCACAGGGTGGG + Intergenic
1174199419 20:48797203-48797225 CCCTGAGAGGTGGCCAAGCTAGG + Intronic
1174377980 20:50138966-50138988 GCCTTTGAGGTGGGCAGGGAGGG - Intronic
1174404787 20:50296100-50296122 CCAGGGGAGGTGGGCACGGGGGG + Intergenic
1174595175 20:51678218-51678240 CCCTGAGAGCTTGGCAGGGCTGG - Intronic
1175130952 20:56789077-56789099 CCCTGGGCTGTGGGAAGGGAGGG + Intergenic
1175226615 20:57448136-57448158 CCCTGGGAGGTGGCAGGGGTAGG + Intergenic
1175327375 20:58139132-58139154 GCATGGGAGGTGTGCAGGGCTGG - Intergenic
1175376203 20:58525666-58525688 CTCTGGGAAGGGGGCAGGGAAGG + Intergenic
1175714643 20:61247326-61247348 GCCGGGGAGGCGGGCGGGGTGGG + Intergenic
1175777362 20:61661819-61661841 CTCTGGCAGGTGCGGAGGGTGGG + Intronic
1175814084 20:61874540-61874562 CCCTGGGCGGTGGGTGAGGTCGG + Intronic
1175929730 20:62487980-62488002 AGCTGGGAGGTGGGCAGTGGAGG - Intergenic
1175979348 20:62729238-62729260 CTCCGGGAGGAGGGCAGGGTGGG + Intronic
1176148332 20:63575252-63575274 CCTCGGGAGGTCGGCTGGGTGGG + Intergenic
1176191249 20:63811181-63811203 CCCTGTGGGCTGGGCGGGGTGGG - Intronic
1176215260 20:63944858-63944880 CCCTGGCAGGTGGGGAGGAGTGG + Intronic
1176215290 20:63944940-63944962 CCCTGGCAGGTGGGAAGGAGTGG + Intronic
1176215692 20:63946673-63946695 ACCTGGGAGGTGGGCAGCTCTGG - Intronic
1176293875 21:5060290-5060312 TCCTGGGCTGTGGTCAGGGTGGG + Intergenic
1176849398 21:13901273-13901295 GACTGGGTGGTGGGTAGGGTTGG - Intergenic
1178467890 21:32865288-32865310 CAGTAGGAGGTGGGCAGGGCTGG + Intergenic
1178582087 21:33846020-33846042 CCCTGGGAGGTAGACAAGGGGGG - Intronic
1178743633 21:35226618-35226640 CTCTGAGAGGTGAGCAGAGTGGG - Intronic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1178910340 21:36668836-36668858 GCCGAGGAGGTGGGCACGGTGGG - Intergenic
1179171346 21:38975341-38975363 CCCAGTGAGTTGGGCAGGATGGG + Intergenic
1179775359 21:43658709-43658731 CCAGGGGAGTTGGGCAGGGCGGG - Intronic
1179809403 21:43860809-43860831 CCCTGGGCCTTGGGCAGGGCTGG + Intergenic
1179863384 21:44203358-44203380 TCCTGGGCTGTGGTCAGGGTGGG - Intergenic
1179886224 21:44315344-44315366 CCCTGGGTGGTGGGCAAGGCGGG - Intronic
1179886642 21:44316958-44316980 CCCTGGGAGAGGGGCTGGGTGGG + Intronic
1179960550 21:44765007-44765029 CCCCGAGAGGTGGGCGGGGGTGG + Intergenic
1179988113 21:44932369-44932391 CCCAGGGAGGCGGCCAGGCTCGG - Intergenic
1180000343 21:44992744-44992766 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180000356 21:44992785-44992807 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180009932 21:45042898-45042920 CCCTGGGGGGTGGGATGGGGAGG - Intergenic
1180198348 21:46210483-46210505 CCTTGGGTGTTGGGCTGGGTCGG - Intronic
1180211387 21:46297264-46297286 GCATGGGAGGTGGGAAGGGAAGG - Intronic
1180581899 22:16845898-16845920 CCCTGGAAGGTGGGCGGGAGAGG - Intergenic
1180855521 22:19042487-19042509 TCCTGGTAGGAGGCCAGGGTTGG + Intronic
1180918779 22:19507546-19507568 CCCTTGGGGGTGGCCAGGGCTGG - Intronic
1180958225 22:19750684-19750706 TCCTGGGGGGTGGGCGGGGGAGG - Intergenic
1181003400 22:19998426-19998448 ACCTGGGAGGGGGGCTGGGCCGG - Intronic
1181461591 22:23089078-23089100 TCCTGGGAGGTGAGGAGGGAGGG + Intronic
1181921814 22:26326759-26326781 CCCTGGGAGGAAGGCAGAGGTGG + Intronic
1182134363 22:27887551-27887573 CCTGGGGAGGTGGGGTGGGTGGG - Intronic
1182147799 22:28007580-28007602 CTCTGTGCAGTGGGCAGGGTTGG + Intronic
1182448405 22:30403375-30403397 CCCTGGGAGGGAGGCAGAGCGGG + Intronic
1182714094 22:32341194-32341216 GACTGGGAGGTGGACAGGATTGG + Intergenic
1182837042 22:33350620-33350642 CCCTTGGGGGTGGGCACCGTAGG + Intronic
