ID: 906613269

View in Genome Browser
Species Human (GRCh38)
Location 1:47218173-47218195
Sequence CCTCGAAGGCAGAGCCTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906613264_906613269 -1 Left 906613264 1:47218151-47218173 CCACAGGCTATCTCTCCTCTGAC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906613269 Original CRISPR CCTCGAAGGCAGAGCCTAGA GGG Exonic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
902274005 1:15326205-15326227 ACTCCAAAGCAGAGCCTTGAAGG - Intronic
902345222 1:15811734-15811756 GCTCCAAGGAAGTGCCTAGATGG - Intergenic
902773229 1:18658293-18658315 CCTCGAAGACACAGCCAGGATGG - Intronic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905028528 1:34866688-34866710 CATCGACGGCAGAGCCTTGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
919438732 1:197599219-197599241 CCAGGAAGGCAGAGCATAAAAGG + Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1072392295 10:94999760-94999782 TCTCAGAGACAGAGCCTAGAAGG - Intergenic
1073466238 10:103696072-103696094 AGTAGAAGGCAGAGCCCAGAGGG + Intronic
1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG + Intergenic
1077776432 11:5277051-5277073 CTCCGCAGGCAGAGCCTTGATGG - Intronic
1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG + Intronic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1095086609 12:38063026-38063048 GCTCTAAGACAGAGCCCAGAGGG - Intergenic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG + Intergenic
1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG + Intronic
1103926479 12:124426326-124426348 GGTCGAAGGCAGAGCATGGAAGG + Intronic
1108635990 13:52334505-52334527 ACTGGAAGCCAGAGCCTAAATGG - Intergenic
1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG + Intergenic
1112353994 13:98659586-98659608 CCTTGAAGGAAGAGCTGAGAAGG + Intergenic
1114770212 14:25422155-25422177 CTTCGAAGGCTGAGGCCAGAGGG - Intergenic
1114933636 14:27506711-27506733 CATTGAAGTCAGAGCCTTGAGGG - Intergenic
1116512987 14:45769750-45769772 CCTCAAAGGAAGAGCTTACAGGG + Intergenic
1118055856 14:62078889-62078911 CCCCTAAGGCACAGCCTATATGG - Intronic
1119126384 14:72130987-72131009 TCCCCAAGGCAGAGCCTAGCAGG - Intronic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1128684764 15:69675648-69675670 CCTGAAAGGCAGAGCCTCGCAGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG + Intronic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1135465604 16:22682033-22682055 CCTCGAGGGCAAGGCCTAGGCGG + Intergenic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1138241161 16:55428215-55428237 TCTTGAAGGCAGAGCCTTTATGG - Intronic
1140929285 16:79611993-79612015 CCTCTAAGGCAGTGCCTAAGGGG - Intergenic
1147919273 17:43906434-43906456 TCTCGGAGGCAGAGCTGAGAGGG - Intronic
1147992545 17:44343936-44343958 CCTCGAAGGCAGGGCCGATCTGG + Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1157186996 18:45549220-45549242 CACCGAAGGCAGAGCATTGATGG - Intronic
1158221106 18:55151675-55151697 CCCCAAAGTCAGAGACTAGATGG + Intergenic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG + Intronic
1164639409 19:29812830-29812852 CCCCGTAGGCAGAGCCAAGTCGG - Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
926227498 2:10978753-10978775 AATCCAAGGCAGAGCCAAGAAGG + Intergenic
926888815 2:17621733-17621755 CCCAGAAGGCAGAGACAAGAGGG - Intronic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932380581 2:71278035-71278057 CCTAGAAACCAGAGCCAAGAAGG - Intronic
932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG + Intergenic
934760460 2:96852937-96852959 CCTCAAAGGACGGGCCTAGAAGG + Intronic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
938086857 2:128407484-128407506 CCCTGAAAGCAGGGCCTAGAAGG + Intergenic
942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG + Intergenic
943255831 2:185591890-185591912 CCTAGAAGGAGGAGCCAAGATGG - Intergenic
945027069 2:205629682-205629704 ACTCAAAGGCACAGCCCAGAGGG - Intergenic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1173494203 20:43507392-43507414 GCTCGAAGAGAGAGCCTGGAGGG - Intergenic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174830680 20:53809325-53809347 TCTCAAAGGTAGAACCTAGAAGG - Intergenic
1175400574 20:58697884-58697906 ACTCGAAGGCAGGGCAGAGAGGG - Intronic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
953107139 3:39894292-39894314 TCTGGAAGGCAGTGGCTAGATGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
958468773 3:94492495-94492517 CCCCAAAAGCAGTGCCTAGAGGG + Intergenic
968920655 4:3520832-3520854 CCACGTGGGCAGATCCTAGAGGG - Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
991192684 5:63894212-63894234 CCACAAAGGGAAAGCCTAGAGGG - Intergenic
993487697 5:88506690-88506712 CCTCAAAGCCAAAGCCTAAAGGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1007694001 6:43720109-43720131 CATCAAAGGCAGAGCGCAGAGGG + Intergenic
1011928051 6:92672785-92672807 CAGCCAAGGTAGAGCCTAGAGGG + Intergenic
1020381895 7:7556709-7556731 CAGCTGAGGCAGAGCCTAGACGG + Intergenic
1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG + Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1029435962 7:100564210-100564232 CCCCGAAGGAAGAGCCTAGGGGG - Exonic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG + Intergenic
1036382920 8:8250380-8250402 CCTCAAATTCAGTGCCTAGAAGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG + Intronic
1043457221 8:80424706-80424728 GCTGGAAAGCAAAGCCTAGAAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049500194 8:142958933-142958955 CCCCGAAGGCAGAGACCAAAAGG - Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1060342963 9:122792976-122792998 CCTTGAAGGGAGAGTGTAGAGGG - Intergenic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060656636 9:125376620-125376642 GCTCGCAGGCAGGGCCCAGAGGG + Intergenic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061884495 9:133584788-133584810 CCTCGGAGGCAGAGCCATGCGGG + Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1193265607 X:79464574-79464596 CATCGAAGCCTGAGCCTAGAGGG - Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic