ID: 906609677

View in Genome Browser
Species Human (GRCh38)
Location 1:47192703-47192725
Sequence GTGAAGACCTCCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906609677_906609691 30 Left 906609677 1:47192703-47192725 CCCTCCTCCCTGGAGGTCTTCAC 0: 1
1: 0
2: 5
3: 45
4: 324
Right 906609691 1:47192756-47192778 GGACACAGCCCTGATCCCCATGG 0: 1
1: 1
2: 4
3: 36
4: 352
906609677_906609687 9 Left 906609677 1:47192703-47192725 CCCTCCTCCCTGGAGGTCTTCAC 0: 1
1: 0
2: 5
3: 45
4: 324
Right 906609687 1:47192735-47192757 GGGTCATCTCCCCAGCTGTATGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906609677 Original CRISPR GTGAAGACCTCCAGGGAGGA GGG (reversed) Intergenic
900157441 1:1208892-1208914 GGCCAGACCTCCAGGCAGGATGG - Intergenic
900200186 1:1401183-1401205 ATGAAGGCCTGCAGTGAGGATGG + Intronic
901128067 1:6943214-6943236 GTGAGGACGGTCAGGGAGGAGGG - Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
903028172 1:20444318-20444340 TTGTTCACCTCCAGGGAGGAGGG - Intergenic
903541284 1:24097750-24097772 GTGAAGGCCCCCAGGGAAGCGGG + Intronic
904330276 1:29754106-29754128 GCAAAGAGCTCCAGGGAGAAGGG + Intergenic
905012868 1:34759079-34759101 GGGAAGGCCTCCAGGGAGGCTGG - Intronic
905685445 1:39904133-39904155 GTATAGACCTCAAGGGAGGCTGG + Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907489837 1:54801693-54801715 CTGAGGACCTGCAGAGAGGATGG - Intergenic
908097483 1:60754244-60754266 GTGAAGACCTACAGGCATGAAGG - Intergenic
908227704 1:62072578-62072600 ATGGTGACCTCCTGGGAGGAGGG + Intronic
908818460 1:68057805-68057827 GTGAATACCCTCAGGGAGGCAGG + Intergenic
912392050 1:109310002-109310024 GTTTGGACCTCTAGGGAGGAGGG - Exonic
912430406 1:109625650-109625672 GTGAACAGCTCCTGGGGGGAGGG - Exonic
913105058 1:115606605-115606627 ATGATGATCTCCAGGGAGCAGGG + Intergenic
913170862 1:116230980-116231002 ATGAAGACACCCTGGGAGGAGGG + Intergenic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
918948167 1:191097807-191097829 GAAAAGACCTCCTGTGAGGAAGG - Intergenic
920243228 1:204569004-204569026 GCAAAGACCTCTAGGGAGCAGGG - Intergenic
920821003 1:209380693-209380715 GTGAAGACAGCCAGGCAGTAAGG - Intergenic
920961828 1:210670475-210670497 CTGAAGGCCTCCAGGGAGGATGG + Intronic
921985802 1:221310477-221310499 GGAAAGAGGTCCAGGGAGGAGGG + Intergenic
922995289 1:229952878-229952900 GTGATTACTTCCAGGGAGAAGGG + Intergenic
923790161 1:237104929-237104951 GAGAAGACCTCGAGGGAGAAGGG - Intronic
923981446 1:239328522-239328544 GTGAAGACCTTGAGGCAGGGAGG - Intergenic
924275978 1:242387460-242387482 GTGATGACATCCAGGGCGGAGGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1064262221 10:13795087-13795109 GTGAACATCACCAGGGAGGTGGG + Intronic
1064370746 10:14750039-14750061 GCGAACAGCTCCAGCGAGGAGGG + Intronic
1065552373 10:26881810-26881832 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1065866724 10:29921051-29921073 GTGAAGTCCCCCAGGCAGCAGGG + Intergenic
1066580871 10:36880609-36880631 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1067542013 10:47161752-47161774 CTGAGGACCCCCAGGTAGGATGG - Intergenic
1067806685 10:49397699-49397721 GTCAAGAGCTCCAGAGAGCAGGG - Intergenic
1068490201 10:57713701-57713723 GTGAAGACAGCCAGGGAACATGG - Intergenic
