ID: 906613830

View in Genome Browser
Species Human (GRCh38)
Location 1:47221729-47221751
Sequence CACTGCCCATTTTATAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906613826_906613830 -9 Left 906613826 1:47221715-47221737 CCTCACCTAAGTCCCACTGCCCA 0: 1
1: 0
2: 0
3: 19
4: 281
Right 906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG 0: 1
1: 0
2: 3
3: 30
4: 311
906613825_906613830 16 Left 906613825 1:47221690-47221712 CCGAGGTAGAGGAGAAGAGCTAA 0: 1
1: 0
2: 1
3: 25
4: 172
Right 906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG 0: 1
1: 0
2: 3
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906613830 Original CRISPR CACTGCCCATTTTATAGCTA AGG Intronic
900646795 1:3712752-3712774 CACTCCCCATTTTACAGATGAGG + Intronic
901870734 1:12137900-12137922 CACTCCCCATTTTACAGATGAGG - Intronic
902659483 1:17891244-17891266 CACTCCTCAATTTATAGATAGGG - Intergenic
902797593 1:18809425-18809447 ACCTGCCCATTTTATAGATGAGG - Intergenic
903227842 1:21903930-21903952 CCCTGGCCATATTCTAGCTAGGG + Intronic
903377140 1:22873979-22874001 CACATCCCATTTTACAGGTAAGG + Intronic
903396983 1:23009047-23009069 ATCTGCCCATTTTACAGTTAAGG + Intergenic
904007335 1:27370310-27370332 CCCTGCCCATTTTATAGAGGAGG + Intronic
904108479 1:28106271-28106293 AACTCCCCATTTTGTAGCTGAGG - Intergenic
904458366 1:30660902-30660924 ATCTCCCCATTTTATAGCTGAGG - Intergenic
904933261 1:34107469-34107491 CTCTCCCCATTTCATAGGTAAGG + Intronic
905242801 1:36591922-36591944 GGCAGCCCATTTTATAGCTGTGG - Intergenic
905317161 1:37090050-37090072 CACTGACCATCTTTTATCTAGGG + Intergenic
905320722 1:37114982-37115004 CCATTCCCATTTTATAGCTATGG - Intergenic
906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG + Intronic
906948969 1:50318960-50318982 CTGTGCCCATTTTACAGATAAGG - Intergenic
907426933 1:54385767-54385789 CAATCCCCATTTTACAGATAAGG + Intronic
907497492 1:54854484-54854506 CAAGGCCCATTTTACAGATAAGG - Intronic
907811352 1:57873612-57873634 CGCTGCCCAATGTATAGCAAAGG + Intronic
908042648 1:60131409-60131431 TTATGTCCATTTTATAGCTAAGG - Intergenic
908226983 1:62066250-62066272 CTATTCCCATTTTATAGATAAGG + Intronic
908972987 1:69860357-69860379 CAGTTCCCATTTTATAGATGAGG + Intronic
910326819 1:86018770-86018792 CCCTATCCATTTTTTAGCTAGGG - Intronic
912007705 1:104924837-104924859 CTCTGCCCAGTTTATAGTTGTGG + Intergenic
915437389 1:155918851-155918873 CTGTGCCCATTTTACATCTAAGG + Intronic
915668947 1:157470823-157470845 ATCTACCCATTTTATAGGTAAGG - Intergenic
915857830 1:159408693-159408715 CATTACCCATTTTATAGATGAGG - Intergenic
916256179 1:162790340-162790362 CAGTGCCCATTTTAGAGAAAAGG - Intergenic
917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG + Intergenic
917560794 1:176152804-176152826 ACCTGCACATTTTATAGGTAGGG - Intronic
917571925 1:176275713-176275735 CTTTGCCCATTTTAAAGTTAAGG + Intergenic
920285370 1:204874977-204874999 CAATCCCCATTTTATAGATGGGG + Intronic
920511401 1:206555022-206555044 CTATGCCCATTTTATAGATAAGG - Intronic
920911513 1:210222107-210222129 TTATCCCCATTTTATAGCTAAGG - Intergenic
921125931 1:212178126-212178148 CCGTCCCCATTTTATAACTAAGG + Intergenic
