ID: 906613246

View in Genome Browser
Species Human (GRCh38)
Location 1:47218053-47218075
Sequence GTGGCTTGTCCTCACCATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906613246_906613254 6 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613254 1:47218082-47218104 GAAGCCCAAACTATAAGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 120
906613246_906613251 3 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613251 1:47218079-47218101 GCTGAAGCCCAAACTATAAGGGG 0: 1
1: 0
2: 2
3: 6
4: 82
906613246_906613252 4 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613252 1:47218080-47218102 CTGAAGCCCAAACTATAAGGGGG 0: 1
1: 0
2: 0
3: 14
4: 112
906613246_906613249 1 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613249 1:47218077-47218099 AGGCTGAAGCCCAAACTATAAGG 0: 1
1: 0
2: 1
3: 10
4: 98
906613246_906613250 2 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613250 1:47218078-47218100 GGCTGAAGCCCAAACTATAAGGG 0: 1
1: 0
2: 0
3: 9
4: 78
906613246_906613253 5 Left 906613246 1:47218053-47218075 CCATCATGGTGAGGACAAGCCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 906613253 1:47218081-47218103 TGAAGCCCAAACTATAAGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906613246 Original CRISPR GTGGCTTGTCCTCACCATGA TGG (reversed) Exonic
901138635 1:7013700-7013722 GGGGCTTGTCCACACCAGGGGGG - Intronic
905814281 1:40936642-40936664 GTACCTTGTCTTCAACATGAGGG - Intergenic
906216736 1:44045553-44045575 GGGGCTTGACATCACCATGATGG + Intergenic
906577189 1:46901593-46901615 GTGGCTTGGGGTCACCATCATGG + Intergenic
906613246 1:47218053-47218075 GTGGCTTGTCCTCACCATGATGG - Exonic
907055195 1:51359825-51359847 GTGGCTTCTCTTGACTATGAAGG - Intronic
907074324 1:51564882-51564904 GTGCATGGTCCTCACCAGGAGGG + Intergenic
907423300 1:54362110-54362132 TACGCTTGTCCTTACCATGATGG - Intronic
907721665 1:56977873-56977895 CTGGCTTGTCCTTTCCATGCAGG + Intergenic
911668449 1:100582080-100582102 GTGGCCTCTCCTCATCTTGATGG + Intergenic
919863318 1:201758049-201758071 TTTTCTTGTCCTCACCATGAGGG + Intronic
921164226 1:212494535-212494557 CTGGCTGGTCCTCACTATGAGGG - Intergenic
922892899 1:229075225-229075247 GTCCCTTGTCCTCACTCTGAGGG + Intergenic
923301651 1:232646436-232646458 GTGGCTTCTGCTAACCTTGAAGG - Intergenic
1063898372 10:10705938-10705960 GAGGCTGGGCCTGACCATGAAGG - Intergenic
1068317999 10:55372629-55372651 TTGGCTTTGCCTCATCATGAGGG - Intronic
1068961994 10:62876452-62876474 GTGGGTGGTCTTTACCATGAAGG + Intronic
1071881574 10:89904598-89904620 GTCACTTGTCTTCAGCATGAGGG + Intergenic
1076554791 10:131314078-131314100 GGGGCTTCTCCTATCCATGAGGG - Intergenic
1077438818 11:2558803-2558825 GGGCCTTGGCCTCCCCATGAAGG - Intronic
1078600232 11:12724100-12724122 TGGGCTTGGCATCACCATGAAGG - Intronic
1081778211 11:45691511-45691533 GTGGCCTCTCCTCACCTTGTTGG + Intergenic
1082701847 11:56441853-56441875 GTGGCTTGACTTCAGCTTGATGG - Intergenic
1083356132 11:62067607-62067629 GTGTCTTCTCCTCATCAAGAGGG + Intergenic
1083485583 11:62981322-62981344 GAGGCTGGACCTCACCCTGAGGG - Exonic
1084209786 11:67615600-67615622 GGGGCTTGCCCTCACCTTGCTGG + Intergenic
1087477818 11:98659628-98659650 ATTGCTTGTCCTCTCCATCAAGG + Intergenic
1087952279 11:104237496-104237518 CTGGCTTATCCTCACATTGAGGG + Intergenic
1088078889 11:105885338-105885360 GTTGCTTGTCCTCATCTTCATGG + Intronic
1089021339 11:115218305-115218327 ATGGCTTCACCTCAGCATGAAGG - Intronic
