ID: 906614542

View in Genome Browser
Species Human (GRCh38)
Location 1:47225481-47225503
Sequence CAGCGCGCGGCCGGGGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 1, 1: 1, 2: 10, 3: 123, 4: 1110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906614525_906614542 28 Left 906614525 1:47225430-47225452 CCTGGCCCCTGACCTGCCGAGAG 0: 1
1: 0
2: 2
3: 20
4: 268
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614524_906614542 29 Left 906614524 1:47225429-47225451 CCCTGGCCCCTGACCTGCCGAGA 0: 1
1: 1
2: 6
3: 23
4: 247
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614535_906614542 2 Left 906614535 1:47225456-47225478 CCAGCGGCTGGCTGAGGCTGTAG 0: 1
1: 0
2: 1
3: 20
4: 290
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614529_906614542 21 Left 906614529 1:47225437-47225459 CCTGACCTGCCGAGAGAGGCCAG 0: 1
1: 0
2: 1
3: 16
4: 195
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614533_906614542 12 Left 906614533 1:47225446-47225468 CCGAGAGAGGCCAGCGGCTGGCT 0: 1
1: 0
2: 2
3: 26
4: 213
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614523_906614542 30 Left 906614523 1:47225428-47225450 CCCCTGGCCCCTGACCTGCCGAG 0: 1
1: 0
2: 6
3: 28
4: 301
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614527_906614542 23 Left 906614527 1:47225435-47225457 CCCCTGACCTGCCGAGAGAGGCC 0: 1
1: 0
2: 1
3: 14
4: 158
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614531_906614542 16 Left 906614531 1:47225442-47225464 CCTGCCGAGAGAGGCCAGCGGCT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110
906614528_906614542 22 Left 906614528 1:47225436-47225458 CCCTGACCTGCCGAGAGAGGCCA 0: 1
1: 0
2: 1
3: 15
4: 181
Right 906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG 0: 1
1: 1
2: 10
3: 123
4: 1110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906614542 Original CRISPR CAGCGCGCGGCCGGGGGCGG CGG Exonic
900019989 1:181566-181588 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
900087228 1:904415-904437 GAGGGCGGGGCCGGGGCCGGCGG - Intergenic
900175020 1:1287794-1287816 CAGCGTCCGGCCAGGGACGGAGG + Exonic
900191780 1:1355174-1355196 CGGCGCGCGGGCCGGGGCGGCGG + Intronic
900214090 1:1471960-1471982 CAGCCCGGGGCCGAGGGCGGCGG + Exonic
900221639 1:1512344-1512366 CAGCCCGGGGCCGAGGGCGGCGG + Exonic
900228975 1:1546503-1546525 GAGCTCGAGGCCGGGTGCGGCGG + Intronic
900307794 1:2019512-2019534 CGGCGCGGGGTCGGGGGCGGTGG + Intronic
900336347 1:2165896-2165918 TAGGGGGCGGCCGGGGGCTGAGG - Intronic
900341505 1:2191458-2191480 CAACGACCGGCCGGGCGCGGTGG + Intronic
900349401 1:2227678-2227700 CTGGGCGCGGGCGGAGGCGGAGG - Intergenic
900397261 1:2458182-2458204 CACCGGGCTGCCTGGGGCGGGGG + Intronic
900414741 1:2529773-2529795 GAGCGGGCGGCGGGGCGCGGGGG + Intronic
900418622 1:2546201-2546223 CTGCTGGAGGCCGGGGGCGGGGG + Intergenic
900488058 1:2932907-2932929 CAGCGCGGGGCCCAGGGTGGAGG - Intergenic
900512859 1:3068599-3068621 CAGGGCGGGGACGGGGGCCGAGG + Intergenic
900676133 1:3887566-3887588 CAGCACCTGGCCGGGCGCGGTGG - Intergenic
900765188 1:4500326-4500348 CTGCCCGGGGCCGGGCGCGGTGG - Intergenic
900786950 1:4655296-4655318 CGGCGGGCGGCGGGAGGCGGCGG + Exonic
901019666 1:6249423-6249445 CTGCGCGCGGCGGGCGGCGGCGG - Exonic
901022195 1:6261087-6261109 CGCCGGGCGGCCGGGGGCGGGGG + Intergenic
901062357 1:6477707-6477729 CAGCGCTGGGCCGGGGTCGAGGG - Intronic
901075789 1:6554128-6554150 CAACGCGCGGCCGGGGCCCACGG + Exonic
901084459 1:6602168-6602190 CAGTGCGCGGCGCGGCGCGGCGG + Exonic
901370739 1:8795309-8795331 AAGTGGGGGGCCGGGGGCGGTGG - Intronic
901381604 1:8878393-8878415 CACCCCGAGGCCCGGGGCGGGGG - Intronic
901443493 1:9293189-9293211 TGGCGCGGGGCCGGGCGCGGGGG + Intronic
901630398 1:10645241-10645263 CAGCGCAGGGCCGGGCGCGGTGG + Intronic
901793965 1:11669923-11669945 CACCACACCGCCGGGGGCGGTGG + Intronic
901851659 1:12019780-12019802 CAAAGCGCGGCCGGGGCCAGGGG + Intronic
901866015 1:12107105-12107127 CAGCTAGGGGCCGGGTGCGGTGG + Intronic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