1069072054 10:63998962-63998984 GTAAACACCTGCAGGGAGGCAGG + Intergenic
1069334040 10:67327773-67327795 GTGAACACTTGCAGGGAGGCAGG - Intronic
1070774888 10:79103711-79103733 GCAAAGAGCCCCAGGGAGGAGGG - Intronic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1072193363 10:93094041-93094063 TTGAAGACCTACAGTGAGCAAGG - Intergenic
1072641030 10:97211439-97211461 GGGAAGACCCCCAGGCAGAAAGG - Intronic
1072691451 10:97574719-97574741 GTCAAGACCCCAAGGGAAGAAGG + Intronic
1073137649 10:101228796-101228818 GAGATGACTTCCAAGGAGGACGG - Exonic
1073146543 10:101285289-101285311 GGGAAGACATCCAGGAAGCAAGG + Intergenic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1074670457 10:115784742-115784764 GTGAAAACATACAGGGAAGAAGG - Intronic
1075568616 10:123522187-123522209 GTGAAGGCCTGGAGAGAGGAGGG - Intergenic
1076308176 10:129479825-129479847 GTGAGGACCCCCAGCAAGGAGGG - Intronic
1076554097 10:131311177-131311199 GCGAGGACCGCCGGGGAGGAGGG + Intronic
1076626567 10:131824675-131824697 GTGAAGACCCCTGAGGAGGAGGG + Intergenic
1076695696 10:132246316-132246338 GTGAAGACCCCCAGACAGGCAGG + Intronic
1077480373 11:2811784-2811806 GTGGAGACCACCAAAGAGGAGGG + Intronic
1077981582 11:7306585-7306607 GTGAAGACCTCAAGGCAGGAAGG - Intronic
1080793979 11:35546440-35546462 GTGAGCAGCCCCAGGGAGGATGG - Intergenic
1081671006 11:44942745-44942767 ATCTTGACCTCCAGGGAGGAGGG + Intronic
1084431005 11:69111216-69111238 GTGAGGACCACCAGGAAGGAAGG + Intergenic
1085054343 11:73395139-73395161 GTGAAGACCATCACGGAGGCTGG + Exonic
1085642019 11:78198568-78198590 GCAAAGGCCTGCAGGGAGGAGGG - Intronic
1085999435 11:81963095-81963117 GTGAATATCTCCAGTGATGAGGG - Intergenic
1087309217 11:96521099-96521121 GTGAACACCTGCAGAGAGGCAGG - Intergenic
1089683759 11:120133969-120133991 GTTAAGACCTCCTGGGTGGACGG - Intronic
1089699159 11:120234117-120234139 GTGCAGACCTCCATGGAGAAGGG + Intergenic
1090162447 11:124510118-124510140 GTAAACACCTGCAGGGAGGCAGG - Intergenic
1091171667 11:133525324-133525346 GTGAAGCCCTTGAGGAAGGAGGG + Intronic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1091602312 12:1925386-1925408 CTGGAAACCTCCTGGGAGGACGG + Intergenic
1091602340 12:1925486-1925508 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091602354 12:1925536-1925558 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091743038 12:2973693-2973715 GTGCAGCCCGCCAGGCAGGAAGG - Intronic
1093088319 12:14891516-14891538 GTGAAGACATGAAGGGAGTAGGG + Intronic
1094251466 12:28366958-28366980 ATGAAAACCTCCAGGTAGGGTGG - Intronic
1094450753 12:30581012-30581034 GTGAAGCCATCAAGGGAGGCTGG + Intergenic
1095858222 12:46885463-46885485 GTGAGGAACTACAGGGAGCAAGG - Intergenic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1096877763 12:54644002-54644024 TTGAAGATCTCCATGGAAGAAGG - Intergenic
1101922874 12:108947113-108947135 GGGAAGACCTCAAGGAATGATGG - Intronic
1102123163 12:110458939-110458961 CTGAACACCTCCCAGGAGGAAGG - Intronic
1102445443 12:112998734-112998756 GTGAAGACATGTAGGGAGAAGGG - Intronic
1102582049 12:113895659-113895681 ATGAATTTCTCCAGGGAGGAGGG + Intronic
1104894178 12:132153768-132153790 GGGAAGGCCTCCCGGGGGGACGG - Intergenic
1104995472 12:132651776-132651798 GTGAAGAGCCCCATGGAGCAGGG + Intronic
1105761379 13:23517811-23517833 GTGAAGGCATACAGGGAGGCTGG + Intergenic
1107458244 13:40575435-40575457 GTGAAGGGCACCAAGGAGGAAGG + Intronic
1107899114 13:44994537-44994559 ATGAAGACTTCAAGGTAGGATGG - Intronic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1113286849 13:108858980-108859002 ATGAAGACCTGAAGGGAGGGAGG - Intronic
1113460106 13:110476291-110476313 GTGAAGAGCTCCAGGGGAAATGG - Intronic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1115500665 14:34046702-34046724 GTGAACACCCCTAGGGAAGAAGG - Intronic
1115964083 14:38867270-38867292 GGGAATTCCTACAGGGAGGAAGG - Intergenic
1118540183 14:66814377-66814399 GTGAACACCTGCAGGGAGGCAGG + Intronic
1119719533 14:76881855-76881877 GTGAGGTCTTCCATGGAGGAGGG + Intergenic
1120669180 14:87344422-87344444 GAGAAGAGTTCCAGGGAGAAAGG - Intergenic
1121013442 14:90534842-90534864 GTGGAGAACTCCAAGGATGATGG + Exonic
1121727926 14:96166493-96166515 CTGAGGACCTGCAGGGAGGGTGG + Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1123131875 14:105993979-105994001 GCGAACACCTGCAGGGAGGCAGG - Intergenic
1123582109 15:21725109-21725131 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1123618759 15:22167705-22167727 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1125723918 15:41858579-41858601 GTGAGGCCCTGCAGGCAGGAGGG - Intronic
1125741936 15:41971763-41971785 GTAAAGACCTCAAGGGAAGGGGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126168264 15:45672192-45672214 GCGAAGACCCCCAGGCAGGTGGG + Intronic
1126933043 15:53676162-53676184 GTGAGGACCTCCAGAAAGGTAGG + Intronic
1128217814 15:65946384-65946406 GTGAAGACATTTGGGGAGGATGG + Intronic
1131872416 15:96776170-96776192 GTGGAGCCTTCCAGGAAGGAAGG - Intergenic
1132092414 15:98957107-98957129 CTGATGATCTCCAGGAAGGAAGG - Exonic
1133171162 16:3983277-3983299 CTGAAGACCGCCAGGGCGGCGGG + Exonic
1134218956 16:12338409-12338431 GGGAATACCTCCCGGGGGGAAGG - Intronic
1135550176 16:23391788-23391810 GTGAGGCCCTCCAGTGAAGAGGG + Intronic
1135890149 16:26349656-26349678 GTGAGGCCATCCTGGGAGGAAGG + Intergenic
1136022398 16:27448597-27448619 CTGTACACCTCCAGGGTGGAGGG - Exonic
1138693921 16:58793553-58793575 GGGAAGGAATCCAGGGAGGAAGG - Intergenic
1139127653 16:64099252-64099274 GTGAAGAGCTACAGGGAGACAGG - Intergenic
1140965750 16:79964439-79964461 GTCACCACCTCCAGGGATGAAGG + Intergenic
1141484711 16:84330943-84330965 GAGCAGCCCTCCAGGGAGTAGGG - Intergenic
1142029134 16:87829735-87829757 GTGGAGACCACCGGGGAGGAGGG - Intergenic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1143353037 17:6303294-6303316 ATCAAGACCACCTGGGAGGATGG - Intergenic
1143880204 17:10024190-10024212 GTGAAGACTTGAAGGTAGGAAGG - Intronic
1144791218 17:17860438-17860460 GTGAAGACCAGCATGGATGAGGG + Intronic
1145035455 17:19537461-19537483 GGGAAGACCTACAGGGAAGGTGG + Intronic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1145973487 17:28970664-28970686 GTTAAGCCCTACAGGCAGGAAGG - Intronic
1148868071 17:50639477-50639499 GGGCAGGCTTCCAGGGAGGAAGG + Intronic
1151808173 17:76419756-76419778 TTGAAGACTTCCAGGCAGGAAGG + Intronic
1152904935 17:82965025-82965047 GTGCACACCCACAGGGAGGACGG + Intronic
1154335775 18:13463322-13463344 CTGCACACCTCCAGGGAGGCGGG - Intronic