921400718 1:214720541-214720563 TTATGCCCATTTTATAGCTGAGG - Intergenic
922108402 1:222532734-222532756 CACTCCCCATTTTATGGATGAGG - Intronic
924020323 1:239774257-239774279 CACTGCTCTTTTTACAGCTGTGG + Intronic
1067508475 10:46876199-46876221 CCCTGCCCATTTGATAGGTTGGG + Intergenic
1067653773 10:48175650-48175672 CCCTGCCCATTTGATAGGTTGGG - Intronic
1068220721 10:54042233-54042255 CTCTCTCCATTTCATAGCTAAGG + Intronic
1070086347 10:73240874-73240896 CACTCTCAAGTTTATAGCTAAGG - Intronic
1070732825 10:78843093-78843115 CACTGTCCATGTGATATCTATGG + Intergenic
1072603817 10:96960008-96960030 CATAGCTCATATTATAGCTAAGG - Intronic
1072784237 10:98269136-98269158 CTCTGCCCATTTTACAGATGGGG - Intergenic
1073341952 10:102751820-102751842 CAATTCCCATTTTATAGATGAGG - Intronic
1074051096 10:109881927-109881949 CGCACCACATTTTATAGCTAAGG - Intronic
1074854195 10:117461449-117461471 TCCTTCCCATTTTATAGCTAAGG + Intergenic
1075171164 10:120116166-120116188 TACTGCCAATTTTATAGCCATGG + Intergenic
1075712730 10:124539319-124539341 CTCTGTCCATTTTAAAGATAAGG - Intronic
1077240024 11:1505779-1505801 CCCTGCCCATTTTACTGATAAGG + Intergenic
1077583131 11:3430293-3430315 CATTCCCCATTTTACAGCTGGGG + Intergenic
1077842352 11:5989264-5989286 CATTTCTCATTTTTTAGCTAAGG + Intergenic
1077843750 11:6002554-6002576 CACTGACCAGTTTGTGGCTAGGG - Exonic
1077970612 11:7185308-7185330 CACTGCCCATGTTATAACACTGG - Intergenic
1078427385 11:11262901-11262923 AACTACCCATTTTATAGATGAGG - Intergenic
1078737044 11:14029892-14029914 CAGTCCCCATTTTACAGATAAGG + Intronic
1079840324 11:25389264-25389286 CACTGCCAATTTTAAATATAAGG + Intergenic
1080829553 11:35878644-35878666 CACTTCCCTTTTTACAGCTGAGG + Intergenic
1080938439 11:36886574-36886596 CAGGCCCCATTTTATAGATAAGG + Intergenic
1081067737 11:38566924-38566946 CACTGACCATTTTATATGGATGG + Intergenic
1081739898 11:45431405-45431427 GGCTGCCCAGTTTATAGATAGGG - Intergenic
1081805441 11:45887449-45887471 ACCTGCCCATTTTATAGATGAGG + Intronic
1081850860 11:46274267-46274289 CCTCGCCCATTTCATAGCTATGG + Intergenic
1083742650 11:64719243-64719265 CACTGCCCCTTTTACAGATGAGG + Intronic
1084240047 11:67813096-67813118 CATTCCCCATTTTACAGCTGGGG + Intergenic
1084832399 11:71779745-71779767 CATTCCCCATTTTACAGCTGGGG - Intergenic
1085067081 11:73506420-73506442 CACTGCCTTCTTTAAAGCTAAGG - Intronic
1085723723 11:78935458-78935480 CTCTGCCCATTTTACAGGTGAGG + Intronic
1086860770 11:91922431-91922453 TTATGCCCATTTTACAGCTAAGG - Intergenic
1087641436 11:100759315-100759337 CATAGCACCTTTTATAGCTAGGG + Intronic
1088913723 11:114211406-114211428 CTATGCCCATTTTACAGATAAGG - Intronic
1090364086 11:126191861-126191883 AACTGCCCATTTTACAGGTGAGG + Intergenic
1091652678 12:2321373-2321395 AAGTGCCCATTTTACAGATAAGG - Intronic
1091782647 12:3223667-3223689 CCCTTCCCATTTTATAGGTGAGG - Intronic
1092410284 12:8247639-8247661 CATTCCCCATTTTACAGCTGGGG + Intergenic
1092443869 12:8535079-8535101 AACTTCTCATTCTATAGCTAAGG - Intronic
1092682413 12:10999449-10999471 CTCTGCTCATTATATACCTAGGG - Intronic
