ID: 906609357

View in Genome Browser
Species Human (GRCh38)
Location 1:47191040-47191062
Sequence TCCACCTGGCCCTCCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 411}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906609353_906609357 -5 Left 906609353 1:47191022-47191044 CCCCAGGATCACGTGGTGTCCAC 0: 1
1: 0
2: 2
3: 5
4: 68
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609355_906609357 -7 Left 906609355 1:47191024-47191046 CCAGGATCACGTGGTGTCCACCT 0: 1
1: 0
2: 1
3: 4
4: 78
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609348_906609357 17 Left 906609348 1:47191000-47191022 CCCTCGGAAGAGGCAAAAGCCTC 0: 1
1: 0
2: 1
3: 3
4: 86
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609354_906609357 -6 Left 906609354 1:47191023-47191045 CCCAGGATCACGTGGTGTCCACC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609352_906609357 -2 Left 906609352 1:47191019-47191041 CCTCCCCAGGATCACGTGGTGTC 0: 1
1: 0
2: 1
3: 5
4: 107
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609347_906609357 23 Left 906609347 1:47190994-47191016 CCAGAGCCCTCGGAAGAGGCAAA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609349_906609357 16 Left 906609349 1:47191001-47191023 CCTCGGAAGAGGCAAAAGCCTCC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411
906609345_906609357 30 Left 906609345 1:47190987-47191009 CCTGGAGCCAGAGCCCTCGGAAG 0: 1
1: 0
2: 1
3: 21
4: 227
Right 906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG 0: 1
1: 0
2: 4
3: 44
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906609357 Original CRISPR TCCACCTGGCCCTCCAGCTC AGG Intronic
900395110 1:2450288-2450310 TCCCCGTGGGCCTCCAGCACAGG + Intronic
900576583 1:3385537-3385559 TCCACCTGAACCACCATCTCGGG - Intronic
901839455 1:11944815-11944837 TACCCCTGCCCCGCCAGCTCTGG + Intronic
901862568 1:12084282-12084304 TCCCCCTGCTACTCCAGCTCAGG - Intronic
902530799 1:17089517-17089539 TCCACCTGCCCCACCACCCCTGG - Intronic
902621970 1:17655999-17656021 TCCGCCTCCTCCTCCAGCTCCGG - Exonic
902985188 1:20150434-20150456 TCCCCCTGCTTCTCCAGCTCTGG + Intergenic
903153173 1:21427731-21427753 TCCACCTGGTCCTCCAGATATGG - Intergenic
903159958 1:21480254-21480276 TCCACCTGGTCCTCCAGATATGG + Intronic
904277193 1:29392306-29392328 TTGGCCTGGCCCCCCAGCTCTGG + Intergenic
904768789 1:32869932-32869954 TCCACCTCCCCCTCCATGTCTGG - Intronic
905131034 1:35757789-35757811 GCCACCTGAACCTCCAGCCCTGG + Intronic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
907317719 1:53583149-53583171 TACATCTGCGCCTCCAGCTCAGG - Intronic
907472854 1:54685606-54685628 TCCACCTGCCAATCCAGCTCTGG - Intronic
912087773 1:106030929-106030951 TCCACCGGACAGTCCAGCTCTGG - Intergenic
912382522 1:109255096-109255118 TCCTCCTGGCCCGGCAGCTCTGG + Intronic
913605607 1:120462997-120463019 TCCACCTGGTCTTCCAGATAGGG + Intergenic
913643024 1:120830619-120830641 TCCACCTGGTCTTCCAGATAGGG + Intronic
913643791 1:120837372-120837394 TCCACCTGGTCTTCCAGATAGGG + Intronic
913989739 1:143599823-143599845 TCCACCTGGTCTTCCAGATAGGG - Intergenic
914082938 1:144426225-144426247 TCCACCTGGTCTTCCAGATAGGG - Intronic
914177855 1:145294729-145294751 TCCACCTGGTCTTCCAGATAGGG - Intronic
914178400 1:145299495-145299517 TCCACCTGGTCTTCCAGATAGGG - Intronic
914178945 1:145304241-145304263 TCCACCTGGTCTTCCAGATAGGG - Intronic
914179323 1:145307424-145307446 TCCACCTGGTCTTCCAGATAGGG - Intronic
914179698 1:145310605-145310627 TCCACCTGGTCTTCCAGATAGGG - Intronic
914180243 1:145315373-145315395 TCCACCTGGTCTTCCAGATAGGG - Intronic
914180788 1:145320143-145320165 TCCACCTGGTCTTCCAGATAGGG - Intronic
914181331 1:145324893-145324915 TCCACCTGGTCTTCCAGATAGGG - Intronic
914181874 1:145329653-145329675 TCCACCTGGTCTTCCAGATAGGG - Intronic
914182419 1:145334406-145334428 TCCACCTGGTCTTCCAGATAGGG - Intronic
914182964 1:145339162-145339184 TCCACCTGGTCTTCCAGATAGGG - Intronic
914183509 1:145343916-145343938 TCCACCTGGTCTTCCAGATAGGG - Intronic
914184052 1:145348686-145348708 TCCACCTGGTCTTCCAGATAGGG - Intronic
914184596 1:145353450-145353472 TCCACCTGGTCTTCCAGATAGGG - Intronic
914185141 1:145358198-145358220 TCCACCTGGTCTTCCAGATAGGG - Intronic
