ID: 906613264

View in Genome Browser
Species Human (GRCh38)
Location 1:47218151-47218173
Sequence GTCAGAGGAGAGATAGCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 359}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906613264_906613270 4 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613270 1:47218178-47218200 AAGGCAGAGCCTAGAGGGAGAGG 0: 1
1: 0
2: 5
3: 57
4: 535
906613264_906613275 21 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613275 1:47218195-47218217 GAGAGGGCTAGGGTGACTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
906613264_906613273 11 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613273 1:47218185-47218207 AGCCTAGAGGGAGAGGGCTAGGG 0: 1
1: 0
2: 1
3: 26
4: 272
906613264_906613272 10 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613272 1:47218184-47218206 GAGCCTAGAGGGAGAGGGCTAGG 0: 1
1: 0
2: 3
3: 37
4: 437
906613264_906613276 22 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613276 1:47218196-47218218 AGAGGGCTAGGGTGACTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 193
906613264_906613269 -1 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 126
906613264_906613271 5 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613271 1:47218179-47218201 AGGCAGAGCCTAGAGGGAGAGGG 0: 1
1: 0
2: 6
3: 69
4: 618
906613264_906613267 -2 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613267 1:47218172-47218194 ACCTCGAAGGCAGAGCCTAGAGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906613264 Original CRISPR GTCAGAGGAGAGATAGCCTG TGG (reversed) Exonic
900495533 1:2974349-2974371 GGGAGAGGAGAGCTGGCCTGTGG + Intergenic
901179473 1:7331287-7331309 TTCAGAGGAGAGCGAGCCTATGG + Intronic
902806419 1:18863888-18863910 GTCAGAGCTGAGAGAGCCTACGG + Intronic
903176561 1:21585070-21585092 GTCATGGTAGAGACAGCCTGTGG + Intergenic
903376643 1:22870537-22870559 GTCAGAGGAGAGCTTCTCTGAGG + Intronic
903969963 1:27112295-27112317 CTCAGAGTAGAGACAGACTGTGG - Intronic
905332337 1:37213842-37213864 GACAGGGGAGAGATAGCATTAGG + Intergenic
905365262 1:37447903-37447925 GTCAGAGGACAGAAAGGGTGGGG + Intergenic
905729749 1:40288879-40288901 CTGGGAGGAGAGAGAGCCTGAGG - Intronic
906613264 1:47218151-47218173 GTCAGAGGAGAGATAGCCTGTGG - Exonic
906995930 1:50794444-50794466 CTGGAAGGAGAGATAGCCTGAGG + Intronic
907447590 1:54518920-54518942 GACAGAGAATAGAAAGCCTGGGG + Intergenic
909935268 1:81543797-81543819 GGGAGAGGTGAGATAACCTGTGG - Intronic
910590679 1:88925713-88925735 GACAGAGGAGAGAGAGACAGAGG + Intergenic
913466341 1:119147124-119147146 GTGAGAGGAGAGAGAGGCAGGGG - Intergenic
914208154 1:145553445-145553467 GTCAGGGGAGGGATAGCATTAGG - Intergenic
914748536 1:150516354-150516376 GTCAGAGGAGAGGAGGACTGCGG + Intergenic
915154221 1:153861054-153861076 GGCAGAGGAGAGAAAGTGTGTGG + Intronic
915755365 1:158254579-158254601 GTCAGAATAGAGATATCGTGGGG + Exonic
915927350 1:160032701-160032723 GTCCGAGGATAGGTAGACTGGGG + Intergenic
916052848 1:161048317-161048339 GCCAGAGGAGATGGAGCCTGAGG - Exonic
917212452 1:172644409-172644431 GGCACAGGAAGGATAGCCTGGGG + Intergenic
917510282 1:175663895-175663917 CTCAGAGGAGATATTGACTGGGG + Intronic
917744628 1:177995731-177995753 GTCAGAGGATAGAGAGCATCAGG + Intergenic
917973741 1:180225399-180225421 CTCAGTGGAGAAAGAGCCTGGGG + Intergenic
918777342 1:188650747-188650769 GTGAGAGGAGAGATAGAATTGGG + Intergenic
918840330 1:189527607-189527629 AGCAGAGGAGTGATTGCCTGGGG - Intergenic
919924249 1:202184245-202184267 GTAATGGGAAAGATAGCCTGGGG + Intergenic