1183301949 22:37062926-37062948 CCCTGTGAGGTAGGTGGGGTGGG - Exonic
1183373521 22:37449143-37449165 CCCTGGGAGGCTGGCTGGGATGG + Intergenic
1183393557 22:37559695-37559717 TCCATGGAGGTGGGCGGGGTGGG + Intergenic
1183458833 22:37937313-37937335 CGCTGGTAGGAGGGCAGGGCTGG - Intronic
1183752601 22:39730194-39730216 CCCTGGGAGTGGGACAGGGTTGG - Intergenic
1183782735 22:40009133-40009155 CCTTGGGAGGCAGGCAGGGCAGG + Intronic
1183930880 22:41235411-41235433 CACTGGGTGTGGGGCAGGGTTGG + Intronic
1183935958 22:41262441-41262463 GCCTGGGAGGCAGGCAGGATTGG + Intronic
1184093476 22:42304347-42304369 CACAGGGAGGTGGGGAGGCTGGG + Intronic
1184236760 22:43187158-43187180 CGCTGGGAGGAGGGCGGGGCGGG - Intergenic
1184244494 22:43228968-43228990 CCCAGGGTTGAGGGCAGGGTTGG + Intronic
1184293528 22:43510206-43510228 CCTAGGGAGGTGTGCAGGGCAGG + Intergenic
1184298266 22:43539931-43539953 CCCTGGGAGGGGGGCAGACGTGG - Intronic
1184331206 22:43829029-43829051 GCCTGGGCGGGAGGCAGGGTGGG + Intronic
1184340935 22:43885461-43885483 GCTTGGGAGGCTGGCAGGGTGGG - Intronic
1184403370 22:44286554-44286576 CGGTGGGAGGTAGGCAGGGGAGG - Intronic
1184520464 22:44991029-44991051 CCCTGGAAGGTGGGCAGGGCGGG - Intronic
1184538004 22:45100532-45100554 CTAAGGGAGGAGGGCAGGGTTGG - Intergenic
1184643165 22:45882865-45882887 CCTAGGGAGGAGGGCAGGGATGG + Intergenic
1184661346 22:45967026-45967048 CCCTGGGTGAGGGGCAGGGATGG + Intronic
1184695255 22:46135360-46135382 CCCAGGGAGGGTGGCAGGCTGGG + Intergenic
1184714699 22:46274148-46274170 CCTTGGGACGGGGGCGGGGTGGG + Intronic
1184728296 22:46358594-46358616 CCTTGGGTGCTGGGGAGGGTAGG - Intergenic
1184841452 22:47054720-47054742 GCCTGGGAGGTGGCCAGTGAGGG + Intronic
1184992706 22:48181677-48181699 CACAGGGAGGAGGGCAGGGGAGG + Intergenic
1185032882 22:48453945-48453967 CCCTTGGCTGTGAGCAGGGTGGG + Intergenic
1185063649 22:48620131-48620153 TTCTGGGATGGGGGCAGGGTGGG + Intronic
1185159743 22:49216191-49216213 CAGTGGGAGGTGAGCAGGCTGGG - Intergenic
1185176580 22:49330749-49330771 CCCTGGGGGAAGGGCAGTGTGGG + Intergenic
1185365979 22:50436912-50436934 TCCTGGGCGCTGGGCTGGGTGGG + Intronic
950030016 3:9846147-9846169 CCCTATGAGGAAGGCAGGGTGGG + Intronic
950507488 3:13404216-13404238 CCCTGTGAGGAAGGCAGGGTGGG - Intronic
950582292 3:13870535-13870557 CCCTGAGAGATGGTCTGGGTGGG + Intronic
950878384 3:16299970-16299992 CCCTGTGAGGTGGGCAGTGCAGG + Intronic
950966789 3:17152243-17152265 CCCTGCGAGGTGGCCAAGCTAGG + Intergenic
951528620 3:23678259-23678281 CCCAGGAAGGTGAGCAGGGCTGG - Intergenic
951725794 3:25757400-25757422 CCCTGTGAGGTAGGCAGGGTAGG - Intronic
952706210 3:36380458-36380480 GCCGGGGAGGTGGGCAGGGCGGG + Exonic
952888182 3:38024543-38024565 CCCTTGGAGGGGAGCAGGGGCGG + Exonic
953246808 3:41200054-41200076 CCCTGGGTGGGGGGCGGGGTGGG + Intronic
953876337 3:46668812-46668834 CCCTGGAATGTGGACTGGGTGGG + Intergenic
953914024 3:46906562-46906584 CCCTGGGAGGTGGCCAGAGGGGG + Intergenic
954095236 3:48320927-48320949 TTCTGGGAGGTGGGCAGTGGAGG - Intronic
954224539 3:49173528-49173550 CCCTGGCGTGTGGGAAGGGTTGG - Intronic
954225136 3:49176408-49176430 CCCTGTGAGGTAGGTAGGGTAGG - Exonic
954414236 3:50385147-50385169 CGATGGGAGGGGGGCAGGCTTGG + Intronic
954462203 3:50633741-50633763 CCCTGTGAGGCAAGCAGGGTGGG - Intronic
954671650 3:52294339-52294361 CTCAGGGAGGAGGGGAGGGTTGG - Intergenic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
954688379 3:52382871-52382893 ACCTGGCTGGTGGTCAGGGTTGG + Intronic
954745725 3:52786490-52786512 CCCTTGGAGGTGAGCAGAGGAGG + Intronic