914185686 1:145362951-145362973 TCCACCTGGTCTTCCAGATAGGG - Intronic
914186232 1:145367711-145367733 TCCACCTGGTCTTCCAGATAGGG - Intronic
914186778 1:145372459-145372481 TCCACCTGGTCTTCCAGATAGGG - Intronic
914187322 1:145377213-145377235 TCCACCTGGTCTTCCAGATAGGG - Intronic
914187865 1:145381965-145381987 TCCACCTGGTCTTCCAGATAGGG - Intronic
914188410 1:145386721-145386743 TCCACCTGGTCTTCCAGATAGGG - Intronic
914188953 1:145391477-145391499 TCCACCTGGTCTTCCAGATAGGG - Intronic
914210808 1:145577168-145577190 TCCACCTGGTCTTCCAGATAGGG - Intergenic
914269569 1:146067950-146067972 TCCACCTGGTCTTCCAGATAGGG - Intronic
914270106 1:146072676-146072698 TCCACCTGGTCTTCCAGATAGGG - Intronic
914270645 1:146077414-146077436 TCCACCTGGTCTTCCAGATAGGG - Intronic
914271183 1:146082144-146082166 TCCACCTGGTCTTCCAGATAGGG - Intronic
914271718 1:146086871-146086893 TCCACCTGGTCTTCCAGATAGGG - Intronic
914272254 1:146091589-146091611 TCCACCTGGTCTTCCAGATAGGG - Intronic
914272792 1:146096311-146096333 TCCACCTGGTCTTCCAGATAGGG - Intronic
914273330 1:146101033-146101055 TCCACCTGGTCTTCCAGATAGGG - Intronic
914273869 1:146105751-146105773 TCCACCTGGTCTTCCAGATAGGG - Intronic
914274405 1:146110459-146110481 TCCACCTGGTCTTCCAGATAGGG - Intronic
914275476 1:146119903-146119925 TCCACCTGGTCTTCCAGATAGGG - Intronic
914276012 1:146124635-146124657 TCCACCTGGTCTTCCAGATAGGG - Intronic
914366815 1:146986555-146986577 TCCACCTGGCCTTCCAGATAGGG + Intronic
914367351 1:146991316-146991338 TCCACCTGGCCTTCCAGATAGGG + Intronic
914485631 1:148106889-148106911 TCCACCTGGCCTTCCAGATAGGG - Intronic
914532403 1:148534631-148534653 TCCACCTGGTCTTCCAGATAGGG - Intronic
914532944 1:148539357-148539379 TCCACCTGGTCTTCCAGATAGGG - Intronic
914533479 1:148544071-148544093 TCCACCTGGTCTTCCAGATAGGG - Intronic
914534014 1:148548779-148548801 TCCACCTGGTCTTCCAGATAGGG - Intronic
914534549 1:148553487-148553509 TCCACCTGGTCTTCCAGATAGGG - Intronic
914535084 1:148558199-148558221 TCCACCTGGTCTTCCAGATAGGG - Intronic
914535620 1:148562944-148562966 TCCACCTGGTCTTCCAGATAGGG - Intronic
914536155 1:148567660-148567682 TCCACCTGGTCTTCCAGATAGGG - Intronic
914536690 1:148572390-148572412 TCCACCTGGTCTTCCAGATAGGG - Intronic
914537051 1:148575586-148575608 TCCACCTGGTCTTCCAGATAGGG - Intronic
914585596 1:149058872-149058894 TCCACCTGGTCTTCCAGATAGGG - Intronic
914628872 1:149489764-149489786 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914629406 1:149494521-149494543 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914629940 1:149499276-149499298 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914630474 1:149504037-149504059 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914631008 1:149508798-149508820 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914631539 1:149513559-149513581 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914632073 1:149518313-149518335 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914632610 1:149523068-149523090 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914633145 1:149527817-149527839 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914633680 1:149532548-149532570 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914634216 1:149537303-149537325 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914634751 1:149542056-149542078 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914635286 1:149546793-149546815 TCCACCTGGTCTTCCAGATAGGG + Intergenic
914635821 1:149551530-149551552 TCCACCTGGTCTTCCAGATAGGG + Intergenic
916179383 1:162070368-162070390 TCGGCCTAGCCCGCCAGCTCTGG - Intronic
916328062 1:163585405-163585427 TGGCCCTGGCCCTCCAGGTCTGG - Intergenic
918294615 1:183144616-183144638 TCAACCTGGCGTTCCTGCTCTGG - Exonic
919766040 1:201127864-201127886 TCCACGGGCCCCTCCAGCTCTGG - Intergenic
920871828 1:209801358-209801380 TCCACCTGGGCCACCAGCCAGGG + Exonic
922225836 1:223645425-223645447 ACCATCAGGCCCTCCAACTCTGG + Intronic
922695340 1:227728489-227728511 CCCACCTGGCTCTCCCGCCCCGG + Intergenic
922808929 1:228405498-228405520 TGCCCCAGGCCCTTCAGCTCGGG + Intronic