902385487 1:16073394-16073416 GGGGGCCCGGCCGGGGGCGGGGG - Intronic
902870730 1:19312245-19312267 CAGCGCGCGGCGTGGGGGCGGGG + Intergenic
903153287 1:21428210-21428232 CGGAGCGCGGGCGGCGGCGGAGG + Intergenic
903191556 1:21659383-21659405 GAGCGCGCGGCCGGTGACTGGGG - Intronic
903372530 1:22846129-22846151 CAGGGCGTGGCCAGGTGCGGTGG + Intronic
903501198 1:23800911-23800933 CAGCGCGCGCCCGCGGAAGGCGG + Intergenic
903597135 1:24503160-24503182 CAGCGCGGGGCGGGGCGGGGCGG + Intronic
903614457 1:24642054-24642076 CAGAGTGGGGCCGGGCGCGGTGG + Intronic
903750422 1:25617518-25617540 CGGCGCGCGGCCGGTCGCTGCGG + Exonic
903950480 1:26993570-26993592 CAGAGCGCGGGGGGGGGGGGGGG + Intergenic
904237648 1:29124824-29124846 CGGCGCGCAGCCGGGGGGAGGGG + Intergenic
904533289 1:31182641-31182663 CAGGGCCCGGCAGGGGGCGGAGG - Intronic
904659858 1:32076396-32076418 CAGCTCCTGGCCGGGCGCGGTGG - Intronic
904744674 1:32703221-32703243 CAGGGCGCGGCCGGGGAGGAGGG + Intronic
905037949 1:34929705-34929727 CTGCGCGGGGGCGGGGGCGGGGG - Intergenic
905135115 1:35793242-35793264 CAAACCGCGGCCGGGTGCGGTGG - Intergenic
905166426 1:36085805-36085827 GAGGGCGCGGCCGGGCACGGTGG - Intronic
905518369 1:38578663-38578685 TAGCGCGCAGCCGAGGGCGCGGG - Intergenic
905580676 1:39081283-39081305 GAGCGCGCATCGGGGGGCGGGGG + Intergenic
905655862 1:39685590-39685612 CTGGGCGCGGCCGGGCACGGTGG + Intronic
905720965 1:40201336-40201358 GAGGGCTCGGCCGGGTGCGGTGG + Intronic
905752407 1:40477399-40477421 GAGGGCGCGGCCGGAGGCAGAGG + Exonic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
906027143 1:42682959-42682981 CGGCGCGCGGCCGCAGGGGGAGG - Intronic
906198419 1:43944276-43944298 CAGCGGGAGGCCGGGCGCAGTGG - Intergenic
906436801 1:45803538-45803560 CGGCGCGCGGCCGGAGGTGGCGG + Intronic
906505455 1:46375817-46375839 CAGTGCGTGGCTGGGCGCGGTGG + Intergenic
906521929 1:46472348-46472370 AGGCGGGCGGCTGGGGGCGGTGG - Intergenic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
906637008 1:47416479-47416501 CCGCGCCCGGCCCGGGGCGGCGG + Exonic
907189071 1:52633553-52633575 CTGCCCGCGGCCGGGGGGCGAGG + Exonic
907237731 1:53063077-53063099 CACAGCCCGGCCTGGGGCGGGGG + Intronic
908056129 1:60289259-60289281 AAGAGCTCGGCCGGGCGCGGTGG + Intergenic
908534687 1:65066872-65066894 CTGGACGCGGGCGGGGGCGGGGG + Intergenic
908582040 1:65525978-65526000 CAGCGCCCGGCGGGCGGCGGGGG + Intronic
908830132 1:68170453-68170475 CAGCCAGCGGCCGAGCGCGGTGG - Intronic
908887858 1:68810668-68810690 CAGCTGTCGGCCGGGTGCGGTGG - Intergenic
908951694 1:69568726-69568748 CAGAGGCCGGCCGGGGGCGGGGG + Intronic
910449081 1:87328811-87328833 AGGAGCGCGGGCGGGGGCGGGGG + Exonic
910450157 1:87335557-87335579 CCCGGCGCGGCCGGGGGTGGGGG + Intronic
912270123 1:108200210-108200232 CAGCGCGAGGCCGGGCTGGGCGG + Exonic
912360386 1:109090283-109090305 CAAGTCGCGGCCGGGCGCGGTGG - Exonic
912492712 1:110070729-110070751 GCGCGCGCCGCGGGGGGCGGGGG + Intronic
912492718 1:110070736-110070758 CCGCGGGGGGCGGGGGGCGGGGG + Intronic
912818140 1:112846330-112846352 GAGCGCCGGGCCGGGCGCGGTGG - Intergenic
912836058 1:112997381-112997403 CAGGTCACGGCCGGGCGCGGTGG - Intergenic
913139731 1:115928787-115928809 CAGCGGGGGGCCGGGCGCGGTGG - Intergenic
913672951 1:121115527-121115549 AAGCGCAAGGCCGGGCGCGGTGG + Intergenic
914024728 1:143902903-143902925 AAGCGCAAGGCCGGGCGCGGTGG + Intergenic
914803028 1:150974381-150974403 AAGGGAGCGGCCGGGGCCGGCGG - Intronic
914869130 1:151458827-151458849 CGGCGGGCGCCGGGGGGCGGGGG + Intronic
915302821 1:154961449-154961471 GAGCGCGCTGCGAGGGGCGGGGG - Intronic
915698635 1:157769712-157769734 CAGGTTGCGGCCGGGCGCGGTGG - Intronic
916179146 1:162069541-162069563 CGTCGCGCGGCCGGGGGCGCGGG + Intergenic
916548436 1:165828045-165828067 TGGAGCGCGGCCGGGAGCGGAGG - Intronic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
916666924 1:166975339-166975361 CACCCCGCGGCAGCGGGCGGCGG + Intronic