1089801666 11:121035623-121035645 GAGGCTTTTCCTTAACATGATGG + Intronic
1089879630 11:121761318-121761340 GTGCCTTTTCCTGATCATGATGG + Intergenic
1090237347 11:125159235-125159257 GTGGCTAGTCCTAACTGTGATGG - Intergenic
1092064111 12:5575262-5575284 GAGCCTTGTCCTCACCATCAAGG - Intronic
1094787860 12:33871559-33871581 GTGGCTTTTCCTAAGCAGGATGG - Intergenic
1095406353 12:41870888-41870910 GTGGCTTATTCACACCGTGAGGG - Intergenic
1097138840 12:56882244-56882266 GTGGCTTGAGGTCACCATCATGG - Intergenic
1102200168 12:111052339-111052361 GTGGATTGTCATCACCATGAGGG + Intronic
1104266983 12:127242879-127242901 CTGGCTTGGCCTGCCCATGAAGG - Intergenic
1105061116 12:133151897-133151919 TTGACTGGTCCTCACCAGGATGG - Exonic
1105467934 13:20664508-20664530 GGGGCTGGTCCACACCATTATGG - Intronic
1110394293 13:75011974-75011996 TGAGCTTATCCTCACCATGAAGG + Intergenic
1113583751 13:111448721-111448743 GTGGCTCGACCTCCCCATGTGGG + Intergenic
1116880087 14:50158763-50158785 GTGGCTTTTCCTAACAATCATGG + Intronic
1118331712 14:64820553-64820575 GTGGCTTTTCCTCTCCCTGGGGG + Intronic
1119688619 14:76653190-76653212 GTGGCTTCACTTCCCCATGAAGG - Intergenic
1121985202 14:98498562-98498584 GTGACCAGTCCTCACCAGGAAGG - Intergenic
1122014824 14:98786332-98786354 GTGGCTTGTCCACACTAAGAGGG - Intergenic
1123983042 15:25621270-25621292 CTGGCTGGTGCCCACCATGATGG - Intergenic
1125730740 15:41891529-41891551 GTGGCTTAAACTCACCGTGATGG + Intronic
1129360375 15:75020528-75020550 TTGGCTTGTCCTCACCCAGTCGG + Exonic
1131108530 15:89750428-89750450 GTGCCTGGTCCTCACCTTGGCGG + Intronic
1131755522 15:95556960-95556982 GTGGAATGTCCTTACCATTAAGG + Intergenic
1133521883 16:6566239-6566261 GTGGCTTTTTCTCACCGTGGTGG - Intronic
1141390212 16:83658070-83658092 GTGCCATGTCCTCACCAGCAAGG + Intronic
1142967840 17:3592148-3592170 GTGGATTGCCCTCACGAGGAAGG - Exonic
1145998670 17:29118627-29118649 GTGGCTTGTCCTCAGGAGAATGG - Intronic
1146457929 17:33021615-33021637 CTGCCTCGTCCTCAACATGAAGG + Intronic
1147249695 17:39145512-39145534 GTGGCTTGTCCTGGCTATGGTGG - Intronic
1148325293 17:46779730-46779752 CTGCCTTGTGCTCACCATGCAGG - Intronic
1155086192 18:22460754-22460776 TTGGTTTGTCCTTACCCTGAAGG - Intergenic
1157173956 18:45433853-45433875 GTGGCTTTTCCTCTCCTGGAAGG + Intronic
1158190779 18:54826374-54826396 GTTGCTTGGCCACTCCATGAAGG - Intronic
1159458215 18:68690256-68690278 GTGGCTTGTGGTTACCATGTTGG - Intronic
1160590104 18:79939322-79939344 TTGGCATGTCCTCACCCTCAGGG + Intronic
1164636109 19:29792585-29792607 GGGCCCTGTCCTCACCATCAAGG - Intergenic
1164891652 19:31828769-31828791 CTGTCAAGTCCTCACCATGAGGG + Intergenic
927154659 2:20214512-20214534 GTGGCTTGCCCTCCCTCTGATGG + Intronic
928809786 2:35209048-35209070 GTGATTTGTCCTCACCATTTTGG + Intergenic
933185204 2:79270665-79270687 GTGGATTATGCTCACCCTGAGGG - Intronic
933692053 2:85186333-85186355 GTGGCTCCTCCTTTCCATGAGGG + Intronic
935698101 2:105787178-105787200 GTTGGTTGTCCTCACACTGAAGG + Intronic
942069184 2:172299949-172299971 GAGGCTTGGCCTGACCATGTCGG - Intergenic
943798680 2:192030521-192030543 GTGGCTTGTCAACAACATGCGGG - Intronic
947912701 2:233811834-233811856 GTGGCTTTTGGTGACCATGATGG - Intronic
948197864 2:236108428-236108450 GTGTCTGCTCCTCACCCTGAGGG + Intronic
1173067429 20:39726748-39726770 GTGGGTTTACCTCACAATGAGGG + Intergenic
1179613229 21:42565637-42565659 GAGCCTTGTCCCCACCACGAGGG - Intronic
1181045055 22:20210503-20210525 GTGGGTGGTGCTCACCATGATGG - Intergenic