922989525 1:229894503-229894525 TCCACATTGCCCTGGAGCTCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923276579 1:232401861-232401883 GCCAACTGGCTCTCCAGCACAGG + Intronic
1063360854 10:5456731-5456753 TCCGGCAGGCCCTGCAGCTCAGG - Exonic
1066220839 10:33335426-33335448 CCCTCCTCGCCCTCCAGCTCTGG - Intronic
1066252292 10:33646374-33646396 TCTGCTTGGCCCTCCAGCACGGG - Intergenic
1068557684 10:58477366-58477388 TCCAGCAGAACCTCCAGCTCAGG + Intergenic
1068791078 10:61032001-61032023 TCCACGAGTCACTCCAGCTCCGG + Intergenic
1069686865 10:70324235-70324257 GCCACCTGTCACTCCAGCTGAGG + Intronic
1069724128 10:70566629-70566651 TCCTCCCCGCTCTCCAGCTCGGG - Exonic
1070167712 10:73911170-73911192 TCCACCTGTCCCCGCAGCGCCGG + Exonic
1070175445 10:73965773-73965795 TCCACCTCCCCCTCCTGCTATGG - Intergenic
1070289609 10:75105656-75105678 CTCACCTGGCCCCTCAGCTCTGG + Intronic
1070895971 10:79983134-79983156 TCCACCTCCTCCTCCATCTCTGG + Intergenic
1071507288 10:86240448-86240470 TGCCCCTGGCCCTCCAGCATGGG - Intronic
1073051118 10:100668084-100668106 TCCACATGACCCCCCAGCCCAGG + Intergenic
1073282298 10:102363427-102363449 TTCACCAGGCCCTCCAGGTGAGG - Intronic
1074386490 10:113020492-113020514 CCCATCTGGTCCTCCAGCCCTGG - Intronic
1075717757 10:124566788-124566810 CCCAAATGGCCCTCCAGCCCTGG - Intronic
1075733254 10:124648762-124648784 TCCACCTGTCCCGCCTGTTCGGG + Intronic
1075957817 10:126539050-126539072 TCCCCATGGCCCTGCAGCTGGGG - Intronic
1076035682 10:127196703-127196725 TCCTCCTCCTCCTCCAGCTCTGG - Intronic
1076234570 10:128853532-128853554 TCCACCTGGAACTGCACCTCAGG + Intergenic
1076251837 10:128990975-128990997 TTAACCTGGCCCTCCAGCCTCGG - Intergenic
1076491184 10:130862680-130862702 TCCACACAGGCCTCCAGCTCAGG - Intergenic
1076499871 10:130929043-130929065 CCCACCTGCACCTCCATCTCAGG - Intergenic
1077067429 11:648547-648569 TCCAGCCGGACCTCCAGCCCAGG - Intronic
1077322835 11:1949986-1950008 GTCACCTGGCCCCCCAGCCCAGG + Intronic
1077442217 11:2574162-2574184 CCCACCTGGCCCTGCAGCTGTGG - Intronic
1077484953 11:2834384-2834406 TCTTTCTGGCTCTCCAGCTCCGG - Intronic
1077486150 11:2839219-2839241 TGCACCTGGGCCTCCTGCCCAGG + Intronic
1078107218 11:8365887-8365909 TCCATTTGTCCTTCCAGCTCTGG + Intergenic
1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG + Intergenic
1080704812 11:34680447-34680469 TTCACCTGGTTCTCCAGCTGGGG + Intergenic
1081567254 11:44267592-44267614 TCCACTTGGCCCTTCGGTTCTGG + Exonic
1082989479 11:59195109-59195131 TTCCCCTGGCCCTTCATCTCTGG + Intronic
1084702418 11:70796118-70796140 TCCACCTCGCCCACCTGCCCTGG + Intronic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1084742108 11:71146588-71146610 TCCTCCTGTCCCTCCAGCCCTGG - Intronic
1085695935 11:78704848-78704870 TCCATCTGTCCCTGCAGCTCAGG + Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088582154 11:111326849-111326871 TCCAACTGGACAGCCAGCTCAGG + Intergenic
1089326826 11:117663271-117663293 TCCACCTGGCCCTCCTACCTGGG + Intronic
1089525267 11:119093025-119093047 ACCCCCTCGCCCTCCAGCTTTGG - Intronic
1089912976 11:122121993-122122015 TCCATCTCTCCCTCCAGCTCTGG - Intergenic
1090650072 11:128798813-128798835 GCCACCTGGCCTTGAAGCTCAGG - Intronic
1202805853 11_KI270721v1_random:5299-5321 GTCACCTGGCCCCCCAGCCCAGG + Intergenic
1091746802 12:2998000-2998022 TCCTCCCCGCCCTCCAGCCCTGG + Intronic
1092137430 12:6159610-6159632 TACACCTGGGCCTGCAGCTGCGG + Intergenic
1095258886 12:40075385-40075407 TCCACCTGCCTCTCCAGTTTTGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095483754 12:42662756-42662778 TTCATGTGGCTCTCCAGCTCTGG - Intergenic
1095945341 12:47750420-47750442 TCCTCCTGTCCCTGCAGCCCAGG - Exonic
1096599873 12:52721668-52721690 TCCTCCTTTGCCTCCAGCTCAGG - Intergenic
1097103097 12:56603372-56603394 TCTATCTGGCGCTCTAGCTCTGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100384339 12:94091686-94091708 CCCTCCTGGCCCTCCACCCCAGG - Intergenic
1100915059 12:99411046-99411068 TCCACCTGCTCCTCCAACCCAGG - Intronic
1101789289 12:107912827-107912849 TGCAGCTGGCCCTCCCGCACTGG + Intergenic
1101961754 12:109256096-109256118 GCCACCTGGCCCTCCAGCCTGGG + Intronic
1102577695 12:113866774-113866796 TCCACCTGGCTATCTAGCTTGGG - Intronic
1102752794 12:115310363-115310385 TCCACCTGCCCCTCTATCTTTGG + Intergenic