1094233166 12:28131803-28131825 CACTCCCTATTTTATAGATAAGG + Intergenic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1096475802 12:51907972-51907994 CACTGCCCATTTTATGAAGAGGG - Intronic
1097813124 12:64040341-64040363 CAGAGCCAATTTTATAACTAAGG - Intronic
1098127806 12:67318385-67318407 TAATTCCCATTTTATAGATAGGG - Exonic
1098359914 12:69644284-69644306 CTATGTCCATTTTATAGGTAAGG - Intronic
1098359999 12:69645329-69645351 CTATGCCCATTTTATAGGTAAGG - Intronic
1099056726 12:77851125-77851147 CACTTCTCATTTGATAGCTGGGG - Intronic
1099706084 12:86154370-86154392 CACTCCCAATTATATACCTAAGG - Intronic
1100228416 12:92582446-92582468 CACTGCTCATTGCTTAGCTAGGG - Intergenic
1100271784 12:93032399-93032421 CCATGCCCATTTTATAGACAAGG + Intergenic
1101062348 12:100985453-100985475 TCATGCCCATTTTATAGATAAGG + Intronic
1101420609 12:104547758-104547780 CTATTCTCATTTTATAGCTATGG - Intronic
1102213108 12:111141387-111141409 CTGTGCCCATTTTACAGGTAGGG - Intronic
1102794053 12:115673154-115673176 AACAGCCCATTTTATGGCTGAGG - Intergenic
1102802498 12:115748800-115748822 CTATGCTCATTTTATAGATAGGG + Intergenic
1102872290 12:116423472-116423494 CACTCCTCATTTTACAGATATGG - Intergenic
1103266269 12:119633208-119633230 CAATTCTCATTTTATAGTTAGGG - Intronic
1103370709 12:120417023-120417045 CCCTGCCCATTTCACAGATATGG - Intergenic
1103710084 12:122906025-122906047 TAATCCCCATTTTATAGATAAGG - Intergenic
1104098946 12:125588228-125588250 CCATCCCCATTTTATAGATAAGG - Intronic
1105558166 13:21465447-21465469 CAGTGCACATTTCATAGCTGAGG - Intergenic
1106087067 13:26552210-26552232 TGTTGCCCATTTTATAGATAAGG - Intergenic
1106404945 13:29465293-29465315 CAATCCTCATTTTATAGATAAGG + Intronic
1111756782 13:92406972-92406994 TACTACCCATTTTCTAGTTAAGG + Intronic
1112428427 13:99326647-99326669 GACTGCCTATTTTAAAGATAGGG + Intronic
1116624455 14:47246988-47247010 CAATGCCCATTTGATAACTGAGG - Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118731959 14:68674700-68674722 GACTTCCCATTTTATACTTAGGG - Intronic
1118883566 14:69848949-69848971 AACTCCCCATTTTATAGGTGGGG + Intergenic
1125281475 15:38046343-38046365 CATTGCTCATGTCATAGCTAAGG + Intergenic
1126095877 15:45089737-45089759 CAATCCCCATTTTACAGATAAGG - Intergenic
1126171517 15:45699278-45699300 CATTGCCCACTTCATATCTAAGG + Intergenic
1127675428 15:61233550-61233572 CCATGCCCATTTTATAGGTGAGG + Intergenic
1128366052 15:67003995-67004017 TAATGCCCATTTTACTGCTAAGG - Intergenic
1128385485 15:67145207-67145229 GCCTGCCCATTTTATAGGTGAGG + Intronic
1130337067 15:82965639-82965661 TATTGCCCATTTTACAGCTAGGG - Intronic
1132034064 15:98465536-98465558 TACTACCCATTTTATAGACATGG + Intronic
1132049952 15:98599190-98599212 CTATGCCCATTTTACAGATAAGG + Intergenic
1132597902 16:761609-761631 CACTGCCCATTTTCTGGCTGTGG + Intronic
1133578272 16:7116085-7116107 CAGTACCCATTTTACAGATAAGG + Intronic
1135726624 16:24859034-24859056 CAATACCCATTTTACAGATAAGG + Intronic
1136664524 16:31797599-31797621 CACAGCCAACATTATAGCTATGG - Intergenic
1137430634 16:48415528-48415550 CCCAGCCCATTTTATAGATGAGG - Intronic
1138649429 16:58450758-58450780 TATTGCCCATTTTATAGACATGG + Intergenic