1155292800 18:24358219-24358241 GCTCAGACCTCCAGGGATGAGGG + Intronic
1156896834 18:42256162-42256184 GTGAACACCTGCAGAGAGGCAGG - Intergenic
1157772111 18:50358349-50358371 ATGAAGACATGCAGAGAGGATGG - Intergenic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1159659244 18:71073494-71073516 TTGAAGACCTCCAGGGGAGCTGG - Intergenic
1159868160 18:73730379-73730401 GAGAGGACCTCCTGGTAGGAAGG - Intergenic
1160679284 19:405372-405394 GCGGTGAACTCCAGGGAGGAAGG - Intergenic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1160949371 19:1658188-1658210 GTGAAGACCCCCGGGAAGAAGGG - Intergenic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1161627431 19:5335490-5335512 GGGAAGTCATCCAGGAAGGAAGG + Intronic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1162551258 19:11359729-11359751 ATGAAGACCTCCTAGGAGGCAGG + Intronic
1163453677 19:17393826-17393848 GTGAAGGCCGCCAGGTAGGTGGG - Intergenic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166538566 19:43591410-43591432 GTTTAGTCCTCCAGGGAGGCTGG - Exonic
1166742454 19:45122639-45122661 GTGAAGACCTGCAGGCAGGGAGG + Intronic
1166924217 19:46255016-46255038 AGGAAAACCTCCAGGAAGGAAGG - Intergenic
1168163229 19:54526998-54527020 GTGAAGATCTCACGAGAGGATGG - Intergenic
1168385042 19:55956130-55956152 GTCAAGGCCTCCGGGTAGGACGG - Intronic
925052828 2:830591-830613 GCAAGGACCTCCAGGGACGAAGG - Intergenic
925732142 2:6926903-6926925 GTGAGGACTTGCAGAGAGGAAGG + Intronic
925901422 2:8511868-8511890 GTGCAGACATCCAGGCAAGAGGG - Intergenic
926998008 2:18759162-18759184 CTGACCACCTCCAGGGAAGAGGG - Intergenic
927488513 2:23505313-23505335 GAGAACACCTCCACGGAGGTCGG - Intronic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
928684513 2:33734295-33734317 GTGCAGACCTCATGGGAGTAGGG + Intergenic
929596634 2:43180175-43180197 GGGAAATCCTCCAGGGAGGTAGG + Intergenic
929597908 2:43187589-43187611 AGGGACACCTCCAGGGAGGAGGG + Intergenic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
931268277 2:60679761-60679783 ATGAAGACCTCAAGGAAGCAGGG + Intergenic
931826445 2:66005360-66005382 CTGAAAACCTCCATGGAGGTTGG + Intergenic
932166951 2:69516884-69516906 ATGAGGACCTCCCGGGAGCAGGG + Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
932919601 2:75895726-75895748 GTGAAGACATGCAGAAAGGATGG + Intergenic
934270924 2:91536435-91536457 GTGGAGACATCCAGGCTGGAAGG + Intergenic
935449313 2:103190573-103190595 GTGAACACCTTCATGGAGGCAGG + Intergenic
936445445 2:112591077-112591099 GGGATCACCTCCAGGGAGGAGGG - Intergenic
936847275 2:116852567-116852589 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
936847529 2:116854538-116854560 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
936849481 2:116878195-116878217 GTAAATTCCTCCATGGAGGAAGG + Intergenic
937428298 2:121817734-121817756 GAGAAGAGTTCCAGGGAGGCAGG + Intergenic
937866587 2:126756208-126756230 GGGAAGACATCCTGGGAGGAGGG - Intergenic
938054256 2:128201903-128201925 ATTCAAACCTCCAGGGAGGAAGG + Intergenic
939656823 2:144836441-144836463 CTGAAAACCTCCAGTGCGGATGG + Intergenic
940121150 2:150267791-150267813 TTGACCACCTCCTGGGAGGAAGG + Intergenic
940641347 2:156347505-156347527 GTTTAAACTTCCAGGGAGGATGG + Intergenic