920573891 1:207041363-207041385 GTAAGAGGAGGGATAGCATTAGG - Intronic
921168820 1:212527281-212527303 GGCTGAGGAGAGATAGTTTGAGG + Intergenic
921502273 1:215919583-215919605 ATCAGAGGAGAGATGGAATGTGG + Intronic
921612433 1:217228208-217228230 GTCAAATGAAAGATTGCCTGGGG - Intergenic
921877781 1:220218600-220218622 GTCAGGGGAGGGATAGCATTAGG + Intronic
923721823 1:236473439-236473461 GTGAGCTGGGAGATAGCCTGGGG + Intronic
924109281 1:240681954-240681976 GTGGGAGGAGAGAGAGCATGAGG + Intergenic
924488881 1:244515131-244515153 GTCAGAGAAGAGATAGGCAAGGG - Intronic
924500005 1:244628649-244628671 CTAATAGGAGAGATGGCCTGAGG - Intronic
1063107864 10:3009260-3009282 TTCAGAGGACAGACAGCCTCTGG + Intergenic
1063795188 10:9506880-9506902 CTCAGAGGAGAGGTGGCTTGCGG + Intergenic
1067413346 10:46084461-46084483 GTAGGAGGAGAGAGAGCCTGCGG - Intergenic
1068942629 10:62694479-62694501 GTCTCAGGGGAGATAGACTGAGG - Intergenic
1069873863 10:71549666-71549688 AACAGAGGAGAGGCAGCCTGCGG + Intronic
1072282188 10:93876466-93876488 CACAGAGGAGGGAAAGCCTGTGG + Intergenic
1072698027 10:97618559-97618581 GTTAGAGGAGAGACTTCCTGAGG + Intronic
1074645656 10:115449311-115449333 ATCAGAGGAGAGCTTGGCTGGGG + Intronic
1074697161 10:116059801-116059823 CTCAGAGGAGAGTTAGCTGGAGG + Intronic
1076671004 10:132121099-132121121 GTCAGAGAAGAGGCAGGCTGGGG + Intronic
1078952812 11:16154141-16154163 GTCATAGCAAAGATAGCCTGAGG + Intronic
1080723819 11:34875035-34875057 GTCAGAGAGGAGATCGGCTGTGG + Intronic
1080743309 11:35085120-35085142 GACTGAGGAGAGACAGGCTGTGG + Intergenic
1081124577 11:39307341-39307363 ACAAGAGGAGAGATAGCCTTAGG - Intergenic
1081465097 11:43309131-43309153 ATCAGACCAGAGAGAGCCTGTGG - Intergenic
1081533771 11:43982879-43982901 GTCAGAGGAGCGGTGGGCTGCGG + Intergenic
1081793885 11:45806451-45806473 GTCATAGGAGAAAGAGCCTGGGG + Intronic
1081990577 11:47335236-47335258 GTCAGTGGTGACACAGCCTGTGG - Intronic
1084404047 11:68960818-68960840 GTCAGAGGAGGCAGAGGCTGCGG - Intergenic
1084729479 11:71064321-71064343 ATGGGAGGAGAGAGAGCCTGGGG + Intronic
1084858128 11:72001700-72001722 GGCAGAGGAGGTGTAGCCTGGGG + Intronic
1084906576 11:72353007-72353029 AACAGAGGACAGACAGCCTGAGG + Intronic
1085755420 11:79197672-79197694 TTCAGAGGAGAAATAACTTGGGG - Intronic
1085792917 11:79511320-79511342 GGCAGAGGAAAGAAAGCCTCGGG + Intergenic
1085876739 11:80416599-80416621 GGCATGGGTGAGATAGCCTGGGG - Intergenic
1086031938 11:82370434-82370456 GTCAGGGGAGGGATAGCATCAGG - Intergenic
1088748539 11:112824515-112824537 GTCAGAGAGGAGATAGCCATGGG + Intergenic
1090036804 11:123256292-123256314 GTGAGAGGATAGAAAGACTGGGG + Intergenic
1090358862 11:126158868-126158890 GGCACAGGAGAGACAGACTGGGG + Intergenic
1090846928 11:130537292-130537314 GACAGGGGAGAGAGAGCCTCAGG - Intergenic
1091013187 11:132025006-132025028 GTCAGTGGAGAGACATTCTGTGG - Intronic
1091399264 12:172603-172625 GGCAGAGGAGAGAGAGCCTGGGG - Intronic
1093103576 12:15057499-15057521 GTCAGAAAAGTGATTGCCTGGGG - Intergenic
1093749246 12:22779618-22779640 GTCAGAGAGGAGATCGGCTGTGG - Intergenic
1095259715 12:40083915-40083937 ATCAGTGGAGAGACAGGCTGTGG + Intronic
1095495897 12:42783328-42783350 GTAAGAGGGGAGATGGGCTGAGG + Intergenic
1097349629 12:58534425-58534447 GCCAGAGGAGAGAAATTCTGAGG + Intergenic
1098192203 12:67961216-67961238 GTCAGAGGAGCCATATCATGTGG + Intergenic
1098348185 12:69528137-69528159 GTCTTAAGAGAGATAGCCAGGGG - Intronic
1098667588 12:73183250-73183272 GTCAGGGGAGGGAAAGCATGAGG - Intergenic
1099120248 12:78680697-78680719 GTCAGAGAAGAGAGAGCCCAAGG + Intergenic