955369122 3:58335827-58335849 CCTTGGGAGGCAGGCAGGGCAGG - Intronic
955475108 3:59328501-59328523 CCCTGGGAGGTAGACAAGGCAGG + Intergenic
955894707 3:63686966-63686988 TCCTCGGGGGTGGGTAGGGTGGG - Intergenic
956186239 3:66565082-66565104 GCCTGAGAAATGGGCAGGGTGGG - Intergenic
956884837 3:73548537-73548559 CCCTGGGATGTGGGCTGGAGAGG + Intronic
957718745 3:83967894-83967916 CCTTGGGAGGTAGATAGGGTTGG + Intergenic
960245063 3:115391187-115391209 CCCTGGTTGATGGGCAGGGTGGG - Intergenic
960909726 3:122637237-122637259 GCCTGGGAGCAGGGGAGGGTTGG - Intronic
961376347 3:126468676-126468698 CCCTGAGAGGTGGCCTGAGTGGG - Intronic
961632396 3:128310833-128310855 GCTTGCCAGGTGGGCAGGGTGGG - Intronic
961649745 3:128411382-128411404 CCCAGGGGTGTGGGCAGGGCAGG + Intergenic
961673173 3:128549435-128549457 CCCTGGGCTGGGGGCAGGGTGGG + Intergenic
962713437 3:138106967-138106989 CCCTGTGAGGTAGGCAGGGCTGG - Intronic
962855461 3:139340926-139340948 CACTGGGGGTTGGGGAGGGTTGG - Intronic
962885874 3:139627372-139627394 CAATGTGAGGTGGGCAGGGAGGG + Intronic
963252924 3:143119350-143119372 CCCGGAGAGGTTGGCAGTGTCGG + Exonic
963543390 3:146623947-146623969 CCCTGGGCAGAGAGCAGGGTGGG + Intergenic
964620504 3:158716122-158716144 AGCTGTGAGGTGGGCAGGGGTGG + Intronic
967107348 3:186264617-186264639 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
967756342 3:193174307-193174329 CCCTGGGAGCTGGTCAGAGATGG + Intergenic
967904122 3:194486845-194486867 CGGCGGGAGGTGGGCAGGGGAGG + Intronic
967932528 3:194700648-194700670 GCCTGGAGGGTGGGCAGGGTAGG + Intergenic
968503302 4:961003-961025 CCAGGGGAGGTGGGCCGGGCTGG - Intronic
968523359 4:1044474-1044496 CCCTGGCAGCTGGGGAGAGTAGG - Intergenic
968642593 4:1721852-1721874 CCCTGGATGGTGGCCAGGGGCGG + Intronic
968648867 4:1752632-1752654 CCCTGGCTGGTGGGCGGGGCAGG - Intergenic
968817824 4:2830869-2830891 CCCTGGGAGAAGGGCACCGTGGG - Intronic
968879504 4:3292069-3292091 CCCTGGGCGGGCGGCAGGGCTGG + Intergenic
968909853 4:3472165-3472187 CCCGGGGAGGTGGGCACGGCTGG + Intronic
968978164 4:3832732-3832754 CCGTGAGAGATAGGCAGGGTTGG + Intergenic
969244615 4:5924445-5924467 CCCTGGGTGTGGGGCAGGCTGGG - Intronic
969344525 4:6562863-6562885 CCCTGGGAAGTGACCCGGGTTGG - Intronic
969531861 4:7734772-7734794 CCCTGGGATGTGGGCGGGCCTGG - Intronic
969629601 4:8328688-8328710 CCCTGGGAGGAGTGATGGGTGGG + Intergenic
969660200 4:8522974-8522996 CCCCGAGTGGAGGGCAGGGTGGG + Intergenic
971195932 4:24471826-24471848 CCCGCGGAGGTGGGGGGGGTGGG - Intergenic
973560446 4:52130112-52130134 CCCTGCCAGGAGGGCAGGGGTGG - Intergenic
977295452 4:95204001-95204023 AGCTGGGATGAGGGCAGGGTGGG + Intronic
977586286 4:98779021-98779043 CCATGGAAGGAGGGCAAGGTAGG + Intergenic
977796150 4:101167646-101167668 ACCTGGGAAGTGGTGAGGGTTGG + Intronic
980402733 4:132313730-132313752 ACCTGGGAGGGGGACTGGGTTGG + Intergenic
981429730 4:144645669-144645691 CCGTAGGAGGTGGGAAGGGAGGG - Intergenic
981549361 4:145927806-145927828 GCCTGTGAGGTGGGCAGGGAAGG - Intronic
982666740 4:158274191-158274213 CCCTGGGTGCTAGGCAGGGTTGG - Intergenic
983238571 4:165207187-165207209 CCCAGGGAGATGGGAAGGGTAGG - Intronic
984713181 4:182903079-182903101 CCCTGTGAGATGGGAAGGGGCGG - Intronic
984767372 4:183409896-183409918 CCCAGGGAGGTAGGCAGGGAAGG - Intergenic
985071620 4:186171239-186171261 CCCTGGGAGCCGGGCCGTGTTGG - Intronic
985624818 5:979822-979844 CACAGGGAGGTGGGCAGAGGCGG + Intronic
985758553 5:1733337-1733359 CCATGGGGGGTGGGGAGGGGAGG - Intergenic
985758587 5:1733422-1733444 ACCTGGGAGGTGGGAAGGAGAGG - Intergenic