940669290 2:156648241-156648263 CTGAAGACCTACAGGGGGAAGGG + Intergenic
942123463 2:172801327-172801349 GTCAAGTCTTTCAGGGAGGATGG + Intronic
943046577 2:182867488-182867510 GGAAATACCTCCAGGAAGGAGGG - Intergenic
944980920 2:205119271-205119293 GTAAAGACAGCCAGGCAGGAAGG - Intronic
945198335 2:207257794-207257816 GTGTAAACCCCCAGGGAGCAGGG - Intergenic
946349163 2:219137194-219137216 ATGAAAATCTCCAGGGAGGAAGG - Intronic
946643875 2:221813355-221813377 AGGAAGACCTCCAGCAAGGAAGG - Intergenic
947581025 2:231318611-231318633 GGGAACGCCTCCAGGCAGGAAGG + Intronic
947715190 2:232335698-232335720 TTGAAGCCCTCCAGGGTGGAAGG + Intronic
947720725 2:232367922-232367944 GTGAAGCCCTCCAGGGTGGAAGG + Intergenic
947734265 2:232446642-232446664 GTAAAGCCCTCCAGGGTGGAAGG + Intergenic
948025448 2:234772631-234772653 GTGAAAACCTCCAAGTGGGAAGG - Intergenic
948286595 2:236790728-236790750 GCCAAGTCCTCCAGGGTGGATGG - Intergenic
948423857 2:237876085-237876107 GTGAAGAGCTCCAGGGTGCCCGG + Intronic
948540140 2:238685445-238685467 GTGCACACTACCAGGGAGGATGG - Intergenic
948813021 2:240494680-240494702 TGGAAGAGCTCCAGGAAGGAAGG - Intronic
1168888471 20:1276753-1276775 TTGAATACCTCCAGTGAGGAGGG - Intronic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1169472645 20:5901484-5901506 GTCCAGAGCTCCTGGGAGGAGGG - Intergenic
1169653117 20:7891941-7891963 GTGAAGACCTCCTCTGAGTAGGG - Intronic
1171882312 20:30627603-30627625 GTGAACACCCGCAGGGAGGCAGG - Intergenic
1172847305 20:37937599-37937621 ATGAAGTCCCCCAGGAAGGAGGG - Intronic
1173680904 20:44880980-44881002 ATGATGACCTCCCGGGAGCAGGG - Intergenic
1173764535 20:45595646-45595668 GAGAGGACCTCCTAGGAGGAGGG - Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174084170 20:47993521-47993543 GTGAGGTCCTGCAGGGAGGCTGG + Intergenic
1176087369 20:63304208-63304230 GTGCACACCTGGAGGGAGGAAGG - Intronic
1176087478 20:63304568-63304590 GTGCACACCTGGAGGGAGGAAGG - Intronic
1177968056 21:27753710-27753732 GAGAAGAGCAGCAGGGAGGAAGG - Intergenic
1178187832 21:30243872-30243894 CTGAAGCCCTCCAGGCAGCATGG + Intergenic
1179282943 21:39950632-39950654 GGAATGACCTGCAGGGAGGATGG - Intergenic
1179774058 21:43648340-43648362 ATGAAGCCCAGCAGGGAGGATGG - Intronic
1180169374 21:46050014-46050036 GTGTTGACCTCCAGGGATGAGGG - Intergenic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1183404676 22:37624640-37624662 GTGAAGACCTGAAGGCAGTAAGG + Intronic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
950536886 3:13583915-13583937 GTGAAGACCCTTAGGGATGAGGG + Intronic
953240935 3:41148917-41148939 GAGCAGCCCACCAGGGAGGAAGG + Intergenic
954329484 3:49881950-49881972 TTGGATAGCTCCAGGGAGGAAGG - Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955640084 3:61073129-61073151 TTCAAGACCTACAGGGAGGAGGG - Intronic
955715825 3:61828727-61828749 GTGAAGACCTCCAGGGGACAGGG + Intronic
955774021 3:62414805-62414827 TTCTTGACCTCCAGGGAGGACGG + Intronic
955937361 3:64113933-64113955 GTGAACACCCACAGGGAGGTAGG + Intronic
956158549 3:66323987-66324009 GTGATGACCTCCTGGAAGCAAGG + Intronic
957282302 3:78169440-78169462 GTGAAGACATTCTAGGAGGAGGG - Intergenic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