1099704980 12:86140519-86140541 GTTAGAGGAGGGATAGCATTAGG + Intronic
1099734131 12:86545457-86545479 TTTAGAAGAGACATAGCCTGTGG - Intronic
1100616727 12:96236705-96236727 GGCAGAGGAGGCACAGCCTGGGG - Intronic
1101049500 12:100846722-100846744 GTGGCAGGAGAGATAGCCAGGGG - Intronic
1105026530 12:132852922-132852944 GTCAGAGGAGAGCTGGGCAGGGG - Intronic
1106110981 13:26776749-26776771 GCTAGAGGAGGGATAGCATGAGG - Intergenic
1106413229 13:29525283-29525305 GGCACAGGACAGAAAGCCTGCGG - Intronic
1107175264 13:37392363-37392385 GACAGAAGAGAGATGGGCTGAGG + Intergenic
1107831656 13:44379646-44379668 GCAAGAGGAGAAATATCCTGTGG + Exonic
1108119349 13:47166451-47166473 ATCAGAAGAGTGATTGCCTGTGG + Intergenic
1108233142 13:48371256-48371278 GTCAGTGGGGGGATAGACTGAGG + Intronic
1108998863 13:56769217-56769239 GACAGAGGAGGGATAGCATTAGG + Intergenic
1110331458 13:74277983-74278005 GTAGGAGGAGAGATAGGTTGGGG + Intergenic
1110425031 13:75357446-75357468 GTTATAGGAGAGAAAGCCAGAGG - Intronic
1111257874 13:85696514-85696536 GTTAGAGGAGGGATAGCATTAGG - Intergenic
1112221727 13:97498083-97498105 GGCAGAGGACAGAAAGGCTGTGG - Intergenic
1112846680 13:103651981-103652003 GACAGAGGAGAGAGAGTCTCTGG - Intergenic
1113871980 13:113565185-113565207 GTCTGAGGGGAGAGAGTCTGCGG - Intergenic
1113872023 13:113565373-113565395 GTCTGAGGGGAGAGAGTCTGCGG - Intergenic
1114381263 14:22206855-22206877 GGCAGACTAGAGATTGCCTGGGG + Intergenic
1114902026 14:27073645-27073667 GTGTGAGGAGAGAAAGCCTAAGG - Intergenic
1115017582 14:28635796-28635818 GTCAGGGGAGGGATAGCATTAGG - Intergenic
1115294818 14:31813666-31813688 GCCAGGGGAGAGATAGCATTAGG - Intronic
1115962454 14:38850980-38851002 GTCAGAAGAGAGGTGGGCTGAGG + Intergenic
1116095657 14:40363782-40363804 TTCAGAGGTGAGCTTGCCTGTGG + Intergenic
1117411973 14:55458344-55458366 CTCAGAGGACAGAAAGGCTGAGG - Intergenic
1117722023 14:58637845-58637867 GACAGAGGAGGGGAAGCCTGGGG + Intronic
1118468799 14:66055947-66055969 GTGAGAGGACAGATAGGTTGGGG + Intergenic
1118663915 14:68045941-68045963 GTCGAAGGAGAGAAAGACTGAGG - Intronic
1119928124 14:78516386-78516408 AGCAGAGGAGAGATTGGCTGTGG + Intronic
1121514193 14:94538411-94538433 CTCAGAGGAGGGTCAGCCTGGGG + Intergenic
1121966622 14:98312982-98313004 GTTAGGGGAGAGATAGCATTAGG - Intergenic
1122317174 14:100832933-100832955 GTCAGAGGAGAGCTAGAGTTGGG - Intergenic
1124151342 15:27181247-27181269 GTTTGATGAGAGACAGCCTGGGG - Intronic
1124513920 15:30350184-30350206 GTCAGAGGGGTGATCGTCTGAGG - Intergenic
1124729001 15:32180581-32180603 GTCAGAGGGGTGATCGTCTGAGG + Intergenic
1126249670 15:46552915-46552937 TTTAGAGGAGAGATGGGCTGAGG - Intergenic
1126309707 15:47301648-47301670 GTCAGTGCAGAGAAAGGCTGTGG - Intronic
1128546983 15:68574999-68575021 CTCAGAGGTGGGGTAGCCTGAGG - Intergenic
1129386805 15:75200934-75200956 GTCAGAGCAGAGCAGGCCTGAGG - Intronic
1129923136 15:79337769-79337791 GTCAGAGGGGAGAGACCATGTGG - Intronic
1129935783 15:79449249-79449271 GTTAGAGCAGAGCAAGCCTGAGG - Intronic
1131109323 15:89754951-89754973 CCCAGAGCAGAGACAGCCTGAGG - Intergenic
1131472535 15:92709402-92709424 TTGGGAGGAGAGAGAGCCTGGGG - Intronic
1134873249 16:17671586-17671608 GTTAGGGGAGAGATAGCATTAGG - Intergenic
1136345393 16:29672212-29672234 GTCAGAGGAGAGATAGGGCCAGG - Intronic
1136882116 16:33908409-33908431 GTCAGACGGGAGATAGGCTTAGG + Intergenic
1138949855 16:61899108-61899130 GCCAGAGGAGGGATAGCGTTAGG - Intronic
1142271052 16:89089418-89089440 CTCAGAGGAGAGGTGCCCTGGGG - Intronic
1203089893 16_KI270728v1_random:1207037-1207059 GTCAGACGGGAGATAGGCTTAGG - Intergenic