985945211 5:3177102-3177124 CACAGGAAGGTGGGGAGGGTTGG + Intergenic
986236112 5:5912250-5912272 CCCAGGGAGGAGGGGAGTGTGGG + Intergenic
986402590 5:7395429-7395451 CGCGGGGAGGCGGGAAGGGTGGG + Intergenic
986470099 5:8065005-8065027 TCCTGGGGGGTGGGGAGGGGTGG - Intergenic
986983980 5:13479772-13479794 ACCTTGGAGGTGTACAGGGTTGG + Intergenic
987061989 5:14251710-14251732 CCCTGGGAGGTGGGAACAATTGG + Intronic
987393758 5:17401582-17401604 CCCAGGCAGGGGTGCAGGGTGGG - Intergenic
988882306 5:35516814-35516836 CCATGGAAGGTTGGGAGGGTTGG - Intergenic
989267916 5:39499166-39499188 CCATTAGAAGTGGGCAGGGTTGG + Intergenic
991944717 5:71888963-71888985 CCCTGGGAGAAGAGCAGGGTGGG - Intergenic
992069571 5:73136485-73136507 GGCTGGAAGTTGGGCAGGGTGGG + Intergenic
992649564 5:78845039-78845061 TCCTGAGGGGTGGGAAGGGTAGG - Intronic
993323138 5:86500441-86500463 ACCTGGGAGGTGGACAGTGATGG + Intergenic
994151190 5:96449460-96449482 CCATGGATGGTGTGCAGGGTTGG - Intergenic
996866822 5:128133223-128133245 CCCTTGAAGGTGGACAAGGTTGG + Intronic
997271376 5:132541093-132541115 CCCTGGAAGAAGGGCAGTGTGGG - Intergenic
997356667 5:133267018-133267040 GCCTGCCAGTTGGGCAGGGTGGG + Intronic
997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG + Intergenic
998168463 5:139857998-139858020 GCCTGGGCTGGGGGCAGGGTGGG - Intronic
998169788 5:139865825-139865847 CCATGGGTGGTGGGGAAGGTGGG + Intronic
998382210 5:141733787-141733809 CCCTAGGAGGTGGGAATGGGGGG + Intergenic
998796978 5:145831183-145831205 CCCTGGAAGGTAGGTGGGGTAGG + Intronic
998983451 5:147729376-147729398 CCCTGGGTGTGGGGCAGGGGAGG + Intronic
999188206 5:149728543-149728565 CCTTGTTAGGTGGGCAGGGTGGG + Intergenic
999288331 5:150407325-150407347 CTGTGGGAGGTGGGGAGGATAGG + Intronic
999323159 5:150626995-150627017 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
999371005 5:151055427-151055449 GCCTAGGCTGTGGGCAGGGTAGG - Intronic
999404179 5:151292512-151292534 CCTTGTGAGGTAGGCAGGGTGGG - Intronic
999450312 5:151672931-151672953 CCCTGGGATCTGGGCAAGATCGG - Intronic
999654228 5:153796939-153796961 ACCTGTGAGGAGGGCAGGGATGG - Intronic
999769073 5:154761443-154761465 TTCTGGGAGGTGGGCAGGGTGGG + Intronic
1000052527 5:157575410-157575432 CCCTGGGAGGTGGCAGAGGTCGG - Intronic
1000210689 5:159104237-159104259 CCCTGGCAGGTGGCGAGGGAAGG - Intergenic
1001083536 5:168684146-168684168 CTCTGTGAGATGGGCAGGGAAGG - Intronic
1001967058 5:175917732-175917754 CCCTGGGATGTGGGCAGACATGG - Intergenic
1002033352 5:176447268-176447290 CTCTGGAAGGTGGGCAGAGGAGG + Intergenic
1002080304 5:176733578-176733600 CCCTCAGAGCTGGGCAGGGATGG - Intergenic
1002181588 5:177433724-177433746 GCCTGGGGGGTGGGGACGGTCGG - Intronic
1002249877 5:177921480-177921502 CCCTGGGATGTGGGCAGACATGG + Intergenic
1002299310 5:178248413-178248435 CCCCGGGTGGTGGGCAGTGTGGG + Intronic
1002587137 5:180256378-180256400 TCCTGGGATGTGGGCAGGGGTGG + Intronic
1002617343 5:180464096-180464118 CCCTGTGAGGTGGGGGGCGTGGG - Intergenic
1002837369 6:876347-876369 CCCTGGGAGAGGGTCAGGGTGGG - Intergenic
1003074493 6:2971432-2971454 AGCGGGGAGGGGGGCAGGGTGGG - Intronic
1003080178 6:3015404-3015426 CCCTGGCAGCTGGGCAGGTGAGG - Intronic
1003234206 6:4281608-4281630 CCCAGGCATGTGGGCAGGGGAGG - Intergenic
1004706129 6:18125403-18125425 CCCTGGGAGGAGGGCAAGGCTGG - Intergenic
1005968443 6:30743088-30743110 CCCAGGGAGGTGCGCGGGCTGGG + Intergenic
1006073649 6:31515574-31515596 CCGAGGCAGGTGGTCAGGGTAGG + Intergenic
1006295252 6:33167358-33167380 CCATGGGAGGGGTGCAGTGTGGG - Intronic
1006401742 6:33821748-33821770 CCTGGGGAGGTGGGCAGGCTGGG - Intergenic