959295732 3:104531577-104531599 GTGAATGCCTGCAGGGAGGGAGG + Intergenic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
961650794 3:128415837-128415859 GTGAGGAACTCCAGGAAGCAGGG - Intergenic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
964062083 3:152537376-152537398 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
965370413 3:167855277-167855299 GTTGAGATCTCCAGGGAGGTGGG + Intergenic
965480485 3:169212818-169212840 GTGAAGACCTCAAGGCAAGCAGG - Intronic
966597327 3:181736484-181736506 GTGAAGGGCCCCAGGGAGAACGG - Intergenic
966916363 3:184586351-184586373 GTGCACACCTCCAGGGAGTGGGG - Intronic
967984044 3:195082337-195082359 AGGAAGACCACCAGGGAGGGGGG - Intronic
968007061 3:195250203-195250225 GTGAAGACCTGAAGGAAAGAAGG - Intronic
968970249 4:3789882-3789904 GTGCCGGCCTCCAGGGATGAGGG - Intergenic
969637731 4:8379044-8379066 GAGAACACCCCCAGGAAGGAAGG - Intronic
969658478 4:8511325-8511347 GTGCAGACCACCACGGAGAAGGG - Intergenic
969695424 4:8731545-8731567 CTGAAGCCCTCCAGGGAGGAAGG + Intergenic
969970256 4:11039808-11039830 CTGAAGAGGTCCAGGGATGAGGG - Intergenic
970180267 4:13384305-13384327 GTGAATGCCTGCAGGGAGGCAGG + Intronic
972108917 4:35530398-35530420 GATAATACCTCCAGAGAGGAGGG - Intergenic
972635469 4:40880105-40880127 GTGATGATCTCCAGTGCGGATGG + Intronic
973365978 4:49210050-49210072 GTGAACGCCCGCAGGGAGGAAGG - Intergenic
973394620 4:49582401-49582423 GTGAACGCCCGCAGGGAGGAAGG + Intergenic
974581857 4:63814234-63814256 GTTAAGGCCTACAGGGAGGCAGG - Intergenic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
977352918 4:95910992-95911014 GTGAAGACAACCAGGTGGGAGGG - Intergenic
980829083 4:138107995-138108017 GTGGAAAGCTCCAGGAAGGAGGG - Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
982555986 4:156865690-156865712 GTGAACCCCACCAGGGAGGAAGG + Intronic
982920907 4:161273835-161273857 GTGACAACCTTCAGGGAGTAAGG + Intergenic
983145342 4:164207635-164207657 GTGAACACCAGCAGGGAGGCAGG - Intronic
983420124 4:167506633-167506655 GTAAACACCTGCAGGGAGGCAGG - Intergenic
983853700 4:172615486-172615508 GTGATAAACTCCAGGGAGTAAGG - Intronic
984684313 4:182648728-182648750 GTGATGACCTCTAGGAAGGAAGG - Intronic
985943610 5:3159676-3159698 GATAAGACCACCTGGGAGGATGG + Intergenic
986778867 5:11045935-11045957 GTTAAAACCACCAAGGAGGAAGG - Intronic
987144054 5:14974450-14974472 GTGATTACCTTCAGAGAGGAGGG + Intergenic
987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG + Intergenic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990326283 5:54678703-54678725 AGGAAGACCTTCAGGGAGGGAGG + Intergenic
990640941 5:57782637-57782659 GTGAAGTCCTGCAGGGAGGCAGG - Intergenic
990754674 5:59055640-59055662 GGGAGGCCCTCCAGGGTGGAGGG + Intronic
990910351 5:60845301-60845323 GTCAGGACCACCAGAGAGGATGG + Intergenic
991577797 5:68122775-68122797 GTGAACACCTGCAGGGAAGCAGG + Intergenic
993178445 5:84518538-84518560 GTTAACACCTGCAGGGAGGCAGG - Intergenic
993903337 5:93598642-93598664 GAGAGGACATCCAGGGAGAAAGG - Intergenic
996663219 5:126027872-126027894 GTGAACACCCACAGGGAGGCAGG + Intergenic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997792128 5:136770594-136770616 GGGAAGGACTCCAGGAAGGAGGG + Intergenic