1142479361 17:208655-208677 GGCAGAGAAAAGACAGCCTGTGG - Intergenic
1142567271 17:848829-848851 GTCTGAGGACAGATCGCCAGGGG + Intronic
1144141445 17:12352494-12352516 GACAGAGGTGAGTTAACCTGGGG - Intergenic
1145297330 17:21601823-21601845 GCCAGAGGAGAGATGGGCAGAGG + Intergenic
1145366627 17:22271078-22271100 GCCAGAGGAGAGATGGGCAGAGG - Intergenic
1145939511 17:28735250-28735272 CTCAGGGGAGATATAGCATGGGG - Exonic
1146941659 17:36847654-36847676 GACAGAGGAGGGACAGCCAGCGG - Intergenic
1148091792 17:45026839-45026861 GTGAGATTAGAGATGGCCTGGGG + Intronic
1148549534 17:48542304-48542326 GTGAAAGGAGAGGAAGCCTGTGG - Intronic
1148618038 17:49014586-49014608 GTCAGGGGAGAGACTGGCTGAGG + Intronic
1149277669 17:55062219-55062241 GTGAGAGGAGGGATAGCATTAGG - Intronic
1150160146 17:62890694-62890716 CTCAGAGGCCAGATACCCTGGGG + Intergenic
1150882011 17:69040565-69040587 GCAAGAGGAGAGATAGCATTAGG + Intronic
1151846496 17:76659580-76659602 GTCAGAGAAGAGGCAGACTGGGG - Intergenic
1152038494 17:77888180-77888202 GTCAGATGAGAAAACGCCTGGGG + Intergenic
1153453891 18:5259712-5259734 GGCAGAGGAGACTTACCCTGTGG - Intergenic
1153456270 18:5285780-5285802 GTCACAGGAGAGATAGTCAAGGG - Intergenic
1155426362 18:25711674-25711696 CTCAGAGGAGGGAGAGCTTGTGG - Intergenic
1155432729 18:25777794-25777816 GTGAGGGGAGAGATAGCATTAGG + Intergenic
1156110552 18:33720789-33720811 CTCAGAAGAGATGTAGCCTGTGG - Intronic
1156795054 18:41034693-41034715 GTCAGCTGAGAGCTAGGCTGGGG + Intergenic
1157429791 18:47615298-47615320 GTGAGAGGAGAGAGAGGTTGGGG - Intergenic
1158522437 18:58182955-58182977 GTCATAGGAGACCTGGCCTGAGG + Intronic
1158963376 18:62604241-62604263 GGCAGGGGAGAGATGGGCTGAGG + Intergenic
1159691284 18:71491613-71491635 GTCAGAGTAGTCATAGTCTGTGG - Intergenic
1160125624 18:76169175-76169197 GTCACAGGAAAGACAGCCAGAGG + Intergenic
1161286543 19:3471309-3471331 GTCAGAGGGGAGGGAGGCTGGGG + Intergenic
1161912981 19:7208333-7208355 GCCAGAGGGAAGATAGGCTGAGG - Intronic
1162154079 19:8664757-8664779 GTCAGAGGAAAGCCAGCTTGGGG + Intergenic
1163420116 19:17209679-17209701 GTCGCAGGAGCGAAAGCCTGCGG - Exonic
1165044211 19:33091902-33091924 GACTGAGAAGAGAGAGCCTGGGG - Intronic
1165426804 19:35750361-35750383 CTCAGAGGAGAGACAGAGTGAGG - Intronic
1165432512 19:35780789-35780811 GTCAGAGACGAGATACCCTGGGG - Exonic
1165559475 19:36666871-36666893 GTCCGAGGGGAGAGCGCCTGGGG + Intergenic
1165663344 19:37602610-37602632 GCCAGAGGAGAAAGAGACTGAGG + Intronic
1166204863 19:41263138-41263160 GTCTGAGTAGAGATAGTGTGTGG + Intronic
1166531606 19:43546458-43546480 GTCTGAGGGAAGAGAGCCTGGGG - Intronic
1166546482 19:43637101-43637123 GGCAGAGGAGAGAAAGCAAGAGG - Intronic
1167322297 19:48804716-48804738 GTGAGAGCAGAGGAAGCCTGTGG - Intronic
1167415830 19:49371748-49371770 GTCAGGGGAGGGATAGCATCAGG - Intronic
1167627484 19:50602122-50602144 GTGAGAGGAGACAGAGCCAGGGG - Intergenic
1168008368 19:53509399-53509421 GTCGGTGCAGAGATACCCTGAGG + Intergenic
1168179360 19:54650378-54650400 GTGAGAGGAGAGAGAGGCCGGGG + Intronic
1168179883 19:54654720-54654742 GTGAGAGGAGAGAGAGGCCGGGG + Intronic
925905116 2:8535514-8535536 GTCAGAGCAGAGATCCTCTGGGG - Intergenic
928080778 2:28310391-28310413 GCCTGGGGAGAGATGGCCTGAGG - Intronic
928102464 2:28447212-28447234 GTCACAGGGGAGAGAGCCAGGGG + Intergenic
928278206 2:29921226-29921248 CGCAGCGGAGAGATAGCTTGAGG - Exonic
928844960 2:35660243-35660265 GTCTGAGGAGAGAAAGAATGAGG - Intergenic
929291324 2:40195361-40195383 CTCAGAGGAGAGCTAGGCTCAGG + Intronic