1104188692 12:126457563-126457585 CCCTCTTGGCCCTCCAGCACTGG + Intergenic
1104811502 12:131622626-131622648 GCCACCTTGCCCTCCCTCTCTGG + Intergenic
1105437749 13:20391720-20391742 TCCTCCTGGTCCTCCTTCTCTGG + Intergenic
1107571330 13:41661410-41661432 TCCACCATGCCCTACAGCCCAGG - Intronic
1109593197 13:64514474-64514496 ACCACATTGCCCTCCAGCCCGGG - Intergenic
1111710372 13:91804886-91804908 TCAACCTGGCCTGCCAGGTCTGG - Intronic
1112395238 13:99023991-99024013 TCCAACTGACCCCTCAGCTCAGG + Intronic
1112416335 13:99206273-99206295 TCCAACTGTCCCCCCACCTCTGG - Intronic
1112958216 13:105088068-105088090 TGCACATCGTCCTCCAGCTCAGG + Intergenic
1113387193 13:109859612-109859634 TCCAGCTGCCCCTGCAGCTCAGG - Intergenic
1113566557 13:111322932-111322954 TGGCCCTGGCCCTGCAGCTCAGG + Intronic
1113920621 13:113906708-113906730 GCCACCTGGGCCCCCGGCTCTGG - Intergenic
1115027359 14:28760342-28760364 CCCACCTGGCCCTCACTCTCCGG - Intergenic
1115445863 14:33488707-33488729 TCCACCCAGCTTTCCAGCTCAGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117253366 14:53955759-53955781 TCTTCCTGGCCCTCCAGGCCCGG - Intronic
1121121446 14:91378251-91378273 ACCCCCTGTCCCTCCAGCTCAGG - Intronic
1121461117 14:94079354-94079376 TCTCCCTGGGCCTCCAGCTCAGG + Exonic
1122296341 14:100708472-100708494 CTCACCTGGCCCTCCAGGTGAGG + Intergenic
1123193455 14:106593198-106593220 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1123199006 14:106643657-106643679 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1123199929 14:106652751-106652773 CAGACCTGGCCCTGCAGCTCTGG - Intergenic
1123872168 15:24587636-24587658 TCCAGCTGATCCTTCAGCTCAGG + Intergenic
1124360052 15:29029982-29030004 TCCACATGGCCAGCCACCTCTGG - Intronic
1125504176 15:40257442-40257464 CCCACCTGACCCTCCAGACCTGG - Intronic
1127683433 15:61319036-61319058 TGCACCTGGCTCCCCAGCTGAGG - Intergenic
1128144172 15:65323186-65323208 TCCACCTGGCTCTCTCTCTCAGG + Intergenic
1128530986 15:68447620-68447642 TCCACCTGGCCCTCTTGATAAGG + Intergenic
1128694950 15:69754597-69754619 TCCCACTTGTCCTCCAGCTCTGG + Intergenic
1129177276 15:73849088-73849110 TCCATCTGGCCAAACAGCTCTGG + Intergenic
1129404048 15:75302582-75302604 TCCATCTGCCACTCCAGCTGTGG + Intergenic
1129469024 15:75740005-75740027 TCCACTTGCCACTCCAGCTGTGG + Intergenic
1129508387 15:76102030-76102052 ATCACCTAGCCCTCCAGCCCAGG - Intronic
1129583078 15:76832614-76832636 CCCACTAGGCCCTCCAGCACTGG - Intronic
1130140675 15:81223752-81223774 ACCAACTGGGCCTCCAGCTCTGG - Intronic
1130580711 15:85134867-85134889 TACACCTGGCCCAGCACCTCAGG - Intronic
1131259776 15:90882331-90882353 TCCACCCTGTCCCCCAGCTCTGG + Exonic
1131422228 15:92316767-92316789 TCCTTCTGACCCTCCAGGTCGGG - Intergenic
1132366650 15:101262541-101262563 CCCACCTCCACCTCCAGCTCAGG + Intergenic
1132658141 16:1049783-1049805 TCTGCCTGGCCCAGCAGCTCTGG + Intergenic
1132672838 16:1108719-1108741 TCCCCCTAGCCCTCCCGCCCAGG - Intergenic
1132864808 16:2088044-2088066 TCCACAAGGCCCTCCATGTCTGG - Exonic
1132902198 16:2263258-2263280 TCCAGCTCGACTTCCAGCTCAGG - Exonic
1133216232 16:4294151-4294173 TACAGCTGGCCCTCCAGCCTCGG + Intergenic
1133316939 16:4890785-4890807 GCCTCCTGGCGCTCCAGGTCCGG + Exonic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1135280583 16:21150943-21150965 CCCACCTGGGCCTCCAGCAAAGG - Intronic
1135566697 16:23516695-23516717 CCCACCTGGCCATGCACCTCAGG + Intronic
1136361889 16:29785871-29785893 TCCACGAGACCCTCCAGGTCTGG + Intergenic
1136922423 16:34344021-34344043 TCCCCCTGTCCCTCCCTCTCTGG + Intergenic
1136982150 16:35067785-35067807 TCCCCCTGTCCCTCCCTCTCTGG - Intergenic
1137400777 16:48152651-48152673 TCCCTCTGGCCCACCAGATCGGG + Intronic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1137548766 16:49422292-49422314 TCCAGCTGGCCCTCCCTGTCAGG - Intergenic
1138585454 16:57967174-57967196 TCCACCTCCGCCTCCATCTCTGG + Exonic
1139531135 16:67543211-67543233 TGCTCCAGGCCCTGCAGCTCAGG - Exonic
1139785000 16:69385727-69385749 TCCGCCGGGCCCCCCAGCCCCGG + Exonic
1140039836 16:71398897-71398919 TCCAACTGGTCTTCCAGCTCAGG + Intergenic
1141068944 16:80935955-80935977 TCCACCTGGCGCCCCAGGGCTGG + Intergenic