1138922104 16:61543765-61543787 CCATGCCCATTTTACAGATATGG - Intergenic
1138977382 16:62224170-62224192 CAATTCCCATTTTATAGGTGAGG + Intergenic
1140121764 16:72089833-72089855 GAGTCCCCATTTTATAGATAGGG + Intronic
1140472225 16:75222381-75222403 TGCTGCCCTTTTTATAGCTGAGG + Intronic
1142655029 17:1386081-1386103 TACTACCCATTTTACAGATAAGG - Intronic
1145976135 17:28985524-28985546 AAGTGCCCATTTTATAGCTGAGG - Intronic
1146479933 17:33197092-33197114 CTCTACCCATTTTATAGATGAGG - Intronic
1146518963 17:33511486-33511508 GACTCCCCATTTTCTGGCTAGGG - Intronic
1146552076 17:33789402-33789424 CAATCCCCATTTTATAGACAAGG + Intronic
1146643612 17:34561328-34561350 CAGTGCCCATTTCACAGGTAAGG + Intergenic
1147510277 17:41062640-41062662 CTCTGCCCATTTTACAGATGAGG - Intergenic
1147567821 17:41548408-41548430 TACTGCCCATTTTACAGATGAGG + Intergenic
1147955233 17:44129800-44129822 CACTTCCCATTTTACAGATGAGG + Intergenic
1149097656 17:52863168-52863190 GTGTTCCCATTTTATAGCTAGGG + Intronic
1151306862 17:73268109-73268131 CTCTACCCGTTTTATAGGTAAGG + Intergenic
1151342882 17:73482953-73482975 CTCTTCCCATTTTACAGCCAGGG + Intronic
1151666382 17:75547448-75547470 CAATGCCCATTTTACAGATGAGG - Intronic
1152248634 17:79199853-79199875 TTCTCCCCATTTTATAGATAAGG - Intronic
1152279300 17:79375916-79375938 CACTCCCCGTTTTACAGCCAAGG - Intronic
1153574619 18:6508128-6508150 CTATGCACATTTTATAGATAAGG + Intergenic
1154977234 18:21471339-21471361 CACTCCCTATTTTACAGATAAGG + Intronic
1156178487 18:34575416-34575438 CACTGTCCATTTCATCTCTAAGG + Intronic
1156496227 18:37526962-37526984 TACTGCCCATTTTATAGATAAGG - Intronic
1156503569 18:37575093-37575115 TTCTGCCCATTTTATAGATGAGG - Intergenic
1156660140 18:39336905-39336927 GACTGCCAATGTTATAACTATGG - Intergenic
1156919069 18:42497279-42497301 CACAGCTCATTATAAAGCTATGG - Intergenic
1157071335 18:44412248-44412270 GACTGCCCATTTTAAAGATCTGG + Intergenic
1157941983 18:51939234-51939256 CACTCCCTATTTTATTGCCATGG - Intergenic
1160835766 19:1123807-1123829 GAGTGCCCATTTTATAGCTGAGG - Intronic
1160879024 19:1311190-1311212 CAGCACCCATTTTATAGCTGGGG + Intergenic
1160954332 19:1683301-1683323 CACTGCCAATTTTATAGATGAGG + Intergenic
1161398685 19:4058359-4058381 CTCTGCCCATTTGACAGATAGGG - Intronic
1162806158 19:13138939-13138961 GACTACCCATTTTATAGCTGGGG + Exonic
1163403634 19:17109462-17109484 CTCTGCCCATTTTAAAGATGAGG + Intronic
1163626996 19:18396021-18396043 CTCTCCCCATTTTATAGGTGAGG + Intronic
1164487378 19:28670490-28670512 CATTGGCCATTTTATAGATTAGG + Intergenic
1165696998 19:37908005-37908027 AAATCCCCATTTTATAGATAGGG - Intronic
1166876494 19:45901154-45901176 TTCGCCCCATTTTATAGCTAGGG - Intronic
924980782 2:219171-219193 CTCTGCACATTCTATACCTAAGG + Intronic
926138331 2:10353175-10353197 CACTGCCCATTTGACAGATGAGG - Intronic
926621903 2:15054211-15054233 TACTACCCATTTCATAGGTAAGG + Intergenic
927088663 2:19694095-19694117 CCCTGCCCATTTTATAGATGAGG - Intergenic
927279520 2:21291710-21291732 CACTGCCTACTTTATACCCAAGG + Intergenic
927642537 2:24854437-24854459 AGATGCCCATTTTATAGATAAGG - Intronic