929609984 2:43263871-43263893 GTGAGAGGAGGGAGAGCATGAGG - Intronic
929996064 2:46826910-46826932 GTCAGACGAGAGACACCATGAGG + Intronic
930837115 2:55806073-55806095 GTCATAGAAGATAAAGCCTGCGG - Intergenic
932654301 2:73595339-73595361 GGCAGATGAGAGGTTGCCTGGGG - Intronic
933103946 2:78297410-78297432 GTGAGAAGAGAGAAAACCTGAGG - Intergenic
933139666 2:78778201-78778223 GTTAGATGAGGGATGGCCTGTGG - Intergenic
933668699 2:84986350-84986372 GTCAGAGAAGAGATTTCCTTAGG + Intronic
936856145 2:116959454-116959476 GAAAGTGGAGAGATGGCCTGAGG - Intergenic
937452411 2:122012447-122012469 ATCTGAGGAGTGATAGCATGGGG + Intergenic
939860895 2:147418824-147418846 ATCAGAAGGGAGAAAGCCTGGGG + Intergenic
940420041 2:153470324-153470346 GTGAGAGGAGAGAGAACATGGGG - Intergenic
940688293 2:156882068-156882090 GTTAGAGGAGGGATAGCATTAGG - Intergenic
940885591 2:158986980-158987002 GAGTGAGGAGTGATAGCCTGAGG + Intronic
941978974 2:171434318-171434340 GTCAGCGGCCAGAGAGCCTGGGG + Exonic
943509145 2:188802754-188802776 GTCTGAGGAGATAAACCCTGTGG + Intergenic
943669929 2:190649267-190649289 GCCAGAGGAGGGAGAGCCGGGGG + Exonic
943746045 2:191463689-191463711 GTCAGAGCAGAGTTTGGCTGGGG - Intergenic
944535506 2:200705681-200705703 GGCAGAGGAGAGATGGCTTGTGG - Intergenic
945831014 2:214784887-214784909 GTCAGGGGAGGGATAGCATTAGG + Intronic
945920348 2:215749221-215749243 ATCTGAGGAGAGTTAGCCTCAGG + Intergenic
946516630 2:220418783-220418805 CTCACAGGAACGATAGCCTGAGG - Intergenic
947440059 2:230112189-230112211 GTAAGGGGAGAGATAGCATTAGG - Intergenic
947819925 2:233062428-233062450 GACAGAGGGCAGAGAGCCTGAGG + Intronic
948129045 2:235586753-235586775 ATCAGAGGAAACATAGTCTGGGG + Intronic
948308709 2:236969208-236969230 GGCAGAGGAGACATGCCCTGAGG + Intergenic
1168770150 20:409210-409232 GACTGAGGACAGATATCCTGTGG - Intronic
1169019235 20:2316689-2316711 GTGACAGCAGTGATAGCCTGTGG + Intronic
1170059104 20:12240767-12240789 GTAAGGGGAGAGATAGCATGAGG + Intergenic
1170349390 20:15422314-15422336 ATTAGAGGAGAGAAAGCGTGTGG + Intronic
1172181695 20:33007705-33007727 GGCAGAGGAGGGCTACCCTGGGG + Exonic
1173722912 20:45275581-45275603 GTTAAATGAGAGATAGCATGTGG - Intergenic
1174767133 20:53265059-53265081 GTCAGGGGAGACACAGCTTGGGG + Intronic
1175630554 20:60531983-60532005 GTCAGGGGAGGGATAGCATTAGG + Intergenic
1176137754 20:63531930-63531952 GTCTGAGGAGAGCTACACTGAGG - Intronic
1176411136 21:6450224-6450246 GTCAGGGGAGAGATGCCCCGAGG - Intergenic
1176940761 21:14921869-14921891 GTGAGAGGAGAGAAAGAATGAGG - Intergenic
1178424088 21:32465307-32465329 GTGAGAGGAGTGAGAGGCTGGGG + Intronic
1179075352 21:38115301-38115323 GTCACAGGTGTGATAGGCTGGGG - Intronic
1179503513 21:41824603-41824625 GTCAGTGGACAGAAAGACTGGGG + Intronic
1179512321 21:41881233-41881255 GTAATAGGAGAAATGGCCTGGGG - Intergenic
1179686629 21:43058546-43058568 GTCAGGGGAGAGATGCCCCGAGG - Intronic
1179898814 21:44378311-44378333 GTACGAGGACATATAGCCTGAGG + Intronic
1180695669 22:17750082-17750104 GTCAGAGGCCAGATCCCCTGCGG - Intronic
1180891204 22:19290893-19290915 GGCAGAGGAGGGATAGCCAGCGG - Intronic
1184279109 22:43427028-43427050 GTCAGAGGTGACTGAGCCTGAGG + Intronic
1185086306 22:48742778-48742800 AGAAGAGGAGAGATGGCCTGGGG + Intronic
949518660 3:4829877-4829899 GTAAGATCAGAGACAGCCTGAGG - Intronic
950253264 3:11484680-11484702 GTCAGGGGAGGGATAGCTTTAGG - Intronic
950669697 3:14518624-14518646 GCAAGAGGAGAGCTGGCCTGGGG - Intronic
950694800 3:14690696-14690718 CTCAGAGGAGAGACAGGCTGGGG + Intronic
950715447 3:14844485-14844507 GGCAGAGGAGAAATAGCCTTGGG + Intronic