1141441707 16:84033528-84033550 CCCACCTGGCCCTTCAACCCTGG + Intronic
1141699985 16:85637948-85637970 GCCACCTCCCCCTGCAGCTCTGG - Intronic
1142141603 16:88475181-88475203 TCCACCTGCCTCGCCTGCTCTGG - Intronic
1142292941 16:89201129-89201151 TCCTCCTGGGCTTCCTGCTCCGG - Exonic
1142815180 17:2419674-2419696 TCAAGCTGGCCCCTCAGCTCTGG - Exonic
1142900446 17:3008232-3008254 TCCAGCTGGCCCTTGGGCTCTGG - Intronic
1143562696 17:7705111-7705133 TCCGCCTCGAGCTCCAGCTCCGG + Intergenic
1143579771 17:7818688-7818710 TCCTTCTGCTCCTCCAGCTCAGG - Exonic
1143852726 17:9824908-9824930 TCCACCTGGGCCTCCAATTTGGG + Intronic
1146968417 17:37052665-37052687 ACAACCTAGCCCTCCAGCACAGG - Intronic
1147186590 17:38716558-38716580 TCCACCACCACCTCCAGCTCAGG + Exonic
1147193349 17:38749357-38749379 TCCACCTGGCGCTGGGGCTCCGG + Exonic
1147416622 17:40295907-40295929 TCCTCCTGCCCCTCCTGCTGGGG + Intronic
1147430320 17:40366865-40366887 CCCACCACTCCCTCCAGCTCAGG + Intergenic
1149997789 17:61413908-61413930 TCCACCTATCCCTCTGGCTCAGG - Intergenic
1151172635 17:72260030-72260052 TCCACCTGCCCCTCCTCCCCTGG - Intergenic
1151705334 17:75764320-75764342 TCCCCCTTGCCCCACAGCTCAGG - Intronic
1151727169 17:75891951-75891973 TCCAGCTGCCCCTCCCGCTGGGG - Intronic
1151745814 17:76011233-76011255 GCCACCTGGCTCTCCACCTTCGG - Intronic
1151791207 17:76307199-76307221 TCCCCAGGCCCCTCCAGCTCGGG + Intronic
1152123460 17:78432810-78432832 TCCTCATGGGCCTCCACCTCAGG - Intronic
1152241480 17:79163556-79163578 CCCATCCTGCCCTCCAGCTCTGG - Intronic
1152571938 17:81124772-81124794 TGCACCTCGTCCACCAGCTCTGG + Exonic
1153675397 18:7452331-7452353 CCCACCAGGCCCTCCACCACAGG + Intergenic
1156623577 18:38882058-38882080 TCCACCTTGCACTCCAGCATGGG + Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157744262 18:50120963-50120985 TCCAGCCTGCCCTCCAGCCCGGG + Intronic
1159066270 18:63570921-63570943 TCCAACTGGACCTCCGCCTCGGG - Intergenic
1159922398 18:74237778-74237800 TCTCCCTGGCCCTGCAGCCCAGG + Intergenic
1160443696 18:78911882-78911904 TGCCCCAGGCCCTCCAGCTCTGG + Intergenic
1160499862 18:79396260-79396282 TCCACTTGGCCCTGCGGCTGCGG + Exonic
1160554126 18:79715042-79715064 TCCTCCTGCCCACCCAGCTCAGG - Exonic
1160734006 19:653558-653580 TCCAGCAGGCCCTTCAGCCCTGG - Intronic
1161483714 19:4523730-4523752 TCCACCAGGTCCGCCAGGTCGGG + Exonic
1161659853 19:5539459-5539481 TCCACTCGGGCCCCCAGCTCTGG - Intergenic
1162043035 19:7981892-7981914 GCCAGCAGGCCCTCCTGCTCTGG - Intronic
1162144999 19:8608201-8608223 TGCACCTGGGCCTCCCTCTCTGG + Exonic
1162463154 19:10825102-10825124 TCCACCTGCCGCTCCAGTTGGGG - Exonic
1162947938 19:14054893-14054915 TCCACCTTAGCCTCCAGCTCGGG + Exonic
1163424236 19:17232359-17232381 TTCAACTGGCCCTACGGCTCGGG - Exonic
1163452045 19:17384095-17384117 TACCCCTGTCCCTCCAGCTATGG + Intergenic
1163521897 19:17796497-17796519 GCCACCTGGCCGTCTAGGTCTGG + Intronic
1163663263 19:18590881-18590903 TCCTCCTGCCCCGCCAGCTCTGG - Exonic
1163777842 19:19228315-19228337 TCCACCTGATCCTCTGGCTCTGG - Exonic
1165726204 19:38114814-38114836 TCCCCCTCGCTCTCCATCTCTGG - Intronic
1166204451 19:41259913-41259935 TCCACCTGGTACTCCCTCTCAGG + Exonic
1166360113 19:42249469-42249491 ACCACCCGGCCCTCCGGATCTGG - Exonic
1166873581 19:45884600-45884622 GCCGCCTCGCCCTCCGGCTCGGG + Exonic
1167534663 19:50042024-50042046 TCTACCTTGCCCTTCAGCACAGG + Intronic
1167587452 19:50383013-50383035 TCCATCTTGCACTCCAGCTCCGG - Intergenic
1168332843 19:55579814-55579836 TCCTCCTGTCTCTCCATCTCTGG - Intronic
1168712825 19:58511641-58511663 TCCACCTGGGCCTGAAGATCAGG - Exonic
1202676228 1_KI270711v1_random:9312-9334 TCCACCTGGTCTTCCAGATAGGG - Intergenic
926684828 2:15690606-15690628 AGCACCTGGCCCTTCAGCCCTGG - Intergenic
927277217 2:21272339-21272361 CCCACCTGGCCCTACAGCACTGG - Intergenic
928374630 2:30764576-30764598 TCAACCTGTGCCTCCAGCACAGG - Intronic
928403505 2:30996473-30996495 TCCACCTGCCTCTCCAGCACAGG - Intronic
928656549 2:33457958-33457980 TTCACCTGGCCCTTCAACTGAGG + Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932575027 2:72958099-72958121 CCCACCCAGGCCTCCAGCTCTGG - Intronic
932622095 2:73270750-73270772 TCCTGCTGCCCCTCCATCTCTGG + Intronic
932834701 2:75025478-75025500 TGAACCTGGGCCTCCAACTCTGG - Intergenic