928939312 2:36711535-36711557 CAATTCCCATTTTAAAGATAAGG - Intronic
929917371 2:46147400-46147422 GACAGCCCATGTTATAGTTAAGG + Intronic
932595727 2:73092520-73092542 CACGGCCCATTTTGTGGCTCAGG - Intronic
933291795 2:80445957-80445979 TACTCCCCATTTTACAGGTAAGG - Intronic
933292864 2:80456717-80456739 TGCTTCCCATTTTATAGCTAAGG - Intronic
933896610 2:86816064-86816086 CACTGTCAATTTTATTGCCATGG + Intronic
934712358 2:96524336-96524358 CTCTGCACATTTTACAGATAAGG + Intergenic
935392086 2:102563573-102563595 CTGTCCCCATTTTATAGATAAGG - Intergenic
937127661 2:119484550-119484572 CTGTGCCCATTTTATAGATGAGG - Intronic
938696364 2:133838805-133838827 TTATGCCCATTTTAAAGCTAAGG + Intergenic
943381074 2:187149119-187149141 CAAGGCACATTTTAGAGCTATGG - Intergenic
944123512 2:196267453-196267475 CACTACCCATTTTACAGATGTGG + Intronic
946489037 2:220130013-220130035 TTGTGCCCATTTTGTAGCTAGGG - Intergenic
947399534 2:229717309-229717331 CCCTGCACATTTTATGGCCATGG - Intergenic
1170177706 20:13490809-13490831 CATTCCCCATTTTACAGCTATGG - Intronic
1170828939 20:19823065-19823087 CAATGCCCATTTTACAGATGAGG + Intergenic
1170848967 20:19986521-19986543 CACAGCCCCTTTTATACCCAAGG + Intronic
1171433255 20:25100236-25100258 CACTCCCCAGTTGATAGGTAGGG - Intergenic
1173772678 20:45676574-45676596 CTCTGCCCATTTTTTAAATAGGG + Intergenic
1178248695 21:30979789-30979811 CCATGCCCATTTTACAGATAAGG - Intergenic
1181431955 22:22887360-22887382 CTCTCCCCATTTTACAGATAAGG + Intronic
1181964430 22:26646630-26646652 CTCTCCCCATTTTATAGACAAGG - Intergenic
1182047310 22:27285413-27285435 CCCTTCCCATTTTATAGATGAGG + Intergenic
1182915178 22:34022778-34022800 TAATCCCCATTTTAAAGCTATGG - Intergenic
1183933716 22:41250054-41250076 CCATGCCCATTTTATACCTGAGG - Intronic
1184402218 22:44280778-44280800 CCCTGCCCAGTTTACAGATAGGG + Intronic
1184580289 22:45412732-45412754 CTCTCCCCATTTTATAGTTGGGG - Intronic
1184653292 22:45929033-45929055 CTCTCCCCATTTTAAAGATAAGG - Intronic
949437453 3:4045002-4045024 CACAGCCCATTTTATAGGTAAGG - Intronic
949536683 3:5001598-5001620 CACTGACCTTTTTAGAGATAGGG - Intergenic
950120030 3:10475669-10475691 CAGTTCCCATTTTATAGACAGGG + Intronic
950359438 3:12440134-12440156 CTATTCCCATTTTATGGCTAGGG - Intergenic
950440383 3:13006981-13007003 CTCTCCCCATTTTATAGATGAGG + Intronic
950549291 3:13656459-13656481 CAGTGCCCATTTTACAGATGGGG - Intergenic
953453298 3:43021678-43021700 TTCTCCCCATTTTATAGCTGAGG + Intronic
955901329 3:63759095-63759117 CAGTCCTCATTTTATAGATAAGG + Intergenic
957055522 3:75439768-75439790 CATTCCCCATTTTACAGCTGGGG + Intergenic
957194227 3:77047314-77047336 CCATGCCCATTTTACAGGTAAGG - Intronic
957831480 3:85526828-85526850 TTATCCCCATTTTATAGCTAAGG + Intronic
961298867 3:125908838-125908860 CATTCCCCATTTTACAGCTGGGG - Intergenic
961889195 3:130116153-130116175 CATTCCCCATTTTACAGCTGGGG + Intergenic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
964020169 3:152000387-152000409 TACTCCCCATTTTGTAGATAAGG + Intergenic
965344197 3:167527231-167527253 CAATTCCCATTTTACAGATAAGG - Intronic
965734452 3:171805871-171805893 CTATGCCCATTTTATAGATGAGG - Intronic