916879795 1:169009131-169009153 AAGCTAGCGGCCGGGCGCGGTGG - Intergenic
917044758 1:170847062-170847084 CATAGTGCGGCCGGGCGCGGTGG - Intergenic
917105320 1:171485792-171485814 CAGAGTGCGGCCTGGGGCGTGGG + Intronic
917603349 1:176600387-176600409 CAGAGCTCGGCCGGGCGCGGTGG + Intronic
917968314 1:180192266-180192288 CAGAGACAGGCCGGGGGCGGAGG + Intronic
918244015 1:182643320-182643342 CAGCGCGGGGGCGGGGGGGCTGG - Intergenic
918479938 1:184967914-184967936 CAACTCACGGCCGGGCGCGGTGG + Intronic
918487615 1:185045795-185045817 GCGAGAGCGGCCGGGGGCGGCGG - Intronic
918629492 1:186699258-186699280 CTGGGCCCGGCCGGGCGCGGTGG + Intergenic
918821020 1:189254141-189254163 CAGAACGGGGCAGGGGGCGGGGG + Intergenic
919789721 1:201283431-201283453 CAGCGCGCGGCCCGGTGGAGTGG + Exonic
919981087 1:202643317-202643339 GAGGGCGGGGGCGGGGGCGGGGG + Exonic
920184592 1:204152085-204152107 CGGCCCGCGGGCCGGGGCGGGGG - Intergenic
920498289 1:206470708-206470730 CAGCGTGCGGAGGGGGGTGGGGG + Intronic
921023736 1:211259310-211259332 CTGCGCGGGGCGGGCGGCGGCGG + Intronic
921096290 1:211889686-211889708 CAGCCCACGGCGGGGGGCGTGGG - Intergenic
921204961 1:212840903-212840925 GAGCGCGGAGCCGGGTGCGGTGG - Intronic
922196475 1:223364194-223364216 GAGCGCGCGGGCGGGGGAGCTGG - Intronic
922254800 1:223884713-223884735 CTGGGCGTGGCCGGGCGCGGTGG + Intergenic
922496573 1:226062407-226062429 GAGTGCAGGGCCGGGGGCGGGGG + Intronic
922584083 1:226720762-226720784 CCGGGCGCGGCCGGGCGTGGTGG + Intronic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
922958621 1:229626016-229626038 CAGAGCGGCGGCGGGGGCGGCGG - Exonic
923056098 1:230426484-230426506 GGGCGCGCGGCCGGGGCTGGCGG + Intergenic
923400781 1:233614079-233614101 CCGGGCGGGGGCGGGGGCGGCGG + Exonic
923684139 1:236142391-236142413 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923684149 1:236142411-236142433 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923744301 1:236686403-236686425 ACGGGCGGGGCCGGGGGCGGTGG + Intergenic
924037922 1:239955079-239955101 AAGGACGCGGGCGGGGGCGGGGG - Intergenic
924443713 1:244108468-244108490 CACGTCGCGGCCGGGCGCGGTGG - Intergenic
924736029 1:246757054-246757076 CAGTGCTAGGCCGGGCGCGGTGG + Intronic
1062760133 10:11632-11654 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1063407873 10:5813679-5813701 CGGCGCGCGGGCCGGGGTGGAGG + Intronic
1063418236 10:5890296-5890318 CGGCGCGGGCCCGGCGGCGGCGG + Intronic
1063664719 10:8054465-8054487 CAGAGGGCGGCCGCCGGCGGAGG - Intronic
1064034604 10:11905209-11905231 CAAAGCGTGGCCGGGCGCGGTGG + Intergenic
1064059674 10:12127562-12127584 CAGCAAGCGGCGGGGGGTGGGGG - Intergenic
1064208960 10:13347762-13347784 CCGCGCGGGGCCGGGGAAGGAGG - Intronic
1064362707 10:14680284-14680306 CAGAGAGGGGCCGGGTGCGGTGG + Intronic
1064483945 10:15766168-15766190 CTGCCCGGGGCCGGGCGCGGTGG - Intergenic
1065101652 10:22336800-22336822 CAGGGCCCAGCCGGGGGCGCTGG - Intergenic
1065342987 10:24723711-24723733 GAGCGGCCGGCCGGGGGCGGCGG - Intergenic
1065590979 10:27260459-27260481 CAGGGTGAGGCCGGGCGCGGTGG - Intergenic
1065712616 10:28532679-28532701 CAGCGCAGGGGCGGGGGCCGCGG + Intronic
1066437911 10:35411223-35411245 CAGCGATAGGCCGGGTGCGGTGG + Intronic
1066465143 10:35643423-35643445 CTGCGGGCGGCCCGGGCCGGCGG + Intergenic
1067091301 10:43266902-43266924 CAGCGCGCGGCCGGCGCCGGCGG + Intronic
1067141378 10:43659891-43659913 CGGCTTGCGGCCGGGCGCGGTGG + Intergenic
1067344434 10:45427558-45427580 CTGCGCGCGGGCGCGGTCGGTGG + Intronic
1067572778 10:47384164-47384186 CCGCGAGCGGGCGCGGGCGGCGG - Intronic
1067865028 10:49895691-49895713 CAGTTCTCGGCCGGGCGCGGTGG - Intronic
1068055886 10:52012527-52012549 CTGGGCGCGGCTGGGCGCGGTGG - Intronic
1068731470 10:60363072-60363094 CGGCGGGCGGGCGGGGGAGGGGG + Intronic
1069283784 10:66688682-66688704 CAGAGACCGGCCGGGCGCGGTGG + Intronic
1069439036 10:68411242-68411264 CAAAGCGTGGCCGGGCGCGGTGG - Intergenic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1070570796 10:77638205-77638227 CCGAGCGCAGCCGGGGGAGGAGG - Intronic