933804372 2:85987503-85987525 GCCACCAGGACCTCCAACTCAGG - Intergenic
935285478 2:101560507-101560529 TCCATCTGCCCCTACAACTCTGG + Intergenic
936076277 2:109403766-109403788 TCAACCTGGCCGTCTGGCTCTGG - Intronic
936522604 2:113220514-113220536 TCCACCAAACCCTCCAGCTCTGG - Intronic
937725902 2:125166226-125166248 TCCTCCTGGCCCCTCAGCTCTGG - Intergenic
938045943 2:128120366-128120388 TTCAACTGTCCCTCCAGGTCGGG - Exonic
939989424 2:148863580-148863602 TGCACCTGGTCCTCCATCTGAGG - Intergenic
940973856 2:159922095-159922117 TGCGCCTGGTTCTCCAGCTCTGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942418761 2:175785974-175785996 TACCCCTGGCTCTCCATCTCTGG + Intergenic
943801789 2:192069203-192069225 TACAACTGCCCCTCAAGCTCTGG + Intronic
946482863 2:220073684-220073706 TCCATCTGGCCCTTCCCCTCTGG + Intergenic
946486930 2:220109820-220109842 TCCACCAGGCTCTCCTTCTCTGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948283355 2:236765699-236765721 CCCACCCTGCCCCCCAGCTCTGG + Intergenic
948565449 2:238883510-238883532 TCCGCCTCGCTCTGCAGCTCTGG - Intronic
948691830 2:239711129-239711151 CCCACCTGGACCTCCAGCTCAGG + Intergenic
948789068 2:240367959-240367981 TCCAGCTGGGCCTCCAGGTGCGG - Intergenic
948942827 2:241204588-241204610 CCCACCAGGCTCTCCACCTCTGG - Intronic
1170706033 20:18745545-18745567 GCCACCTGTCCTTCCAGATCTGG - Intronic
1171348701 20:24486287-24486309 TCCACCTGGCTCCCCAGCCCAGG - Intronic
1172126428 20:32627529-32627551 TCGCCCTGGCCCCCCAGCCCTGG + Intergenic
1174085867 20:48006772-48006794 TCCACCCACCCCTCCAGCCCTGG - Intergenic
1174130391 20:48340178-48340200 TCCACCTGCCCCTCCAGCCCTGG + Intergenic
1176029815 20:63006546-63006568 TGCACCTCGCGCCCCAGCTCAGG - Exonic
1176030427 20:63008753-63008775 TCCTCCTGCTCCCCCAGCTCCGG - Intergenic
1176108533 20:63400756-63400778 TCCAGCGGGACCACCAGCTCTGG + Intergenic
1177554256 21:22669383-22669405 TCCACCTGACCCTCCACCAGTGG + Intergenic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1180693803 22:17739370-17739392 ACGGCCTGGCCCTGCAGCTCAGG - Exonic
1181024571 22:20120665-20120687 AACACCTGGCCCTCCTGCCCAGG - Intronic
1182020332 22:27076222-27076244 TAAAGCTGGCCCTCCAGCTTAGG + Intergenic
1183149395 22:36026189-36026211 TCCACCTCCACCTCCACCTCTGG - Intronic
1183495332 22:38140086-38140108 TGCACCTGGCCTGCCAGCTGGGG - Exonic
1183516626 22:38270617-38270639 TGCACCAGGCCCTGCAGCCCCGG - Intronic
1183581794 22:38730788-38730810 GCCACCCAGCCCTCCCGCTCAGG + Exonic
1184589770 22:45474277-45474299 TCCACGTTTCCCTCTAGCTCTGG - Intergenic
1184662555 22:45972093-45972115 TCCCCCCGGGCCTCCAGCGCTGG - Intronic
1184671612 22:46014781-46014803 TCCACCCAGCCCTCCTTCTCTGG - Intergenic
1184945638 22:47801975-47801997 TGCACCTGCCCCTCCAGGTATGG + Intergenic
1185032172 22:48449875-48449897 ACATCCTGGCCCTCCAGCCCTGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953837206 3:46357057-46357079 TCCACCTGCCCCTCCTGCTCTGG - Intronic
954031648 3:47824376-47824398 TTCACCTTCCCCTCCAGCCCTGG + Intronic
954638500 3:52084657-52084679 TCCCCCTGCCCCCCCAGCTCTGG + Intronic
955465883 3:59236885-59236907 TCAACCTGGTACTCCAGCTGTGG - Intergenic
956640887 3:71414368-71414390 TCCACCTGGGCCTCAGCCTCTGG + Intronic
958595845 3:96221464-96221486 TCCACCTTGCCTTCCAACTTTGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961161449 3:124730313-124730335 TCCACCTGACCCTTGAGCCCGGG + Intergenic
961341733 3:126227662-126227684 TCCTCCTGACCCTGCAGCTAGGG + Intergenic
961864579 3:129944484-129944506 TCCTCCTGGCCATCCTGCACAGG - Intergenic
962235383 3:133702226-133702248 CCCACAGGCCCCTCCAGCTCTGG + Intergenic
962630762 3:137273103-137273125 TCCACCTGCTACCCCAGCTCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963844709 3:150143527-150143549 TCCACCAGGCCATCCTGCTGTGG - Intergenic
966235895 3:177701105-177701127 CCCACCTAGCCCTCCAGCCTCGG + Intergenic
967220625 3:187245326-187245348 TCCACCTGACCGCCCAGTTCAGG + Intronic
967946037 3:194804989-194805011 GGCTCCTGGACCTCCAGCTCAGG - Intergenic
968075395 3:195813342-195813364 CCCAACAGTCCCTCCAGCTCTGG + Intergenic
968086577 3:195876657-195876679 TCCCCCTGGGCCACCAGCCCTGG - Intronic