966129522 3:176621668-176621690 CATTGCCCATTCTACAGCTCTGG - Intergenic
966991594 3:185236938-185236960 CAATTCCCATTTTACAGGTAAGG + Intronic
967280167 3:187814725-187814747 TTCTTCCCATTTTATAGATAAGG + Intergenic
968780886 4:2580505-2580527 CACCCCCCATTTTGGAGCTAGGG + Intronic
968998335 4:3960076-3960098 CATTCCCCATTTTACAGCTGGGG + Intergenic
969755664 4:9148576-9148598 CATTCCCCATTTTACAGCTGGGG - Intergenic
971045837 4:22804252-22804274 CACTGCCCATTTTCTATGTTAGG - Intergenic
971403935 4:26302711-26302733 TACTTCCCTTTTTATAGCTAAGG - Intronic
971493839 4:27242821-27242843 CCCTCCCCATTTTACAGCTTGGG - Intergenic
972289842 4:37681446-37681468 CAATGCCCATTTTACAGGTGAGG + Intronic
972443687 4:39122362-39122384 CTATTCCCTTTTTATAGCTAAGG + Intronic
972687883 4:41368798-41368820 CACTGTCCATTTTACATCTGAGG + Intronic
973194507 4:47424330-47424352 CCATCCCCATTTTATAGATAAGG - Intronic
975076910 4:70220975-70220997 TACTTCCCTTTTTATAGCTAGGG + Intergenic
975902330 4:79167474-79167496 GACTCCCCATTTAATAGGTATGG - Intergenic
976335395 4:83879500-83879522 CTATCCCCATTTTATAGATAAGG - Intergenic
977276286 4:94981112-94981134 CACTACCAATTTTTTATCTAAGG - Intronic
977377072 4:96219320-96219342 CTCTGGCCATTTTATATCAATGG + Intergenic
977558793 4:98511887-98511909 TAATCCCCATTTTATAGATAAGG + Intronic
978629968 4:110732783-110732805 TTATGCCCATTTTATGGCTAAGG - Intergenic
979670429 4:123355191-123355213 CTATGCCCATTTCATAGATAAGG - Intergenic
981145758 4:141322121-141322143 CAGTGCCCATTTTAAAGTTGAGG + Intergenic
986316696 5:6593793-6593815 ATCTGCCCATTTTATAGATGAGG + Intergenic
986745475 5:10740420-10740442 CACTGAGCATTTTTTATCTATGG - Intronic
987698902 5:21368955-21368977 CACTGATCATTTTATGTCTATGG - Intergenic
988452944 5:31361583-31361605 CAATTCCCATTGTACAGCTATGG + Intergenic
988753751 5:34222511-34222533 CACTGATCATTTTATGTCTATGG + Intergenic
988982142 5:36582093-36582115 CTATGCCCATTTTATAGATGAGG - Intergenic
989169162 5:38458305-38458327 CACTGCCCAGGTTATAGCTAAGG - Exonic
989243716 5:39229707-39229729 TTATGCCCATTTTATAGATAAGG + Intronic
990128899 5:52554866-52554888 CACTGGCCATTTTATGGCAATGG - Intergenic
990885668 5:60589838-60589860 TACTGTCCATTTTACAGCTCAGG - Intergenic
991741535 5:69683367-69683389 CACTGATCATTTTATGTCTATGG + Intergenic
991756083 5:69871072-69871094 CACTGATCATTTTATGTCTATGG - Intergenic
991793109 5:70263105-70263127 CACTGATCATTTTATGTCTATGG + Intergenic
991820994 5:70559441-70559463 CACTGATCATTTTATGTCTATGG + Intergenic
991835486 5:70746989-70747011 CACTGATCATTTTATGTCTATGG - Intergenic
991885558 5:71263410-71263432 CACTGATCATTTTATGTCTATGG + Intergenic
992034250 5:72756350-72756372 CACAGCTCATTTTACAGATATGG + Intergenic
992244191 5:74801352-74801374 CCATCCCTATTTTATAGCTAAGG + Intronic
992911482 5:81399867-81399889 CAATTCCCATTTTATAGATGAGG + Intergenic
997465541 5:134085532-134085554 CTCTGCCCATTTTACAGATAAGG - Intergenic
998148111 5:139741866-139741888 TAGTGCCCATCTTATAGATAAGG + Intergenic
998575532 5:143311539-143311561 AACTCCTCATTTTATAGATAAGG - Intronic
998888835 5:146724286-146724308 CAGTCCCCATTTTACAGCTGAGG - Intronic