1006425785 6:33962137-33962159 GCCAGGGAGGTAGGCAGGGTGGG - Intergenic
1006582262 6:35083857-35083879 CCCTGGAAGGTGGGAGGGGCTGG + Intronic
1006639891 6:35484466-35484488 CTCGAGGAGGTGGGCAGGGTAGG + Intronic
1006717892 6:36131559-36131581 TCCTGGAAAGTGGGCAGGGAAGG - Intronic
1006905101 6:37528023-37528045 GCCTCTGAGGTGGCCAGGGTAGG + Intergenic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1007010839 6:38416132-38416154 CACTGGGAGGTGGGTAGGGTAGG + Intronic
1007092806 6:39194559-39194581 CCCTGGGTGTTGGGCAGAGATGG - Intronic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1008054920 6:46936241-46936263 CCCTGGGATGGGGGCTGGCTGGG + Intronic
1008320344 6:50104413-50104435 TATGGGGAGGTGGGCAGGGTGGG + Intergenic
1008551210 6:52633118-52633140 ACATGTGAGGTGGGCGGGGTGGG + Intergenic
1008661562 6:53673186-53673208 GCCTGGGAGATGGGCAGGGGTGG - Intergenic
1008711136 6:54228479-54228501 CCCAGGCAGCTGGGCAGGGAGGG - Intronic
1009644293 6:66377814-66377836 CTGTGGCAGGTGGGGAGGGTGGG + Intergenic
1010061721 6:71630212-71630234 GGCTGGGATGCGGGCAGGGTAGG - Intergenic
1011622756 6:89258015-89258037 CCTTGTGAGGTGGGCAGAGGAGG + Intronic
1011704709 6:89989450-89989472 CCCAGGGAGGTGGGAAGGGAGGG + Intronic
1011863021 6:91784697-91784719 ACTTGGGGAGTGGGCAGGGTTGG - Intergenic
1012050978 6:94343568-94343590 TCTGGGGAGGTGGGCAGTGTTGG + Intergenic
1012160216 6:95874862-95874884 CCATGGGAGATGGGCATGGTAGG + Intergenic
1014110626 6:117616402-117616424 CCCCATGAGGTGGGCAGGATGGG + Intergenic
1015576271 6:134674825-134674847 CCCTGGATGGTAGGCAGGGGTGG - Intergenic
1016743920 6:147557994-147558016 CCCTGGGAGGTAGGCACAGAGGG + Intronic
1017874363 6:158512550-158512572 CCATGGGAGGTGGGAAGGTGGGG + Intergenic
1018686589 6:166308322-166308344 CCCCAGGAGGAGGGGAGGGTGGG - Exonic
1018751723 6:166812405-166812427 CTGTGGGAGGAGGGCAGGGCTGG - Intronic
1018803477 6:167240988-167241010 CCCTCAGAGGGGGACAGGGTGGG - Intergenic
1018851684 6:167644936-167644958 CCCCTGCAGGTGGGCAGGGTGGG - Intergenic
1018942714 6:168319839-168319861 CCCTGGGGGGTCGGCGGGGCGGG - Intergenic
1018995852 6:168709952-168709974 CCCTGGGAGGTGGCCAGTCAGGG + Intergenic
1019493663 7:1326388-1326410 GCCTGGAAGATGGGCAGGCTCGG - Intergenic
1019530072 7:1498940-1498962 CCCGGGGGGGTGGGCGGGGCAGG - Intronic
1019574501 7:1729934-1729956 CCCCAGGAGGTGGGCGGGGGTGG + Intronic
1019762765 7:2825851-2825873 CCCTGGGTGGTGGGAATGCTGGG - Intronic
1019797600 7:3063333-3063355 CACTCTGAGGTGGGCAGGGAAGG - Intergenic
1020111816 7:5451878-5451900 CCCTGGGAGGAGGGGAGAGTGGG - Intronic
1020130942 7:5558230-5558252 GCCTGGGAGGAGGGCAGGAGAGG + Intronic
1020214350 7:6178321-6178343 CCCTGGGAGTGGGGCCAGGTTGG - Intronic
1022013612 7:26329948-26329970 CACAGGGAGATGGGAAGGGTGGG + Intronic
1022497113 7:30860168-30860190 CCCTGGGAAGTGGGGAGGCAGGG + Intronic
1022532411 7:31075326-31075348 CCCTGTGAGGCGGGCACTGTCGG + Intronic
1023448778 7:40259155-40259177 CCTGGGGAGGAGGGCAGGTTAGG + Intronic
1023608412 7:41950447-41950469 CCCTGAGAGGTGGCAATGGTGGG + Intergenic
1023681469 7:42691755-42691777 TCCTGGGAGATGGGAAGGGCAGG - Intergenic
1023822076 7:43986081-43986103 GCTTGGAAGGTGGGCAGGGGCGG + Intergenic
1023878455 7:44305610-44305632 CCCTGTGAGGTGGGGGAGGTGGG + Intronic
1023986638 7:45100993-45101015 GCTTAAGAGGTGGGCAGGGTAGG - Intronic
1024026187 7:45411910-45411932 CCTTGGGAGCTGGGAAGGGAGGG + Intergenic
1024322613 7:48086029-48086051 CTCTGAGAGGTGGGGAGGGAAGG - Intergenic
1024324853 7:48101625-48101647 CCCTGGTGAGTGGTCAGGGTGGG - Intronic