950924066 3:16722638-16722660 GTGGTAGGAGAGAGAGCCTGGGG + Intergenic
951089427 3:18555064-18555086 GACAGAGGAAAGGTAGCCTCTGG + Intergenic
951424508 3:22528196-22528218 GTGAGAGGAGGGATAGCATTAGG - Intergenic
952567928 3:34680814-34680836 TTCAGAGGAGAGTGAGCCTCAGG + Intergenic
952707175 3:36391267-36391289 GGCAGAGGACAGATTGCCAGTGG - Intronic
952945598 3:38476411-38476433 GGCAGAGGAGAGCTAGCTGGTGG - Intronic
954624808 3:52016623-52016645 GACAGAGGGGATAGAGCCTGAGG + Intergenic
954901395 3:54022978-54023000 GTCAAAGGAGAGACAGGGTGAGG + Intergenic
955229990 3:57090223-57090245 GTCCTAGGGGAGAAAGCCTGTGG - Exonic
955487986 3:59454107-59454129 GGCAGAAGAGAGATAGACAGAGG + Intergenic
957141536 3:76365124-76365146 GTGAGAAGAGAGAGAGCCTGTGG + Intronic
957803829 3:85120688-85120710 GCCAGGGGAGGGATAGCCTTAGG + Intronic
958718691 3:97819653-97819675 GCCAGAGGAGATATATTCTGTGG - Intergenic
959217192 3:103466196-103466218 GTCAGAGCAGATATACACTGGGG + Intergenic
960338703 3:116448451-116448473 GTAAGAGCAGAGATACTCTGAGG + Intronic
961178390 3:124855372-124855394 GTCAGGGGGGAGATACCCTGAGG + Intronic
962030950 3:131599837-131599859 GTCTGTGGAGACAGAGCCTGGGG - Intronic
963045604 3:141100765-141100787 GGGAGAGGAGAGAGAGCCTGTGG + Intronic
964245714 3:154650229-154650251 GCTAGAGGAGAGATAGCATTAGG + Intergenic
964477430 3:157109675-157109697 GCCTGAGGACAGATAACCTGAGG - Intergenic
964531618 3:157673959-157673981 GCCAGGGGAGAGATAGCATTAGG + Intronic
965176866 3:165346163-165346185 GTCAGATGACAGATATCCTCAGG - Intergenic
966309961 3:178582371-178582393 GTTAGGGGAGGGATAGCCTTAGG + Intronic
966847923 3:184144852-184144874 AGCAGAGGAGAGATCGGCTGGGG - Intronic
967432687 3:189405244-189405266 GTGAGAGGTGAGACATCCTGAGG + Intergenic
967552277 3:190810402-190810424 GTCAAAGAAGAGATAACCTAGGG - Intergenic
967722396 3:192829090-192829112 ATCAGAACAGAGATTGCCTGGGG - Intronic
967893615 3:194380743-194380765 GTCAGAGCAGAGTAAGTCTGGGG - Intergenic
968127912 3:196173826-196173848 GTCAAAGGAGAGAAAGTCTGGGG - Intergenic
968159010 3:196409783-196409805 GTCACAGGAAAGAAAGCTTGGGG - Intronic
968671262 4:1853015-1853037 GTCAGGGAAGAGATTGCCTGGGG - Intronic
969542188 4:7799442-7799464 GGCAGAGGAGAGAGTGCCTGGGG - Intronic
970907518 4:21233510-21233532 TTCAGAAGAGAGAGAGGCTGAGG + Intronic
972367542 4:38390561-38390583 GGCAAAGGGGAGACAGCCTGGGG - Intergenic
972779302 4:42272168-42272190 GTAAGAGGGGTGAGAGCCTGTGG - Intergenic
973638881 4:52884433-52884455 GCCAGAGGTCAGAGAGCCTGGGG - Intronic
974455306 4:62123137-62123159 GTTAGGGGAGAGATAGCATTAGG - Intergenic
975498962 4:75063703-75063725 GGCAGAACACAGATAGCCTGAGG - Intergenic
975902636 4:79170729-79170751 GGAAAAGGAGAGAAAGCCTGAGG - Intergenic
975964245 4:79950858-79950880 GGGAGAGGAGAGAGAACCTGAGG - Intronic
976914691 4:90357513-90357535 GTCAGAGGAGAGATACTCTTGGG + Intronic
977238364 4:94536198-94536220 GACTGAGGAGAGACAGCATGAGG + Intronic
980006139 4:127544503-127544525 GTCAGAGAGGAGATTGGCTGTGG + Intergenic
981013831 4:139952837-139952859 GTGAGAAAAGAGATAGCCTAGGG - Intronic
982097590 4:151936908-151936930 GGCAGGGGAGAGAAATCCTGAGG - Intergenic
982884389 4:160759943-160759965 GTCAGGGGAGGGATAGCATTAGG + Intergenic
983298437 4:165896063-165896085 GTTAGAGGAGGGATAGCATTCGG - Intronic
984270053 4:177538444-177538466 GTTAGAGGAGGGATAGCATTAGG + Intergenic
985491037 5:179622-179644 GTCAGAGCATAGCTGGCCTGGGG - Intronic
985563839 5:605365-605387 GTGAGAGGAGAGCAAGCCAGAGG + Intergenic
985563848 5:605406-605428 GTGAGAGGAGAGCAAGCCAGAGG + Intergenic