1071309530 10:84329043-84329065 CAGCGCGGGGCCTCGGGCCGCGG + Intronic
1072654636 10:97321243-97321265 CGGAGCGCGGCCAGGGGCGGTGG - Exonic
1073043238 10:100621502-100621524 CTGGGCGGGGGCGGGGGCGGGGG - Intergenic
1073154787 10:101337741-101337763 CAGCGAGAGGCTGGGCGCGGTGG - Intergenic
1073236387 10:102020387-102020409 CCGAGCACGGCCGGGCGCGGTGG + Intronic
1073916301 10:108408649-108408671 TAACGGGCGGCCGGGCGCGGTGG + Intergenic
1074265728 10:111901349-111901371 CAGCATTCGGCCGGGCGCGGTGG + Intergenic
1074786948 10:116849768-116849790 CAGCGCGGGGCGGGGGGAGAGGG - Intronic
1074864092 10:117535036-117535058 GTGCGTGTGGCCGGGGGCGGGGG + Intergenic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1075438303 10:122461082-122461104 CAGCGCGTGACCGGGGTCCGCGG + Intergenic
1075916082 10:126168764-126168786 TAGCGCACGGCCAGGCGCGGTGG + Intronic
1076371481 10:129958906-129958928 CGGCGGGCGGCGGGCGGCGGGGG - Intronic
1076372524 10:129964501-129964523 CGGTGCGTGGCGGGGGGCGGCGG - Intergenic
1076792300 10:132784099-132784121 CAGCGCCCAGCCGGGGGCTCGGG - Intergenic
1076792856 10:132786052-132786074 CAGCGCGGGGCGCGGGGCGCGGG + Exonic
1076807571 10:132866658-132866680 GAGCCCCCGGCCTGGGGCGGTGG + Intronic
1076853749 10:133105348-133105370 CAGAGCTGGGCCGGGGACGGGGG - Intronic
1076878674 10:133229840-133229862 CTGAGCCCGGGCGGGGGCGGCGG + Intergenic
1077009217 11:372788-372810 CAGGGCGGGGGCTGGGGCGGGGG + Intronic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077018478 11:407186-407208 CGGCGCAGGGGCGGGGGCGGGGG + Intronic
1077018577 11:407425-407447 CAGCGCGCGGCAGGAGGTCGCGG + Exonic
1077090720 11:777202-777224 CGGGGCGGGGACGGGGGCGGGGG - Intronic
1077227181 11:1443466-1443488 CTGCGGGCGGCCGGGTGTGGGGG - Intronic
1077285630 11:1764047-1764069 CAGCGCCCGGGCGGGGGGCGGGG + Intergenic
1077923109 11:6655897-6655919 CGGAGCGCGGGTGGGGGCGGGGG - Intergenic
1079217474 11:18526717-18526739 CAGGGCGCGGAAGGGAGCGGTGG + Intronic
1079344077 11:19636755-19636777 CAGAACTCGGCCGGGTGCGGTGG - Intronic
1080034895 11:27700529-27700551 GAGCGGGGGGCGGGGGGCGGGGG - Intronic
1080802138 11:35618778-35618800 CGGCGCCCGGCCCGGAGCGGCGG + Exonic
1081410068 11:42747281-42747303 CAGTGAGTGGCCGGGTGCGGTGG + Intergenic
1081576251 11:44320092-44320114 ATGCGCGGGGCGGGGGGCGGGGG - Intergenic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1082053940 11:47797312-47797334 CAGGGTGGGGCGGGGGGCGGAGG - Intronic
1082833614 11:57637555-57637577 CAGGGCGAGGCTGGGCGCGGTGG - Intergenic
1082838171 11:57667102-57667124 GAGCGCGCGACCTGAGGCGGTGG - Intergenic
1083315665 11:61813676-61813698 CTGCTCCCGGCCGGGCGCGGTGG + Intronic
1083329656 11:61891608-61891630 CGGGGCCTGGCCGGGGGCGGGGG - Intronic
1083454018 11:62766072-62766094 CAGCTCTCGGCCAGGCGCGGTGG - Intronic
1083474008 11:62904023-62904045 CAGAGAGAGGCCGGGCGCGGTGG - Intergenic
1083657001 11:64234604-64234626 GGGCGGGCGGCCGGTGGCGGCGG - Exonic
1083729089 11:64643345-64643367 GAGGGAGCGGCCGGGGGAGGGGG + Intronic
1083753668 11:64777989-64778011 CCGGGCCCGGCCGGCGGCGGAGG - Exonic
1083753751 11:64778229-64778251 GAGCCCACGGGCGGGGGCGGCGG + Exonic
1083853826 11:65382378-65382400 CAGAGAGAGGCCGGGTGCGGAGG + Intronic
1083881505 11:65551188-65551210 CAGCGCATGGTCGGGGGCGAGGG + Exonic
1084070132 11:66728358-66728380 CGGCGCGCGGGCGCGAGCGGCGG + Intronic
1084145219 11:67261618-67261640 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1084146155 11:67266435-67266457 GGGCGCGCGGGCGGCGGCGGCGG + Exonic
1085574254 11:77588744-77588766 CCGGGCGCGGCTGGGCGCGGTGG - Intronic
1085676236 11:78521501-78521523 AAGCCCGGGGCCGGGCGCGGTGG + Intronic
1086887744 11:92224602-92224624 GGGCGCGCGGGAGGGGGCGGCGG - Intergenic
1087556388 11:99727017-99727039 CAGGGCATGGCCGGGCGCGGTGG + Intronic
1088034018 11:105290099-105290121 CTGGGCGTGGCCGGGCGCGGTGG + Intergenic
1088244962 11:107809008-107809030 CAGCGTGGGGCCGGGGCCTGAGG - Intronic
1089700213 11:120240109-120240131 GAGCACGCGGCGCGGGGCGGGGG - Intronic
1089789026 11:120929229-120929251 CAGCCCGCGGCGGGTGGCGTGGG + Intronic
1089796561 11:120985966-120985988 CGGCGCGCCGCCGGCGGGGGTGG - Exonic
1090211061 11:124921336-124921358 CGGCGAGCGGCCGGGCACGGCGG + Exonic
1091161656 11:133427403-133427425 CAGAGCGGGGCCGGGGGTGGGGG + Intronic
1091373369 12:11180-11202 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1091496758 12:979758-979780 CAGCTCTTGGCCGGGTGCGGTGG + Intronic
1091567899 12:1661872-1661894 CGGCGGGGGGCGGGGGGCGGGGG + Intergenic
1091722026 12:2820646-2820668 CAGAGAACGGCAGGGGGCGGTGG - Intronic
1092159848 12:6310388-6310410 CGGGGCGCCGCCGGGGGAGGCGG - Intergenic
1092159945 12:6310681-6310703 CAGCGCGGGTCCGGGCGAGGAGG - Intronic
1092475841 12:8818466-8818488 CTGAGCTGGGCCGGGGGCGGTGG - Intergenic
1092537961 12:9404599-9404621 CACCGCGAGGCGGGGGGGGGGGG + Intergenic
1092539789 12:9413627-9413649 CAGAGAGGGGCGGGGGGCGGGGG + Intergenic
1092825367 12:12394036-12394058 TAGCCCTCGGCCGGGTGCGGTGG + Intronic
1094470475 12:30796990-30797012 CAGCTCCGGGCCGGGGGTGGAGG + Intergenic
1095261665 12:40105633-40105655 CAGAGCGCGGGCGCGGGCGGCGG - Exonic
1095812250 12:46383535-46383557 CCGCGCGCGGGCTGGGGAGGCGG - Intergenic
1096214324 12:49791239-49791261 CAGTGCGGGGCTGGGGGCTGGGG + Exonic
1096435886 12:51591041-51591063 CAGGGAGGGGGCGGGGGCGGTGG + Intronic
1096461136 12:51821851-51821873 AGGAGCGCGGCCGGGGGCGGCGG + Intergenic
1096674681 12:53220162-53220184 CGGGGCGCCGCCGGGGGAGGAGG - Intronic
1096695319 12:53344990-53345012 CAGCCCGGGGGAGGGGGCGGCGG + Intronic
1096698231 12:53364642-53364664 TAGCCGGCGGCCGGGCGCGGTGG - Intergenic
1096747857 12:53739954-53739976 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1096747870 12:53739979-53740001 GAGGGCGAGGGCGGGGGCGGGGG + Intergenic
1096752212 12:53767963-53767985 CAGCACTCGGCCGGGCGTGGTGG + Intergenic
1096784407 12:54009033-54009055 CGGCGAGCGGGCGGCGGCGGCGG - Intronic
1096976535 12:55702453-55702475 CCGGGCGTGGCCGGGTGCGGTGG - Intronic
1097021400 12:56023084-56023106 CTGAGGGCGGCCGGGCGCGGTGG - Intronic
1097107695 12:56635029-56635051 CAGCCCTGGGCCGGCGGCGGCGG + Intronic
1097191201 12:57220389-57220411 AGGCGCGGGGCGGGGGGCGGGGG + Intronic
1097678984 12:62631901-62631923 CAGCGCGGGGGCGGGGGTGTAGG + Intergenic
1097863940 12:64543529-64543551 GAGCCCACGGCGGGGGGCGGGGG - Intergenic
1098024710 12:66189442-66189464 CGGGGACCGGCCGGGGGCGGCGG + Intronic
1098369308 12:69739416-69739438 GCGGGCGCGGCCGGGAGCGGAGG + Exonic
1098587031 12:72165960-72165982 CATTTCTCGGCCGGGGGCGGTGG - Intronic
1098879440 12:75902209-75902231 AAGAGCCCGGCCGGGCGCGGTGG + Intergenic
1099312972 12:81050670-81050692 CATAGAGCGGCCGGGCGCGGTGG - Intronic
1099989554 12:89708555-89708577 CCGCCCGCGGCCGGGGGCGGCGG - Intronic
1100640422 12:96477160-96477182 CAAGGCACGGCCGGGCGCGGCGG - Intergenic
1100869418 12:98894924-98894946 GGGCGCGCGGCGGGGGGTGGGGG - Intronic
1101587515 12:106097998-106098020 CAGCTCGTGGCCAGGGGCAGTGG - Intronic
1101605535 12:106245880-106245902 CAGAGCACGGCCGGGCGTGGTGG - Intronic
1102043331 12:109814751-109814773 CCGCGCGGGGCCCGGGGAGGTGG - Exonic
1102043368 12:109814855-109814877 CAGAACCCGGCCAGGGGCGGGGG + Exonic
1102349951 12:112184769-112184791 CAGCAAGCGGCTGTGGGCGGTGG + Exonic
1102644624 12:114396140-114396162 CGAGCCGCGGCCGGGGGCGGGGG + Intronic
1102680184 12:114685668-114685690 CAGCGCCCGGTCGGGGTCAGAGG + Intergenic
1102892569 12:116571766-116571788 CAGTCCGTGGCCGGGCGCGGTGG - Intergenic
1102925232 12:116821301-116821323 CAGCGCCCGGCCAGGAGGGGTGG - Intronic
1102933579 12:116879829-116879851 CGGCGCGCGGCGGGGCTCGGGGG + Intronic
1103044495 12:117724581-117724603 CTGCAGGCGGCCGGGGGTGGGGG - Intronic
1103074260 12:117969299-117969321 CAGCCTGCTCCCGGGGGCGGCGG + Intergenic
1103096433 12:118136366-118136388 CAGCGAGCGGCACGGCGCGGAGG + Intronic
1103348291 12:120265529-120265551 CAGCGAGCGGCAGGGGCCGCGGG - Intronic
1103376353 12:120459144-120459166 TAGCTCACGGCCGGGTGCGGTGG - Intronic
1103433065 12:120904240-120904262 CCGCGCTCGGGCGGCGGCGGCGG + Exonic
1103474647 12:121209885-121209907 GGGCGAGGGGCCGGGGGCGGTGG - Intronic
1103488165 12:121296650-121296672 CAGAGCGCGGGAGGCGGCGGCGG - Intronic
1103527657 12:121578771-121578793 CAGAGGGCGGCCCGGGGTGGGGG + Intronic
1103684258 12:122719345-122719367 CAGAGCATGGCCGGGCGCGGTGG + Intergenic
1103698549 12:122835660-122835682 CGGCGGGCGGCGGGCGGCGGCGG + Intronic
1103779320 12:123388913-123388935 CGGCGCCCGGCCCGGGGAGGGGG - Intronic
1104376181 12:128267093-128267115 CGGGGCCCGGGCGGGGGCGGGGG + Intergenic
1104444717 12:128823877-128823899 GGGCGCGCGGCGGGCGGCGGCGG - Exonic
1104602511 12:130162874-130162896 CAGCCCGTGCCCGGGAGCGGCGG + Exonic
1104721058 12:131045462-131045484 CAGCGCACGCCCGGGAGCTGCGG + Intronic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104980135 12:132570033-132570055 CAGGGCGCGGCATGGGGCGCGGG - Exonic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105407202 13:20142499-20142521 CGGCGGGCGGCCGGGAGCTGGGG + Exonic
1105492754 13:20903642-20903664 AAGCGTTCGGCCGGGGGCGGTGG - Intergenic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1105552913 13:21414656-21414678 CAGCCCTAGGCCGGGCGCGGTGG - Intronic
1105845715 13:24292041-24292063 CAGAGAGAGGCCGGGCGCGGTGG - Intronic
1105984144 13:25549170-25549192 CCGGGCCCGGCCGGGCGCGGTGG + Intronic
1106057762 13:26254422-26254444 CAGAGGCCGGCCGGGGGTGGAGG - Exonic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1106296597 13:28419590-28419612 CATCCAGCGGCCGGGTGCGGTGG + Intronic
1106537807 13:30663222-30663244 CAGTCCTCGGCCGGGCGCGGTGG - Intergenic
1107054944 13:36092771-36092793 CCTCTCGCGGCCGGGCGCGGTGG - Intronic
1107133502 13:36920313-36920335 GAGCGCGCGGCGGCGGGCGGGGG - Intronic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1107549045 13:41457963-41457985 CCGCGCGCGCCCGGGGTTGGGGG + Intronic
1107674822 13:42784528-42784550 CAGTTCTCGGCCGGGCGCGGTGG + Intronic
1108292555 13:48976050-48976072 CAGCGCGCCGGCGGCCGCGGCGG + Intronic
1108689297 13:52847431-52847453 CAGCGCGGGGCCCGGGTCCGCGG + Exonic
1108695358 13:52897987-52898009 CAGCTCCCAGCCGGGCGCGGTGG - Intergenic
1110064559 13:71087514-71087536 CACTGCGCGGGCGGGGGGGGGGG - Intergenic
1110219587 13:73059227-73059249 CAGCGCGGGGCTGCCGGCGGAGG - Exonic
1110471673 13:75866731-75866753 CAGGGAGAGGCCGGGCGCGGTGG - Intergenic
1110711815 13:78658769-78658791 CAGTGTGAGGCCGCGGGCGGTGG + Intronic
1112506334 13:99978553-99978575 CCGCGCGCGGCCGGGCGGTGGGG - Intergenic
1113085762 13:106567979-106568001 CAGCCCGCGTCCGAAGGCGGAGG - Exonic
1113312016 13:109140936-109140958 CAGCGCCAGGCCGGGGGACGCGG - Exonic
1113312034 13:109140998-109141020 CCGGGCGGGGGCGGGGGCGGGGG - Exonic
1113541783 13:111115164-111115186 CCGCGCACGGCCTGGAGCGGAGG + Intronic
1113643711 13:111976688-111976710 CAGGGCGCGGCCTGGGTGGGTGG + Intergenic
1113723330 13:112578270-112578292 CTGCTCTCGGCCGGGCGCGGTGG + Intronic
1113752302 13:112784808-112784830 CAGAACGCGGCCGGGCGCGGCGG - Intronic
1113914805 13:113863873-113863895 CGGCGCGCGGCGCAGGGCGGCGG + Exonic
1113962152 13:114132241-114132263 CAGCCCGAGGCCCGGGGAGGCGG + Intronic
1114474483 14:22984084-22984106 CAGCCAACGGCCGGGAGCGGTGG + Intergenic
1114514050 14:23286068-23286090 CGGCGCGCTCCCGGGGACGGTGG - Exonic
1114554056 14:23551388-23551410 CAGCGCGAGGCGGGGAGGGGAGG + Exonic
1114559751 14:23581030-23581052 GAGCCCACGGCCGGGGGAGGGGG - Intergenic
1115851236 14:37591951-37591973 CAGCCGGGGGCCGGCGGCGGGGG - Exonic
1116067293 14:40000916-40000938 AAGTGTGCGGCCGGGCGCGGTGG + Intergenic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1116886935 14:50231315-50231337 CAGCCCGCGGGCCGGGCCGGTGG + Exonic
1117843216 14:59882097-59882119 CAGGGAGAGGCTGGGGGCGGTGG - Intergenic
1118873803 14:69766160-69766182 CAGCTTGAGGCCGGGCGCGGTGG + Exonic
1119261059 14:73238108-73238130 CAGAGGGGGGCCGTGGGCGGGGG + Intronic
1119289026 14:73479715-73479737 CTGGGCGTGGCCGGGAGCGGAGG - Intronic
1119357503 14:74019296-74019318 CGGCGCGCGGGGTGGGGCGGAGG - Exonic
1120528663 14:85606807-85606829 CAGCTAACGGCCGGGTGCGGTGG - Intronic
1120753538 14:88220128-88220150 TAGAGCGTGGCCGGGCGCGGTGG + Intronic
1120905690 14:89619174-89619196 CGGCGCCCGCCCGGGGTCGGCGG + Intergenic
1121074928 14:91060244-91060266 CCGCGCGGGGCTGGGGGCGCGGG - Intronic
1121192491 14:92042629-92042651 CAGAGCCCGGCCGGGCGCAGTGG + Exonic
1122159252 14:99771069-99771091 CAGTGGGAGGCCGGGCGCGGTGG - Intronic
1122275213 14:100587446-100587468 CTGCGCGGGGCCGGGGCTGGCGG - Intergenic
1122444941 14:101761567-101761589 CGGGGCGGGGCCGGGCGCGGGGG + Intergenic
1122445163 14:101762194-101762216 GAGGGCGCGGCCCGGGGAGGGGG + Intronic
1122523543 14:102363407-102363429 CAGGGTGGGGCCGGGGGCCGAGG - Intronic
1122666722 14:103334843-103334865 CATCGCGCGCTCTGGGGCGGGGG + Intronic
1122874345 14:104656643-104656665 CAGCGCGGGAGCGGGGGCGGGGG + Intergenic
1122904583 14:104795833-104795855 CACCGCGCGGCCGGCGGCGAGGG + Intergenic
1122917391 14:104865381-104865403 CAGCGCTCGGCCGGGCGGGCGGG + Exonic
1122975296 14:105168447-105168469 CCGGGCGCGGGCGGCGGCGGCGG - Exonic
1122975344 14:105168587-105168609 CGGCGCGCGGGCCTGGGCGGCGG + Exonic
1123037768 14:105478374-105478396 CGCGGCGCGGGCGGGGGCGGGGG + Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1123684667 15:22788212-22788234 CATCTTGCGGCCGGGCGCGGTGG + Intronic
1124109481 15:26773045-26773067 CAGCGCGGCGGCGGCGGCGGCGG - Exonic
1124207846 15:27738446-27738468 CAACGCCGGGCCGGGCGCGGTGG + Intergenic
1124605732 15:31169234-31169256 GAGCATGCGGCCGGGCGCGGTGG + Intergenic
1125181836 15:36887518-36887540 CAGCCAGCGGCGGGGGGCGAGGG + Intergenic
1125603635 15:40928393-40928415 CAGGGCGCGGCCGGGGGCTTGGG + Intergenic
1125916579 15:43493134-43493156 GAGTTCGCGGCCGGTGGCGGCGG - Exonic
1125983651 15:44027929-44027951 CAGCACAGGGCCGGGCGCGGTGG - Intronic
1127119560 15:55759272-55759294 TGGTGCGCGGCCGGGTGCGGTGG - Intergenic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1127557249 15:60099675-60099697 CAGAGGGCGGCCGGGCGCGGTGG + Intergenic
1128135045 15:65256692-65256714 CTGTGGGCGGCCGGGCGCGGTGG - Intronic
1128315835 15:66658669-66658691 CAGCTCTCGGCCGGGCGTGGTGG - Intronic
1128944613 15:71812050-71812072 CTGCGCCCTGCCGGGGCCGGGGG - Exonic
1129203047 15:74017082-74017104 CACTGCCCGGCCGGGCGCGGCGG - Intronic
1129322293 15:74782059-74782081 AGGCGCGCTGCCGCGGGCGGAGG + Exonic
1129348278 15:74938164-74938186 CACCGCGCGGCCGGCGGCGGCGG + Exonic
1129357445 15:75000971-75000993 CAGCTCCAGGCCGGGCGCGGTGG + Intronic
1129483026 15:75843124-75843146 CGGCTCCAGGCCGGGGGCGGGGG + Intergenic
1129483377 15:75844423-75844445 CAGCGCGCAGCCAGGCCCGGGGG - Intronic
1129667908 15:77589811-77589833 CAGGGGTCGGCGGGGGGCGGTGG + Intergenic
1129676001 15:77632688-77632710 CGCCGCGGGGCCGGGGCCGGCGG + Intronic
1129854029 15:78811529-78811551 CGGGGCGGGGCCAGGGGCGGGGG - Intronic
1130115418 15:81001385-81001407 CAGAGCGCGGCCCGGCGCCGCGG - Exonic
1130551791 15:84894082-84894104 CAGGGAGAGGCCGGGCGCGGTGG + Intronic
1131052024 15:89354694-89354716 CAGCTCCTGGCCGGGCGCGGTGG - Intergenic
1131186040 15:90275057-90275079 GAGCGCGCGGGCCCGGGCGGCGG - Exonic
1131513997 15:93065643-93065665 CTGCGGGCTGCCGGGGGCCGGGG + Intronic
1131517578 15:93089246-93089268 CCGCGCTCGGCGGCGGGCGGGGG - Intergenic
1131692783 15:94844995-94845017 CCGAGCGCGGCGGGAGGCGGCGG + Intergenic
1131950490 15:97675953-97675975 CAACGTGTGGCCGGGCGCGGTGG + Intergenic
1132186918 15:99808240-99808262 CAGCGCGCGGCCAGGCCCCGGGG - Intergenic
1132314049 15:100878264-100878286 CAGCACCCAGCCGGGGGCCGTGG + Intronic
1132365351 15:101252392-101252414 GAGCGCGGGGCCGGGAGCGCGGG - Intergenic
1132428771 15:101744481-101744503 CAGCGCGCGGCCAGGCCCCGGGG + Exonic
1132481106 16:166502-166524 CAGCGCGCAGCCGGGGTGGGGGG + Intronic
1132499872 16:280540-280562 CCGGGCGCGGCTGGGCGCGGGGG + Intronic