998984417 5:147739894-147739916 CCCTGCCCATTTTCCACCTAGGG + Intronic
999265839 5:150266306-150266328 CTCTCCCCATTTTATAGATAAGG + Intronic
999516306 5:152305283-152305305 AACTCCCCATTTTATAGATAAGG + Intergenic
1000297696 5:159926576-159926598 CTCTGCCCATTTTATAAATAAGG + Intronic
1001012554 5:168111581-168111603 CTCTGCCCATTTAATAGGTCAGG + Intronic
1001285956 5:170424324-170424346 CTGTTCCCATTTTATAGATAGGG + Intronic
1002307029 5:178289695-178289717 CACGGAGCATTTTAAAGCTACGG + Intronic
1004571350 6:16848815-16848837 TACTGCCCACTTTGTAGATAAGG + Intergenic
1005204161 6:23381670-23381692 CACTGACCCTTTTGCAGCTATGG - Intergenic
1005551921 6:26929348-26929370 CACTGATCATTTTATGTCTATGG + Intergenic
1006447701 6:34089063-34089085 CTATGCCCATTTTATAGATGGGG - Intronic
1006644119 6:35504474-35504496 CTCAGCCCATTTTATAGATGGGG - Intronic
1007288239 6:40763591-40763613 CAATACCCATTTTCTAGCCAAGG - Intergenic
1007352677 6:41285378-41285400 TTCTCCCCATTTTATAGATAAGG + Intronic
1008928578 6:56913299-56913321 CAATGCCCATTTTACAGATAAGG + Intronic
1014500158 6:122178339-122178361 AACAGACTATTTTATAGCTATGG - Intergenic
1015540859 6:134312194-134312216 TTATGCCCATTTTATAGCCAAGG - Intronic
1015617788 6:135096588-135096610 CTCTTCCCATTTTACAGATAAGG + Intronic
1016248027 6:142010466-142010488 CAATCCCCATTTTATAGATGAGG - Intergenic
1017328065 6:153162675-153162697 CACTCCCCTTTTTAAAGTTAGGG + Intergenic
1018919259 6:168160074-168160096 CCCTCCTCATTTTATAGATAGGG - Intergenic
1019417055 7:932603-932625 CCCTGCCCATTTTTTAGGGAAGG + Intronic
1019567458 7:1691515-1691537 CCCTGCCCATTTTACAGATGAGG - Intronic
1019896899 7:3989862-3989884 TAATCCCCATTTCATAGCTACGG + Intronic
1020520651 7:9182053-9182075 CATTCCCCATTTTACAGATAAGG - Intergenic
1023375305 7:39549852-39549874 CCCTCTCCATTTTATAGATAAGG - Intergenic
1025710458 7:63903073-63903095 CAATCCCCATTTTATAGGTGTGG + Intergenic
1027308178 7:76924449-76924471 CACAGCCCTTTATATAGCAATGG + Intergenic
1029893599 7:103958059-103958081 TTCTGCCCATTGTATAGCTCAGG - Intronic
1030592146 7:111494647-111494669 CAGTCCCCATTTTATAGATGAGG - Intronic
1031085570 7:117298836-117298858 CTCTTCCCATTTTATAGATGAGG + Intronic
1031341188 7:120604019-120604041 TCATTCCCATTTTATAGCTAAGG - Intronic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1034550541 7:151817737-151817759 TACTGTCCATTTTATCGATAAGG + Intronic
1036378911 8:8223882-8223904 CATTCCCCATTTTACAGCTGGGG - Intergenic
1036704696 8:11038310-11038332 CCCCGCTCATTTTATAGTTAAGG + Intronic
1036850655 8:12198718-12198740 CATTCCCCATTTTACAGCTGGGG + Intergenic
1036872020 8:12440983-12441005 CATTCCCCATTTTACAGCTGGGG + Intergenic
1038012734 8:23487650-23487672 TCATGCCCATTTTATAGCTGGGG + Intergenic
1038426770 8:27468997-27469019 TTCTGCCCATTTTACAGCTCAGG - Intronic
1038536730 8:28359073-28359095 CATTGCCCATAATAGAGCTATGG + Intronic
1039900658 8:41750000-41750022 CAATTTCCATTTTATAGCTCAGG - Intronic
1039914795 8:41852014-41852036 CCATGCCCATTTTATAACTGAGG + Intronic
1045543160 8:103105235-103105257 CACTGCCCCTTTCAGAGCTCAGG + Intergenic