998036459 5:138921022-138921044 ATGATAACCTCCAGGGAGGAGGG + Intronic
998215385 5:140234842-140234864 GTAAAGACCTCGAGGGAGGGAGG - Intronic
998825094 5:146093415-146093437 CTGAGCACTTCCAGGGAGGAGGG - Intronic
999187385 5:149722206-149722228 ATGATGACCTCCTGGGAGCAGGG + Intergenic
999313662 5:150569940-150569962 AGGAAGACCTCCTGGGAGAAGGG - Intergenic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1002445180 5:179286329-179286351 GTGCAGACCTCCAAGGAGGCAGG - Intronic
1003098894 6:3162547-3162569 CAGAAGAGCTCCAGGGAGGGAGG - Intergenic
1003544791 6:7051002-7051024 ATGAAGAGCTCTGGGGAGGAAGG + Intergenic
1004806044 6:19205087-19205109 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
1005360115 6:25023738-25023760 ATGAAGAACTCCAAGGAGGTCGG + Intronic
1006295953 6:33170200-33170222 GTGGAGGCCTCCCGGGAGTAAGG + Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007162224 6:39800866-39800888 GTCAAGTCCTCCAGGCAGGAGGG - Intronic
1007967041 6:46013177-46013199 ATGAAGACTTCCAAGAAGGATGG - Intronic
1008716407 6:54295170-54295192 GTGAATACCAGCATGGAGGATGG - Intergenic
1009596862 6:65746586-65746608 GTGAAAGCCTGCAGGGAGGCAGG + Intergenic
1010707097 6:79127855-79127877 GTAAACACCTACATGGAGGAAGG + Intergenic
1011351896 6:86432875-86432897 GGGAAGACGTAAAGGGAGGAGGG - Intergenic
1014408111 6:121077273-121077295 TTGAAATCCTCCAGAGAGGAAGG - Intergenic
1014604697 6:123458449-123458471 CTGAAGTCCCCCAAGGAGGAAGG + Intronic
1014793247 6:125699277-125699299 GTAATTACCTCCAGAGAGGAAGG + Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1018184176 6:161251602-161251624 TTAAAGACCCGCAGGGAGGATGG + Intronic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1019193685 6:170268737-170268759 CTGCAGCCCTCCCGGGAGGAAGG + Intergenic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019267624 7:127279-127301 GTGGACACGTCCAGGGAGGGTGG - Intergenic
1019479715 7:1260994-1261016 GTGGAGAACGCCAGGGAGGGAGG - Intergenic
1019736789 7:2654055-2654077 GTGAAGAGCTCCTTGGAGAAGGG - Intronic
1019847809 7:3524096-3524118 GCAAAGACCTGCAGGAAGGAAGG + Intronic
1020011558 7:4808247-4808269 GAAAAGCCCTCCAGAGAGGAGGG - Intronic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1022036414 7:26538551-26538573 GGGAGGAACTCCAGGGAGAATGG - Exonic
1024198267 7:47081377-47081399 GTGCAGTCCTCCACTGAGGAGGG - Intergenic
1024988615 7:55217756-55217778 GTGGAGACCTCTAGTGAGTAAGG + Intronic
1026677617 7:72441249-72441271 GAGCAGACCTACAGGGAGGTGGG + Intronic
1026738890 7:72966087-72966109 TTGAAGACCTCCAGGCAGATGGG + Exonic
1026789900 7:73324717-73324739 TTGAAGACCTCCAGGCAGATGGG + Exonic
1026996341 7:74619371-74619393 GGGATGACCTACAGGGAGGTGGG - Intergenic
1027104844 7:75398982-75399004 TTGAAGACCTCCAGGCAGATGGG - Exonic
1027418266 7:77995233-77995255 GTGAAGCCAGCGAGGGAGGAAGG + Intergenic
1028083103 7:86601150-86601172 GTGAATACCCACAGGGAGGCAGG + Intergenic
1029415775 7:100442276-100442298 AGGAAGAGATCCAGGGAGGAGGG + Intergenic
1029482222 7:100820044-100820066 GGGAAGAAGCCCAGGGAGGATGG + Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1030809216 7:113955238-113955260 GTGAACACCTGCAGGGAGGCAGG - Intronic
1030946491 7:115728434-115728456 GTAAAGACCTCTGGGGAGCAAGG + Intergenic