1024366556 7:48527187-48527209 CCCTGGAACATGGACAGGGTAGG + Intronic
1024564780 7:50672342-50672364 CCCTCGGAGGGAGGCAGTGTGGG - Intronic
1024913853 7:54476520-54476542 CCCTGACATGGGGGCAGGGTAGG - Intergenic
1026126038 7:67580491-67580513 ACTTGGGTGGTGGGCAGGGGAGG - Intergenic
1026973258 7:74480597-74480619 TCCTGGCAGGCGGGCAGGGGCGG - Intronic
1027238272 7:76310935-76310957 CCTGGGGCGGTGGGCAGGGAGGG - Intergenic
1027267758 7:76503631-76503653 TGCTGGGATGTGGGCGGGGTGGG - Intronic
1027319568 7:77003493-77003515 TGCTGGGACGTGGGCGGGGTGGG - Intergenic
1027328313 7:77065144-77065166 CATTGGGAGGTGGGGAGTGTGGG + Intergenic
1027548232 7:79557502-79557524 CCCTAGGAGGTGGGGAGAGTAGG + Intergenic
1028129505 7:87152883-87152905 CCCTGGGGGGTGGGGTGGGCCGG + Intronic
1028295624 7:89126918-89126940 CCCTGTGAGGTAGGCAGAGCAGG - Intronic
1029542494 7:101192390-101192412 GCCTGGCAGGTTGGCAGGTTGGG + Intergenic
1029545157 7:101206670-101206692 CACTGGGAAATGGGCAGGGAGGG + Intronic
1029658187 7:101941204-101941226 CACTGGGAGGAGGGCGGGTTGGG + Intronic
1029712896 7:102309185-102309207 CACTGGGAGTTGGGCAGAGATGG + Intronic
1029750340 7:102539495-102539517 GCTTGGAAGGTGGGCAGGGGCGG + Intronic
1029768292 7:102638603-102638625 GCTTGGAAGGTGGGCAGGGGCGG + Intronic
1029976965 7:104843923-104843945 CACTGGGAGGTGGAAAGAGTGGG + Intronic
1031969744 7:128055461-128055483 CACTGGGAGGTGGTCAGGTTAGG - Intronic
1031990015 7:128191435-128191457 CCCTGTGTGGTGGGCAGGGCAGG + Intergenic
1032067519 7:128782881-128782903 CCCTGTAAGGTAGACAGGGTAGG + Intergenic
1032261997 7:130345888-130345910 CCCTGTGAGGTAGGGAGGGGAGG + Exonic
1032405877 7:131655074-131655096 CCCTGGGAGGCAGGCAGCCTTGG - Intergenic
1032636502 7:133714771-133714793 CCATGGGCAGTGGGCTGGGTTGG + Intronic
1032780824 7:135164284-135164306 TCCTTGGTGGAGGGCAGGGTAGG + Intronic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1035064359 7:156094526-156094548 CCCTGAGGGGTGGGCAGGCTGGG - Intergenic
1035168230 7:157003941-157003963 CGCTGGGAGGAGGGGAGGGGAGG + Intronic
1035222458 7:157414269-157414291 CCGTGGGATGGGGGCGGGGTGGG - Intronic
1035355823 7:158275722-158275744 CACGTGGAGGTGCGCAGGGTGGG - Intronic
1035754936 8:2023884-2023906 CCGCGGGAGCTGGGCAGGGATGG + Intergenic
1036620329 8:10421062-10421084 CCCGGGGATGTGAGCTGGGTAGG + Intronic
1037725644 8:21480602-21480624 CCCTGGTGGGTGGGCTGTGTAGG - Intergenic
1037751615 8:21686008-21686030 CGATGGGAGGTGGGCAGGCATGG - Intergenic
1037813585 8:22100540-22100562 CCCTGGGAGCTGGGTGGGGAAGG + Intronic
1037915232 8:22768958-22768980 CACTAGGAGCTGGGCAGAGTGGG + Intronic
1038185200 8:25267049-25267071 CCCTGGGAAAAGGGCAGAGTGGG - Intronic
1038376952 8:27049328-27049350 CCCTGATAGATGTGCAGGGTTGG - Intergenic
1038420508 8:27431211-27431233 CTCTGGGAGGTGGGCAGGACAGG + Intronic
1038423770 8:27451566-27451588 CCCTGGGCGGTGGGCAAGGATGG - Intronic
1039833065 8:41233160-41233182 CCCTGGGAGGTGGAGTGGGACGG - Intergenic
1039902971 8:41766608-41766630 CCCTGGAGGCTGGGCAGGGTGGG + Intronic
1040435546 8:47387402-47387424 CCCTGGCAGGAGGGCAGGAGTGG + Intronic
1041441229 8:57899137-57899159 AGCTGGGATGAGGGCAGGGTGGG - Intergenic
1044618631 8:94167290-94167312 CTCTGGGAGGTGGGAATTGTAGG + Intronic
1044780679 8:95740573-95740595 CCCTTGGTGGTGGGGAGGGGAGG + Intergenic
1045543325 8:103106281-103106303 GGCGGGGAGGGGGGCAGGGTTGG + Intergenic
1045559537 8:103247643-103247665 AGCTGGGAGGTGGGCCTGGTGGG + Intergenic
1046654180 8:116874620-116874642 CGCTGGGAGTTGGGCGGGCTGGG + Exonic
1046933800 8:119867368-119867390 TCCTGGGAGGTGAGCAGGGTTGG + Intergenic