1045678200 8:104631549-104631571 TAATTCCCATTTTATAGATAAGG + Intronic
1045749270 8:105462292-105462314 CAATCCCTATTTTATAGCTAAGG + Intronic
1046019424 8:108646817-108646839 CCCTGGCCATTTTTTAGCTCAGG - Intronic
1046596063 8:116262772-116262794 AACAGCCCATTTTATAGAGAAGG + Intergenic
1047098199 8:121646695-121646717 CACTGACGATTTTCCAGCTAAGG + Intergenic
1047211690 8:122845749-122845771 CTCTGCCCATTTCACAGGTAAGG + Intronic
1047550051 8:125861243-125861265 CACTTCCCACTTTCTAGCTGAGG - Intergenic
1048265527 8:132982167-132982189 CTATGCCCATTTTATAGACAAGG + Intronic
1048923568 8:139251621-139251643 ATATGCCCATTTTATAGCTGAGG - Intergenic
1050570351 9:6931934-6931956 CACTGACCATATTATTGCTTAGG - Intronic
1051217603 9:14815315-14815337 TTATCCCCATTTTATAGCTAAGG - Intronic
1051706417 9:19885501-19885523 CTCTCCCCATTTTATAGATGAGG + Intergenic
1052677486 9:31645571-31645593 CACTGGACATTTTATAGCCAGGG + Intergenic
1053291857 9:36885414-36885436 TCCTCCCCATTTTATAGATAAGG - Intronic
1055057952 9:72040709-72040731 CATTGTCCATTTTATTGCTTAGG - Intergenic
1055083729 9:72292755-72292777 CACTGCTCATTATTTATCTATGG - Intergenic
1057212121 9:93206065-93206087 CACGGCCCATTTTATAGATGAGG + Intronic
1057609602 9:96528885-96528907 CACTGGCCATTTTATATCTTTGG + Intronic
1057896816 9:98915776-98915798 CTCTTCCCATTTTACAGATAAGG - Intergenic
1058153087 9:101483249-101483271 TACTACCAATTTTATAGCTGAGG - Intronic
1058647837 9:107146903-107146925 CATTACCTATTTTATAGTTATGG - Intergenic
1059362643 9:113757516-113757538 CTATCCCCATTTTATAGATAAGG + Intergenic
1060063320 9:120481147-120481169 CACTCCCCATTTTAGAGATGAGG + Intronic
1060182947 9:121546317-121546339 CACCTCCCATTTTATAGACAAGG - Intergenic
1060516029 9:124266313-124266335 TTCTGCCCATTTTATAGATGAGG + Intronic
1060765810 9:126294443-126294465 CCCAGCCCATTTTATAGACAAGG + Intergenic
1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG + Intronic
1061369341 9:130189263-130189285 CTATTCCCATTTTACAGCTAAGG + Intronic
1061435026 9:130555643-130555665 GTATCCCCATTTTATAGCTAAGG - Intergenic
1061541390 9:131279408-131279430 CACTACCCAGTTTATATGTAGGG + Intergenic
1062434972 9:136542984-136543006 CAGTGCCCATTTTACATCTGAGG + Intronic
1186758414 X:12697784-12697806 CACTGCCTATTTTATACCCAAGG - Intronic
1186811193 X:13190449-13190471 TCGTCCCCATTTTATAGCTAAGG - Intergenic
1187023315 X:15406987-15407009 CAATGCTCATTTTATAGATGAGG - Intronic
1188181873 X:27066283-27066305 CACAGCCAATTTAAAAGCTAAGG + Intergenic
1188679529 X:32984574-32984596 TACTTCCCTTTTTATAGATAGGG - Intronic
1192226495 X:69231789-69231811 CATTGCCCATTTCATAGATGAGG + Intergenic
1194738154 X:97539218-97539240 CACTGCCATTTTTATAGTTAAGG - Intronic
1195329966 X:103788827-103788849 CACAGCCCATTTTCTTGATATGG - Intronic
1195667231 X:107442428-107442450 TAATTCCCATTTTATAGATAAGG - Intergenic
1195824300 X:108981137-108981159 TTCTGCCCATTTTACAGATATGG - Intergenic
1195826234 X:109003943-109003965 CACTGCCCTTTTCAGAGCCAGGG - Intergenic
1196318342 X:114256334-114256356 CAATTCCCATTTTATAGATGAGG - Intergenic
1199976722 X:152898612-152898634 CTGTGCCCATTTTATAGATGAGG + Intergenic