985563864 5:605488-605510 GTGAGAGGAGAGCAAGCCAGAGG + Intergenic
985563880 5:605570-605592 GTGAGAGGAGAGCAAGCCAGAGG + Intergenic
986145956 5:5078082-5078104 GACAGAGGAGAGCTTTCCTGAGG - Intergenic
986216506 5:5724443-5724465 GTAAGAGGAGAGTCAGCTTGGGG - Intergenic
986967680 5:13294986-13295008 TGCAGTGGAGAGATATCCTGCGG - Intergenic
987537554 5:19208075-19208097 GTCAGAGGAGAGAGAGATAGGGG + Intergenic
988417992 5:30970279-30970301 GTCAAAGAAAAGATATCCTGGGG + Intergenic
988483548 5:31649269-31649291 GTCATAGGAGAGGTGGACTGGGG - Intronic
988511001 5:31864747-31864769 GTCTGAGGTGAGATCACCTGAGG - Intronic
989114056 5:37934839-37934861 GACAGAGGAGAAAGACCCTGGGG + Intergenic
989506262 5:42230360-42230382 GTCAGGGGATACATAGCCTATGG - Intergenic
991258047 5:64637234-64637256 GTCAGACGTGACATGGCCTGTGG + Intergenic
994151475 5:96452503-96452525 GCCAGTGGAGAGATAGCATTAGG + Intergenic
995017956 5:107333302-107333324 GCTAGAGGAGAGATAGCATTAGG - Intergenic
996569519 5:124917170-124917192 GCTAGAGGAGAGATAGCATTAGG + Intergenic
996585879 5:125088027-125088049 GTCAAAGCAGAAACAGCCTGAGG + Intergenic
998292307 5:140926996-140927018 GTCCGCGGAGAGATTGCCTACGG - Exonic
998717975 5:144907582-144907604 ATTAGAGGAGAGATAGCATTAGG + Intergenic
998750760 5:145318983-145319005 GTCAGAGAGGAGATCGGCTGTGG - Intergenic
1001101718 5:168819781-168819803 TTAAGAAGAGAGATAGCTTGGGG - Intronic
1001801541 5:174548627-174548649 TTCAGAGGGGAGATTTCCTGGGG - Intergenic
1002302941 5:178267870-178267892 GCCACAGGAGAGATTGCATGAGG - Intronic
1003461405 6:6332037-6332059 GTGAGAAGAAAGATAGCCTTTGG - Intergenic
1003687867 6:8322700-8322722 GTCAGAGAAGAGATCGGCTGTGG - Intergenic
1005025375 6:21458052-21458074 GCAAGAGGAGAGATTTCCTGGGG - Intergenic
1006298149 6:33179130-33179152 GTGAGAGGAGAGATGGGGTGGGG + Intronic
1006358522 6:33574489-33574511 GTCAGCGGGGAGATTACCTGTGG + Intronic
1007115151 6:39338180-39338202 TTCAGTGGACAGAGAGCCTGAGG + Intronic
1007612415 6:43159022-43159044 GGCAGAGGACAGATAGTTTGGGG + Intronic
1007627944 6:43257041-43257063 GTAGGAGTAGAGACAGCCTGAGG + Intronic
1011234423 6:85200552-85200574 GCTAGAGGAGAGATAGCATTAGG - Intergenic
1011551862 6:88537545-88537567 GACTGAGGAGGGAGAGCCTGGGG + Intergenic
1012172862 6:96041092-96041114 GTCACAGGAGAGAAAAACTGGGG - Intronic
1012993112 6:105946457-105946479 GAGAGAGGAGAGATAGGGTGGGG - Intergenic
1015512028 6:134047620-134047642 TTCACAGGAAAGATACCCTGTGG + Intronic
1016510424 6:144836572-144836594 GGCAGTGGACAGATGGCCTGGGG - Intronic
1018348407 6:162927644-162927666 GTCAGAGGAGGGAGAGCATCAGG + Intronic
1022269805 7:28795210-28795232 CTTAGAGGAGATATAGCTTGGGG - Intronic
1022493918 7:30841203-30841225 GGCAGAGGGGAGATAGCGTGGGG - Intronic
1023278613 7:38547013-38547035 GTGGGAGGAGGGAGAGCCTGGGG + Intronic
1023651545 7:42374396-42374418 GAAAGAGGAGAGAGAGACTGAGG + Intergenic
1024037897 7:45524114-45524136 GGCAGGGGGGAGATAACCTGGGG - Intergenic
1027515348 7:79135706-79135728 GTGGGATGAGAGATAGCTTGAGG + Intronic
1028034731 7:85967173-85967195 GTTAGGGGAGAGATAGCATTAGG + Intergenic
1030933662 7:115557313-115557335 GCCAGGGGAGAGATAGCATTAGG - Intergenic
1030949475 7:115771468-115771490 GTCAGAGAAAAGATAAACTGCGG + Intergenic
1031859777 7:126965171-126965193 GTCAGAGGAGGGATAGCATTAGG + Intronic
1033767083 7:144505785-144505807 GTCAGAGAGGAGATTGGCTGTGG + Intronic
1033781668 7:144677900-144677922 GTCAGAGGGGAGAAAGCGCGTGG + Intronic
1034387964 7:150756241-150756263 GTCAGAGCACAGGTAACCTGAGG - Intergenic
1034424563 7:151007700-151007722 GCCAGAGGCCAGACAGCCTGGGG + Intronic