1047411422 8:124627650-124627672 CCCTGGGAGATGGCCAGGGGTGG + Intronic
1047520899 8:125594647-125594669 GGCTGGGAGGTGGGCTGGGGAGG - Intergenic
1048201781 8:132380670-132380692 CCCTGGGAGGGAGGGAGGGAGGG - Intronic
1048296335 8:133217330-133217352 CCATGGGAGGTGTGAAGGGAGGG + Intronic
1048416607 8:134234022-134234044 CTTTTGGAGGTGGGGAGGGTGGG + Intergenic
1049003508 8:139840768-139840790 CCCTGGGCTGTGGGCGGGGCAGG - Intronic
1049216266 8:141409770-141409792 TCCTGGGAGCTGGGCACGCTGGG - Intronic
1049254231 8:141605317-141605339 TTCTAGGAGGTGGGCAGGGGAGG + Intergenic
1049413008 8:142481792-142481814 GCCTGGGCTGTGGCCAGGGTTGG - Intronic
1049645990 8:143735829-143735851 TCCTGGGGGGTGGGTAGGGAAGG - Intergenic
1049748694 8:144273664-144273686 CCCGGGGAGGTGGGCCGGGGTGG - Intronic
1049748847 8:144274204-144274226 CCCTGGTAGCAGGGCAGGGAGGG - Intronic
1049798385 8:144506673-144506695 GCCTGCGGGGTGGGCAGGGGGGG + Intronic
1051170072 9:14313214-14313236 CGCCGGGGGGTGGGCAGGGCCGG - Intronic
1051339771 9:16100802-16100824 CCCTTGGTGGGGGGCGGGGTGGG - Intergenic
1052739897 9:32383379-32383401 CCTTGGGAGGTAGGGAGAGTAGG - Intergenic
1052816570 9:33106664-33106686 CCCTGGGAGGGAGGCAGGGAGGG + Intronic
1052840484 9:33288533-33288555 TCCTGGGGGCTGGGCAGGGCAGG + Intergenic
1052941136 9:34132870-34132892 CCCTGGGATGGGGGCTGGGCTGG + Intergenic
1053072728 9:35110755-35110777 GCCTGGGAGGTGGGTGAGGTGGG + Exonic
1053128949 9:35604856-35604878 ACCTGGGAAATGGGCAGGCTGGG + Intergenic
1053261790 9:36672691-36672713 CCGTGTGAGGTTGCCAGGGTAGG - Intronic
1054759465 9:68991768-68991790 CCTTGTAAGGTAGGCAGGGTGGG - Intronic
1055402655 9:75941115-75941137 CGCTGGAAGGAGGGCAGGCTGGG - Intronic
1055483982 9:76739001-76739023 CCCTGTGAAGTGGGCAGAGCTGG + Intronic
1056282674 9:85057173-85057195 CACAGGGAGGTGGGCAGCATGGG + Intergenic
1056721843 9:89078736-89078758 GCCTGGGAGGTGGGCAAAGGTGG + Intronic
1056733010 9:89181971-89181993 CCCTGGTAGGTTGGTTGGGTTGG + Intergenic
1056888559 9:90468161-90468183 GTCTGAGAGGTGGGCAGAGTAGG + Intergenic
1057315714 9:93967107-93967129 CCCTGAGAGTGGGGCTGGGTGGG - Intergenic
1057727517 9:97578701-97578723 CCCTGGGAGGTGAGCAGGGCAGG - Intronic
1057945058 9:99319263-99319285 TTCTGGGAGGTGGACAGAGTTGG + Intergenic
1058005086 9:99906234-99906256 CCCTGTGAAGTGGACAGGGCAGG - Intergenic
1058095038 9:100850323-100850345 CACTGGGAGGTGTGGAGGGTGGG + Intergenic
1059159886 9:112024009-112024031 CTATGGGGGGTGGGCAGGGATGG - Intergenic
1059961737 9:119571828-119571850 CTTGGGGAGGTGGGCTGGGTGGG + Intergenic
1060051846 9:120383583-120383605 GCCTTGGAGGTGAGCAGGGAAGG - Intergenic
1060219111 9:121755071-121755093 CCCTGGGAGGTGGGCGGCTCAGG + Intronic
1060514028 9:124254768-124254790 CCCTTGGATGGGAGCAGGGTAGG - Intergenic
1060721542 9:125983011-125983033 CCGTGGGAGGAGGGCAGGTTCGG - Intergenic
1061008572 9:127942289-127942311 CCCTGGGCAGAGGGCACGGTCGG + Exonic
1061022795 9:128027085-128027107 CCCTGGGAGGAGGGAAGGGCAGG - Intergenic
1061038154 9:128124790-128124812 CCCAGGTAGAGGGGCAGGGTGGG + Intronic
1061086856 9:128404666-128404688 CCCCAGGAGGGGAGCAGGGTGGG - Intergenic
1061572392 9:131485806-131485828 GAGTGGGAGGTGGGAAGGGTAGG + Intronic
1061579772 9:131529865-131529887 TCCTGGGAGGTGGGTAGGCTGGG + Intronic
1061817349 9:133205210-133205232 CCCTGGGAGGTCTGCTGGGAGGG - Intergenic
1061818079 9:133208007-133208029 TCCTTGGAGGTGGGCAGAGCTGG + Intronic
1061822821 9:133238266-133238288 CCCCCAGAGCTGGGCAGGGTTGG + Intergenic
1061865387 9:133489469-133489491 CCCTGGAAGGTGGGGAGGGGAGG - Intergenic