1032463730 7:132130301-132130323 GAGAAGAGATCCAGGAAGGAGGG + Exonic
1033111546 7:138582854-138582876 ATAAATACCTCCAGGGAGAAGGG + Intronic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1034578785 7:152025333-152025355 GTGGTGACCTCCCGGGAGCAGGG - Intergenic
1035451390 7:158979357-158979379 GGTAAGAGCTCCAGGGAGGCAGG - Intergenic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1038041047 8:23724555-23724577 GTGATGACTACCAAGGAGGAGGG + Intergenic
1038923905 8:32116436-32116458 GTGAAGAGCTCCATCCAGGAGGG - Intronic
1040404370 8:47086028-47086050 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
1041291295 8:56310755-56310777 GTGGAGACTTCCAGGGACCATGG + Intronic
1043882750 8:85563829-85563851 TTGAAGACATCCAAGGAGGCTGG + Intergenic
1045057992 8:98385544-98385566 CTGAGGACCTCCAGGAAGGAGGG + Intergenic
1046108306 8:109691920-109691942 GTGAAGACCTCGAGGGAGACTGG - Intergenic
1046520304 8:115317677-115317699 GTGTAGGCCTCAAGGGATGACGG - Intergenic
1047211093 8:122841156-122841178 GGGAAGACAGGCAGGGAGGAAGG - Intronic
1048266507 8:132991982-132992004 GTGAAGCCTTCCAGGAAGGAAGG - Intronic
1049383339 8:142328685-142328707 GTGACGGCCCCCAGGGTGGAAGG + Intronic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1049528782 8:143142957-143142979 GTGAGGACCTCTGGGGAGGGAGG - Intergenic
1050391201 9:5146370-5146392 GTGAATGCCTGCAGGGAGGCAGG - Intronic
1051550754 9:18326260-18326282 GTGATTACCTCTAAGGAGGAGGG + Intergenic
1051852652 9:21527780-21527802 GTGAACACCTGCACGGAGGCAGG - Intergenic
1051899544 9:22024366-22024388 GTGAATGCCTGCAGGGAGGCAGG - Intronic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1052310626 9:27064638-27064660 GTGGATACTTCCAAGGAGGAAGG + Intergenic
1055168329 9:73223705-73223727 GTGAACACCTGCAGGAAGGTAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059694906 9:116721787-116721809 GGTAAGATCTCCAGGCAGGAAGG - Intronic
1060621098 9:125067431-125067453 GTGAAGACAGACAGGAAGGAAGG + Intronic
1060802517 9:126553758-126553780 GGGAAGACTTCCCGTGAGGAGGG - Intergenic
1061946971 9:133913945-133913967 TCGAAGAGCTCCAGGGAGGTGGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1186071466 X:5825933-5825955 TTGAAGACCTCCCTGTAGGATGG - Intergenic
1186407712 X:9318208-9318230 TTGGTGACTTCCAGGGAGGATGG + Intergenic
1187251897 X:17606222-17606244 GTAAAGACCCCCACAGAGGAGGG + Intronic
1188247831 X:27855899-27855921 GTGATGCCCTCAAGGGAGGTGGG + Intergenic
1189391009 X:40576845-40576867 GTGATTACCTCCAGGGTGGAGGG - Intergenic
1189790112 X:44595794-44595816 TTGAAGTCCTCCAGGCAGAAGGG + Intergenic
1190274613 X:48891848-48891870 GTGAAGGCCTGCAGGGGGCAGGG + Intergenic
1191136215 X:57067946-57067968 GTCATGAACTCCAGGGAAGAAGG + Intergenic
1191191197 X:57669501-57669523 GAGAAGACTCCCAGGGAAGATGG - Intergenic
1194144720 X:90247571-90247593 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
1194925704 X:99820424-99820446 GTGAACACCCACAGGGAGGCAGG + Intergenic
1196764955 X:119235287-119235309 AAGCAGACCTCCACGGAGGAAGG - Intergenic
1196814796 X:119656485-119656507 GGGAAGACGGCCAGGGAGGTGGG + Intronic
1199257573 X:145734081-145734103 GTGAAGAGCAACAGGAAGGATGG + Intergenic
1200490475 Y:3816876-3816898 GTGAATGCCTGCAGGGAGGCAGG + Intergenic