1035711815 8:1722943-1722965 GCTAGAGGAGAGATAGCATTAGG + Intergenic
1035790706 8:2302091-2302113 GAGAGAGGAGAGATAGCATTGGG - Intergenic
1035802099 8:2419614-2419636 GAGAGAGGAGAGATAGCATTGGG + Intergenic
1036409220 8:8483378-8483400 GTCAAAGGAGACATGGCCAGAGG + Intergenic
1038697883 8:29822201-29822223 GACAGATGAGAGATTCCCTGCGG + Intergenic
1038770270 8:30472376-30472398 ATCAGAGCAGTGATTGCCTGGGG + Intronic
1040360085 8:46656816-46656838 GCTAGAGGAGAGATAGCATTAGG + Intergenic
1040403218 8:47073981-47074003 GTTAGAGGAGGGATAGCATTAGG + Intergenic
1040545088 8:48392888-48392910 GTCAGAGGAGAGAGAATCAGAGG + Intergenic
1040941971 8:52843544-52843566 GGCAGAGCAGAGAGAGACTGGGG - Intergenic
1041116812 8:54547971-54547993 GTGAGAGGAGAGAGAGGATGAGG + Intergenic
1042601451 8:70503251-70503273 GTCAGAGAGGAGATCGGCTGTGG - Intergenic
1043176434 8:77028096-77028118 GTGGAAGGAGAAATAGCCTGAGG + Intergenic
1044324251 8:90842044-90842066 GTGAGAGGAGAAAGAGCATGAGG + Intronic
1045188738 8:99863087-99863109 TTCAGAGGAGAACTTGCCTGAGG - Intronic
1046932086 8:119851750-119851772 GTTAGATGAGAAATAGGCTGGGG - Intronic
1047049046 8:121089132-121089154 CTAAGAGAAGAGTTAGCCTGAGG + Intergenic
1047071898 8:121354466-121354488 GTCAGAGAGGAGAGATCCTGAGG + Intergenic
1047265134 8:123300202-123300224 GTAAAAGGAGAGAGACCCTGAGG + Intergenic
1047433060 8:124809309-124809331 TTCAGAGCAGAGAAGGCCTGAGG - Intergenic
1050803968 9:9650637-9650659 GTGAGAGGAGAGATAGTATCAGG + Intronic
1052052158 9:23860740-23860762 GTCAGGGGAGGGATAGCATTAGG - Intergenic
1052357162 9:27516975-27516997 ACCAGCTGAGAGATAGCCTGTGG - Intronic
1052861824 9:33442253-33442275 GGCAGAGGAGAGGCAGGCTGGGG + Intronic
1053011910 9:34638274-34638296 CTCCGAGGAGAGACAGCTTGGGG + Intronic
1054809735 9:69425372-69425394 GGCAGGGGAGAGACAGCCAGGGG + Intergenic
1054980161 9:71196998-71197020 GTCGGGGGAGAGATAGCATTGGG - Intronic
1055148270 9:72962377-72962399 GTTAGGGGAGAGATAGCATTAGG + Intronic
1055278223 9:74643498-74643520 GTCAGAAGAGAGCTTGCCTAAGG - Intronic
1056399552 9:86213237-86213259 GGCACAAGAGAGATAGCCTCTGG - Intergenic
1056691312 9:88810925-88810947 GTCTAAGGAGAGAAAGCCTGAGG - Intergenic
1056691334 9:88811030-88811052 ATCTAAGGAGAGAAAGCCTGAGG - Intergenic
1056724730 9:89104738-89104760 GTGAGAGGATAGATAAACTGAGG - Intronic
1057074903 9:92133484-92133506 GTAATGGGAAAGATAGCCTGGGG + Intergenic
1057992845 9:99790179-99790201 GTCAGGGGAGAGAAAGCATCAGG - Intergenic
1058038219 9:100276385-100276407 GCCAGAAGAGAGACAGACTGTGG - Intronic
1061149544 9:128821041-128821063 GGCAGAGGAGAGATGGTCAGGGG - Exonic
1185551436 X:985319-985341 GTCAGCTGAGAGAAAGCATGAGG - Intergenic
1185619193 X:1442955-1442977 GTCAGAGGGGAGATGGTCAGAGG - Intronic
1185937426 X:4274684-4274706 GTCAGAAGTGAGAGAGTCTGGGG - Intergenic
1186193228 X:7086560-7086582 ATCAGAAGAGGGATAGCCTGAGG - Intronic
1186540993 X:10399745-10399767 GTCAGAGGAGTGAAATCCTATGG - Intergenic
1189451905 X:41142404-41142426 GGCCGAGGAGAGATTGCTTGAGG + Intronic
1190154338 X:47975726-47975748 GTCTGAGGAGAAACAGGCTGGGG - Exonic
1190220444 X:48509219-48509241 GTGGTAGGAGACATAGCCTGAGG - Intronic
1190577211 X:51852205-51852227 GTCAGAGGAGAGATGGCAACGGG - Intronic
1191220184 X:57979756-57979778 GACAGGGGAGGGATAGCATGTGG - Intergenic
1192370181 X:70506586-70506608 GAGACAGGAGAGAAAGCCTGGGG - Intergenic
1192707898 X:73546452-73546474 GTCAGGGGAGGGATAGCATTAGG + Intergenic
1196941964 X:120785859-120785881 ATCACAGTATAGATAGCCTGGGG + Intergenic
1201245331 Y:11997713-11997735 GAGAGAGGAGAGATAGCATTAGG - Intergenic