1061882977 9:133577278-133577300 GCGTGGGGGGTGGGCTGGGTGGG - Intergenic
1061992931 9:134170029-134170051 GCGTGAGAGGTGGGCAGGGCAGG - Intergenic
1061997215 9:134192619-134192641 CACTGGGAGGTGGGCTGGTGGGG + Intergenic
1062024853 9:134335636-134335658 CCCTGGGAGGAGCTCAGGCTAGG + Intronic
1062179674 9:135184597-135184619 TACGGGGAGGTGGGCAGGTTAGG - Intergenic
1062242373 9:135547347-135547369 TCCTTGGAGGTGGGCAGGGCTGG - Intronic
1062425269 9:136503373-136503395 CCCTGGCCGGTGGGCGGGGGAGG - Intronic
1062429658 9:136521350-136521372 CCCTGGGGAGTGGGCAGGGAGGG - Intronic
1062488538 9:136792910-136792932 CCCTAGGGTGTGGGGAGGGTCGG - Exonic
1062527550 9:136984435-136984457 GCCTGGGCGCTGGGCAGGGGTGG + Intronic
1062532300 9:137007290-137007312 CCCAGGGAGGTGGGCGGGCAGGG + Exonic
1062563832 9:137154868-137154890 TCCTGGGAGATGGGCATGCTGGG - Intronic
1062582307 9:137234055-137234077 GCCTGGGGGGTGGGCCGGGGTGG - Intronic
1062637272 9:137498283-137498305 CCCTGGGCGAAGGGTAGGGTTGG - Intronic
1062723765 9:138059384-138059406 TCCTGGGAGGGAGGCAGGGCTGG + Intronic
1186402103 X:9269507-9269529 CCATGGGCGGTGGGCATGGAGGG + Intergenic
1186410230 X:9340383-9340405 CCCAGGGAAGTGGGCGGGGTGGG - Intergenic
1186435893 X:9543038-9543060 CCCTGTGAGCAAGGCAGGGTGGG + Intronic
1186581786 X:10827453-10827475 CTCTGGCTGGTGGGCGGGGTGGG - Intronic
1189351542 X:40279414-40279436 CTCTGTGAGGTGGGCAGGTGTGG + Intergenic
1189390018 X:40568773-40568795 ACCTGGGAGGTGGGCAGAGGTGG - Intergenic
1190916019 X:54811666-54811688 CCCTGGGGGATGGGCACAGTGGG + Intronic
1191853238 X:65601664-65601686 CCCTGGCAGGTTGACAGGCTGGG + Intronic
1191947672 X:66553630-66553652 CCATGGTGGGTGAGCAGGGTGGG + Intergenic
1192543157 X:71992121-71992143 TACTGGGAGGTGGGCAGAGAGGG + Intergenic
1192807690 X:74524627-74524649 TCCTGGGAGCTGGGCAGGAGGGG - Exonic
1193046866 X:77063111-77063133 CCATGACAGGTGGGCAGGGTAGG + Intergenic
1193151567 X:78129860-78129882 CCCTGTGAGGTAGGCAGGGTAGG + Exonic
1193919158 X:87404889-87404911 CCTTGGGAGGTGAGCACGCTTGG - Intergenic
1195018450 X:100801113-100801135 CACTGGGAGTTGGGCAGGCTGGG - Intergenic
1195328799 X:103779743-103779765 CCCTGGGAGGTGGGTGGGAGGGG + Intronic
1195722486 X:107879550-107879572 CACAGGGTGGTGGGCAGGGTGGG + Intronic
1196391306 X:115210279-115210301 CCCTGTGTGGTGTGCAGGCTAGG + Intronic
1197153217 X:123242736-123242758 ACCTGTGAGGTGGGCAGAGCAGG + Intronic
1197372809 X:125645984-125646006 CTATGGGAGGGGGGCAGGGGTGG - Intergenic
1198129475 X:133679400-133679422 CCCTTTGAGGTAGGCAGGGGAGG + Intronic
1198137404 X:133767757-133767779 CAATGGCAGGTGGGCAGGGGTGG + Intronic
1198228523 X:134668845-134668867 CTGGGGGAGGTGGGTAGGGTGGG - Intronic
1198444408 X:136697102-136697124 CTCTGGGAGCTGGGCAGCATGGG - Intronic
1199608304 X:149593796-149593818 CCCTGTGAGGTGAGCAGGCCAGG - Intronic
1199613202 X:149634947-149634969 CCCTGGGAGGTGGGTGGGTCTGG + Intergenic
1199630816 X:149775564-149775586 CCCTGTGAGGTGAGCAGGCCAGG + Intronic
1200149392 X:153943863-153943885 CACTGGGAGATGGGCAGGAAGGG + Intronic
1200168088 X:154051063-154051085 CCCTTGGATGTGGGCAGTGAAGG + Intronic
1200210348 X:154344339-154344361 CCCTGGGAGGGGGGCATTGGAGG - Intergenic
1200220504 X:154387753-154387775 CCCTGGGAGGGGGGCATTGGAGG + Intergenic
1200229422 X:154436810-154436832 CCCGGGGGGGTGGGCGGGGGTGG + Intergenic
1200753988 Y:6972825-6972847 CCCTGTGAGGGAGGCAGGATGGG + Intronic
1201250735 Y:12054970-12054992 CTCAGGGAGGTGGGAAGGCTGGG + Intergenic
1201344264 Y:12965594-12965616 CTCTGGGAGGTGCGCAGGGCAGG + Intergenic