1181934784 22:26430209-26430231 GTGACTTGGCCTCATCCTGAGGG + Intronic
1182113505 22:27741586-27741608 GTGGCTAGTGGTCACCATGTTGG + Intergenic
1184223593 22:43116132-43116154 GTGCCTTTTTATCACCATGAAGG - Intronic
949154125 3:808727-808749 GTGGCTTGAACTCTCCATAATGG - Intergenic
950032560 3:9862416-9862438 GTGGCCTTTCCCCACCCTGAGGG + Intergenic
950918029 3:16665326-16665348 GAGGCCTGTCCCCACCAGGAAGG + Intronic
951249898 3:20382394-20382416 GTGGCTTGGCCCCAGCACGATGG + Intergenic
954219013 3:49141282-49141304 GTGGCTTGGGGTCACCATCACGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954671448 3:52293337-52293359 GGGGCTTGTCCTCATCCTCAGGG - Exonic
958805090 3:98800716-98800738 TTGGCTTGCCGTCACAATGAAGG - Exonic
961244129 3:125436739-125436761 GTGCCCTGTCCTCACACTGAAGG - Intergenic
972576166 4:40354030-40354052 GTGGATATTCATCACCATGATGG - Exonic
973377016 4:49293602-49293624 TTTCCCTGTCCTCACCATGATGG - Intergenic
977722168 4:100251989-100252011 GTAGCTTGTTCTCTCCATGATGG + Intergenic
989147359 5:38261973-38261995 GTGGTGTGTCCACACCGTGAAGG - Intronic
992655649 5:78907172-78907194 GTGCCTTGTCTTCTCCATCAAGG - Intronic
997395629 5:133557670-133557692 GAGGCTGGCACTCACCATGAAGG + Intronic
997407353 5:133661570-133661592 GTGGCATGACATCATCATGAAGG + Intergenic
998526228 5:142845743-142845765 CTGGCAGGTCCTCACCATGATGG + Intronic
1004202955 6:13566571-13566593 CTTGCTTATCCTCCCCATGATGG - Intergenic
1004473866 6:15953042-15953064 GTTACTTGTCCTCAGCATGTGGG - Intergenic
1007085780 6:39143989-39144011 GTGGCTAGGCCTCACAATCATGG + Intergenic
1008525692 6:52404651-52404673 GTGGCTGGTCCTCACCCTGTTGG + Exonic
1010159902 6:72841252-72841274 ATAGCTTGTCTTCACCATTAAGG - Intronic
1010272435 6:73929424-73929446 GTGGCTTAGCCTCAGGATGAAGG + Intergenic
1012492640 6:99799464-99799486 GGGGTTTGCCCTCATCATGATGG + Intergenic
1019123894 6:169826204-169826226 GTGGCTTGTCAGGACCATGGTGG - Intergenic
1022651731 7:32283623-32283645 GTGGCTTGCCATCACCCTGAGGG + Intronic
1023556866 7:41432371-41432393 GTAGCCAGTTCTCACCATGATGG - Intergenic
1024556380 7:50606410-50606432 GTGGCTTCTCCTCTCCAGTATGG - Exonic
1025969274 7:66307093-66307115 GTGGCTTAACCTCACCATAATGG + Intronic
1028943537 7:96552104-96552126 GAAGCGTGGCCTCACCATGAAGG + Intronic
1032031449 7:128487048-128487070 GTGGCTAGTGCCCACCATAAGGG - Intronic
1038144278 8:24880081-24880103 GTGGGGAGTCCTCACCATCATGG + Intergenic
1042301544 8:67288006-67288028 GTGGCTTTTCCTCACAATCATGG + Exonic
1047830618 8:128625989-128626011 TTGGCTTGTCCCCACTATGCTGG - Intergenic
1048845693 8:138602240-138602262 GTCCCTTGTCCTCAGCATGCAGG - Intronic
1049682816 8:143927237-143927259 GCGGCTGGGCCTCACCTTGATGG + Exonic
1049775836 8:144404251-144404273 TTGGCTGGTCCTGACCAAGAGGG - Intronic
1052354409 9:27489449-27489471 GTGGCTTGAGCTCAAGATGAGGG - Intronic
1058754274 9:108070090-108070112 ATGGCTTTTCTTCTCCATGATGG - Intergenic
1060151652 9:121292728-121292750 GTCACTTGTCCTCACCCTGTTGG + Intronic
1061315844 9:129795323-129795345 AGGGCCTGTCCCCACCATGAAGG - Intergenic
1061752571 9:132790630-132790652 GTGGTTTTTCCTGACCATAAGGG - Intronic
1186073915 X:5855413-5855435 GTGGCTTTTCCTCTCCCTGATGG + Intronic
1188701751 X:33272925-33272947 GTGGATTTTAATCACCATGAGGG + Intronic
1190053568 X:47169618-47169640 GTGGCTTTGCCTCACCTGGAGGG + Intronic
1197704385 X:129623283-129623305 GTGTCTTGAACTCACCTTGAAGG + Intergenic
1200091447 X:153637995-153638017 ATGGCTTGTCCTCACGGTCACGG + Intergenic