968650978 4:1760192-1760214 TCTCCTTAGCCCTCCAGCTCCGG + Intergenic
968810519 4:2797702-2797724 TCCGCCTGCCCCTCCTGCTTGGG + Intronic
969597853 4:8158958-8158980 TCCGCCTGGCTCCCCAGCTGCGG + Intergenic
969662395 4:8537913-8537935 TCCACAATGACCTCCAGCTCAGG - Intergenic
969870189 4:10099690-10099712 TCCACCTGGGCCTGCAGACCGGG + Intronic
970001782 4:11372209-11372231 TCCAGCTCGACTTCCAGCTCAGG + Intergenic
971181123 4:24329398-24329420 CCTACCTGCCTCTCCAGCTCCGG + Intergenic
971346715 4:25818241-25818263 CCTACCTGGACCTCCAGCGCAGG - Exonic
974086898 4:57270935-57270957 TCCACATGGCTCTTCAGCTCGGG - Intergenic
977609923 4:99021021-99021043 TCCCCCAGATCCTCCAGCTCAGG + Intronic
979266571 4:118710169-118710191 TCCACCTCTTCCTCCACCTCTGG - Exonic
980107198 4:128599365-128599387 TTCCCCTGGCCCTGCAGCTCTGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981657620 4:147130009-147130031 TTCACCTAGCCCTTCAGCTGTGG + Intergenic
982068544 4:151675199-151675221 CCCGCCTGGCCCTCCTTCTCGGG - Intronic
982999384 4:162393754-162393776 TCCACCTGGTCCTGCTACTCAGG + Intergenic
983535595 4:168853706-168853728 TTCACCTGGCCCACCAGGCCTGG - Intronic
985445456 4:190019002-190019024 TTCCCCTGGCTCTCCAGCTCCGG - Intergenic
985551926 5:538169-538191 TCCACCTAGCCCACGAGCTCAGG + Intergenic
985695679 5:1338825-1338847 TCCCCCCGGCGCTCCAGCTCTGG + Intronic
985979626 5:3451719-3451741 TCCACCTGGATCCCCACCTCAGG + Intergenic
986125989 5:4882726-4882748 CCAGCCTGGCCCTCCAGCCCTGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988805469 5:34736357-34736379 TCCACCAGGCACTCCAGCCTGGG + Intronic
988957778 5:36336263-36336285 TCCTCTTGGCCCCCCAGCCCGGG + Intergenic
990539792 5:56760833-56760855 TCCACCAGCACCTACAGCTCTGG + Intergenic
990771204 5:59247903-59247925 TCCACCTGGCCTTCCAACATAGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994875862 5:105420000-105420022 TCCAGCTGGTCCTTCTGCTCAGG + Intergenic
997226866 5:132215449-132215471 TCCGCCTGGGCCTGCAGCTCGGG - Intronic
997592999 5:135086966-135086988 TCCACCAGCACCTCCAACTCTGG - Intronic
998156234 5:139788560-139788582 TCCAGCTGGCCGTCCAGGCCTGG - Intergenic
998529907 5:142874896-142874918 TCCACCTGGCACTCTAGCTAGGG - Intronic
999132895 5:149298135-149298157 ACCTCCAGGCCCTGCAGCTCCGG + Intronic
999238863 5:150115842-150115864 TCCACCTGGAGCTCAAGCTGGGG + Exonic
999317996 5:150596531-150596553 TCCACCCCGCCCTCCACATCTGG + Intergenic
999738539 5:154531389-154531411 TCCATCTGTCCTTCCAGATCAGG - Intergenic
1001704040 5:173729046-173729068 TCCACCTGCCACTCCTACTCCGG + Intergenic
1001984592 5:176062029-176062051 TCCACCAAGCGCTCCAGCTGGGG - Intronic
1002105506 5:176877757-176877779 TCCACCCGGCCTTCCACCGCTGG + Intronic
1002232923 5:177782168-177782190 TCCACCAAGCGCTCCAGCTGGGG + Intronic
1002263069 5:178007651-178007673 TCCACCAAGCGCTCCAGCTGGGG - Intronic
1002926104 6:1606563-1606585 TCCACCTGGCCCAGGAGCTGGGG - Intergenic
1004354640 6:14920436-14920458 TCCTCCAGCCCTTCCAGCTCTGG - Intergenic
1004564795 6:16786222-16786244 TCCTCCTGGTACTCCAACTCTGG + Intergenic
1005997782 6:30941902-30941924 TCCACCTGTCCCCCCAGGGCTGG - Intronic
1006079936 6:31559247-31559269 TCCTCATGGCCCCCCAGCGCCGG - Intergenic
1007624047 6:43232830-43232852 CACACCTGTCCCTCCACCTCCGG + Intergenic
1010235572 6:73572478-73572500 TCCACCTGCCCCCCCAGTGCGGG - Intergenic
1012726827 6:102824298-102824320 GCCACATTGCCCTCCAGCTTGGG + Intergenic
1013413287 6:109901395-109901417 TCCTCCTGGGCCTCCTGCTGAGG - Intergenic
1013512315 6:110856322-110856344 ACTACCTGACTCTCCAGCTCTGG + Intronic
1015275678 6:131381300-131381322 TCCAGCTGTCGCTCCAGCTGGGG + Intergenic
1015297256 6:131610209-131610231 ACCAACTGGTCCTCCAGCACAGG + Exonic
1017098962 6:150830894-150830916 TCCACAGAGACCTCCAGCTCTGG + Exonic
1017491034 6:154945309-154945331 ACCACCAGCCCCTCCAGCCCCGG + Intronic
1017511894 6:155121932-155121954 TCCATCTGGGCAGCCAGCTCAGG + Intronic
1017635650 6:156440504-156440526 TTCCCTTGGCCCTCCAGCACTGG + Intergenic
1017826203 6:158083880-158083902 TGCACCCTGCCCTGCAGCTCAGG - Intronic
1018029752 6:159832504-159832526 TCAGCCTGGCCCTGCAGCTCTGG - Intergenic
1019451206 7:1099348-1099370 TCCCCGTGGCCCACCAGCACAGG - Intronic
1019526664 7:1483482-1483504 TGTACCAGGCCCTCCAGCTCAGG + Intronic
1020043175 7:5019547-5019569 TTCACCTGGGCCTCCACATCTGG - Intronic
1020128578 7:5546789-5546811 TCCAGGTGGCTCTGCAGCTCAGG - Intronic
1021817641 7:24463759-24463781 TCCACCTGCCTCTCCATCCCAGG - Intergenic
1022264158 7:28736975-28736997 TCAGCCTGGCCCTCCATCTGGGG - Intronic
1022567752 7:31420634-31420656 TACAACTGGGCCTCCATCTCTGG + Intergenic
1022890130 7:34688701-34688723 TGCACCTGCTCCTCCAGATCAGG + Intronic
1023873012 7:44272800-44272822 TCCACTTGGCCTTTCAGCTGGGG + Intronic
1025259913 7:57412097-57412119 TCCTCCTCCCCCTGCAGCTCTGG + Intergenic
1026488026 7:70837765-70837787 TCCGGCAGGCCCTGCAGCTCAGG - Intergenic
1026744135 7:72998080-72998102 TCCTCCTGGCACTCCAGACCTGG - Intergenic
1026848128 7:73708930-73708952 TGCACCTGGCTCAGCAGCTCCGG - Intronic
1027030242 7:74882757-74882779 TCCTCCTGGCACTCCAGACCTGG - Intergenic
1027099602 7:75367012-75367034 TCCTCCTGGCACTCCAGACCTGG + Intergenic
1027235311 7:76294515-76294537 TCCTCCCGCCCCTCCCGCTCTGG - Intergenic
1028752693 7:94399056-94399078 TCCACGTGGTCCTCTATCTCCGG - Exonic
1029357341 7:100061895-100061917 TCCACCTGGCCATCCACATCAGG - Intronic
1029378849 7:100199524-100199546 TCCTCCTGGCACTCCAGACCTGG + Exonic
1029567333 7:101347784-101347806 GCCACCCAGCCCTCCAGCTGCGG + Intergenic
1030075716 7:105734563-105734585 CCCTCCTTGCCCTCCAGCTGAGG + Intronic
1032345174 7:131110069-131110091 CCCTCCTCCCCCTCCAGCTCCGG - Intergenic
1034093211 7:148382797-148382819 TCCGCCTGGCCCACTAGCTAAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035042283 7:155937789-155937811 CCCACTTGGCCCTGGAGCTCTGG - Intergenic
1035327521 7:158074623-158074645 TCCAGCTTCCCCTCCACCTCGGG - Intronic
1035757099 8:2042849-2042871 TCCACCAGACACACCAGCTCTGG - Intergenic
1037094457 8:14967313-14967335 TCTAACTGGCGCTCCATCTCTGG + Intronic
1037746430 8:21649210-21649232 TCCACAAGGACCTCCATCTCAGG - Intergenic
1037994244 8:23341115-23341137 TCCACGTAGCCCTCCATCACTGG + Exonic
1038662085 8:29506135-29506157 TTCACCTGGGCCTTCATCTCAGG - Intergenic
1038701085 8:29849794-29849816 AGCACCTGCCCCTCCAGATCTGG - Intergenic
1039892484 8:41694785-41694807 TCCTCCAGGCTCCCCAGCTCTGG + Exonic
1043864430 8:85359275-85359297 TCCATCTGGCCTTCCAGTTACGG - Intronic
1045059691 8:98401074-98401096 TCCACCTGGCTCTCTCTCTCGGG + Intergenic
1045498363 8:102727029-102727051 TCCACCCTGGCCTCCACCTCAGG - Intergenic
1048572812 8:135669276-135669298 TCCGCCTGGCCCTGCAGCAGAGG + Intergenic
1048639512 8:136337790-136337812 TCCAACTGTCCCTCCAGTTTTGG + Intergenic
1049406511 8:142453954-142453976 CCCACCTTCCTCTCCAGCTCTGG - Intronic
1049552386 8:143266650-143266672 TCCGCGTGCCCCTCCAGCTCAGG + Intronic
1049643844 8:143727485-143727507 TCCTCCGGGCCCTCGCGCTCTGG + Exonic
1053015608 9:34660321-34660343 TCCACCTGAGGCTCCACCTCTGG - Exonic
1053123623 9:35562903-35562925 TCCAGCTGCCCCTCCGGCTCTGG + Exonic
1054984549 9:71246483-71246505 TTCACCAGGCCCTTCAGTTCTGG + Intronic
1055072711 9:72183424-72183446 TCCACCAGGCCCACCTGCTGGGG + Intronic
1056796810 9:89664182-89664204 CCCACCTGGACCGCCAGCTCTGG - Intergenic
1057785601 9:98085258-98085280 GCCACCAGGCCCTACTGCTCAGG - Exonic
1057785951 9:98087503-98087525 TCTACCCGGCCCTGCGGCTCTGG - Exonic
1059167990 9:112097280-112097302 GGCACCTGGCCCTCCAGCCTGGG + Intronic
1060070048 9:120538562-120538584 ACCACGTGTCCTTCCAGCTCTGG - Intronic
1060925888 9:127454816-127454838 TCCCTCTGGGCCTCAAGCTCTGG + Intronic
1061262091 9:129486091-129486113 GCAGCCTGGCCCGCCAGCTCTGG - Intergenic
1061426214 9:130499946-130499968 TCCAGCTAGACCTACAGCTCAGG - Intronic
1062128947 9:134882362-134882384 TCCAGGTGACCCTCCAGCTGAGG + Intronic
1062385622 9:136310394-136310416 GGCACCTGCCCCTCCAGCTTTGG + Intergenic
1186334378 X:8570681-8570703 TCCATCTGCCCCACCAGCACCGG - Exonic
1188341422 X:29006563-29006585 TCCATCTTGCCCTCAATCTCTGG + Intronic
1188961580 X:36499668-36499690 TCCATCTGGCCATCTAGCCCAGG + Intergenic
1190219071 X:48499349-48499371 TCCATCTGTCCATCCATCTCAGG - Intergenic
1194566376 X:95494194-95494216 TCCTCCTGGGCCTCCAGGCCGGG - Intergenic
1200081686 X:153579961-153579983 TCCACCTCCCACTCCAGATCCGG + Exonic
1200957908 Y:8970243-8970265 TCTACCTCGCCCTGCAGCCCAGG + Intergenic