1132527728 16:425932-425954 CAGGGCGCGGCGGCGGGCGCGGG - Exonic
1132552770 16:560238-560260 GAGTGCGCGCCAGGGGGCGGCGG + Intergenic
1132571151 16:644725-644747 CAGGGCAGGGCCGGGCGCGGTGG - Intronic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1132583413 16:695322-695344 CTGCACGGGGCCGGGGGCGGGGG - Intronic
1132683667 16:1153569-1153591 GAGGGGGCGGGCGGGGGCGGGGG + Intronic
1132683813 16:1154051-1154073 CGGCGGGGGGCGGGGGGCGGGGG + Intronic
1132703872 16:1232980-1233002 GAGCGGGTGGCCGGGCGCGGTGG + Intergenic
1132903220 16:2269425-2269447 CCGCCCTCGGCCGGGGGCGGTGG - Intergenic
1132942167 16:2513784-2513806 CAGGGCGGGGCCGGGCGCCGGGG + Intronic
1132942412 16:2514583-2514605 CAGTGCGCGGGCGGCGGCGCGGG + Intronic
1132947138 16:2537960-2537982 CGGGGCGGCGCCGGGGGCGGGGG + Exonic
1132987817 16:2777189-2777211 CCGGGCCGGGCCGGGGGCGGCGG - Intronic
1133197078 16:4178666-4178688 CAGGGCGTGGCCGGGTGCAGTGG - Intergenic
1133701739 16:8315548-8315570 CACCTCTCGGCCGGGAGCGGTGG + Intergenic
1133784381 16:8963440-8963462 CGGCCCGCGGCGGGCGGCGGCGG + Exonic
1134849796 16:17470603-17470625 CGGCGCGGGGCCGGGGCCGGGGG + Exonic
1135064989 16:19301876-19301898 CAGTGTGAGGCCGGGCGCGGTGG - Intronic
1135116756 16:19730241-19730263 CAGCAAGAGGCCGGGTGCGGTGG - Intronic
1135302211 16:21340374-21340396 CAGGTCGAGGCCGGGCGCGGTGG + Intergenic
1135422137 16:22312577-22312599 CAAGGCGCGGCCGGGCGCAGTGG + Intronic
1136347170 16:29683644-29683666 CAATGCTCGGCCAGGGGCGGTGG - Intronic
1136365192 16:29806438-29806460 CCCCGCGGGGCCGGGGCCGGGGG - Intronic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136913092 16:34159906-34159928 CAGCGCGGGGCGGTGGGAGGGGG - Intergenic
1137280549 16:46973277-46973299 CTGCGGGCGGGCGGGGCCGGCGG + Intronic
1137328076 16:47461344-47461366 GAGCGCGATGGCGGGGGCGGCGG + Exonic
1137454732 16:48609742-48609764 CCGCGGGCGCGCGGGGGCGGCGG + Intronic
1137655269 16:50153577-50153599 CTGCGGGCGGCCGGGAGGGGCGG + Intronic
1137656142 16:50159525-50159547 CAGAGAGAGGCCGGGCGCGGTGG - Intronic
1138104818 16:54282388-54282410 CGGCGCGCGGCCGGGTGTAGAGG + Intergenic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1138196609 16:55056980-55057002 CAGCGGCCGGCGGGCGGCGGCGG - Intergenic
1138247575 16:55479120-55479142 CAGAGCGGGGCTGGGGGCGGGGG - Exonic
1138360787 16:56425560-56425582 CAGCGTCCCGCTGGGGGCGGCGG - Intergenic
1140088429 16:71817226-71817248 CAGCCCTAGGCCGGGCGCGGTGG + Intergenic
1140128237 16:72135502-72135524 CAGCTGACGGCCGGGTGCGGTGG - Intronic
1140189484 16:72803042-72803064 CAGCTGTCGGCCGGGTGCGGTGG + Intronic
1140462166 16:75148667-75148689 CTCCGCGCGGCCTGGGGCCGAGG + Intronic
1140826318 16:78710016-78710038 CAACTATCGGCCGGGGGCGGTGG - Intronic
1140906471 16:79413518-79413540 CACAGCTCGGCCGGGCGCGGTGG - Intergenic
1141054644 16:80804093-80804115 CAGCGGGCGGCGGCGGGCGGCGG - Intronic
1141430491 16:83968422-83968444 CCGCGCCCGGCCGGCGGGGGTGG + Intergenic
1141516456 16:84548264-84548286 CAGCACACGGCTGGGCGCGGTGG + Intronic
1141531249 16:84648503-84648525 AAGTGCGAGGCCGAGGGCGGAGG - Exonic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1141959189 16:87392822-87392844 CAGCGCGCTTGCGGGGGCGGCGG - Intronic
1141989649 16:87602684-87602706 CTGCGGGCGCCCGAGGGCGGCGG - Intronic
1142008017 16:87699404-87699426 CAGGGCAGGGCCGGGCGCGGTGG + Intronic
1142009305 16:87705783-87705805 CAGGGCCTGGGCGGGGGCGGGGG + Intronic
1142009310 16:87705789-87705811 CTGGGCGGGGGCGGGGGCGGGGG + Intronic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1142188533 16:88706338-88706360 CAGCGGGCGGCGGGCGGCGCGGG - Exonic
1142189397 16:88710877-88710899 CAGGGCTCGGCTGGGGGTGGTGG + Intronic
1142209892 16:88803992-88804014 CTGGTCGCGTCCGGGGGCGGCGG - Exonic
1142228655 16:88889259-88889281 CAGGGCGTGGGAGGGGGCGGAGG + Intronic
1142240371 16:88941914-88941936 GAGCGCGGGGCAGGGGGCGGGGG - Intronic
1142299760 16:89249636-89249658 AAGCACGAGGCCGGGCGCGGTGG + Intergenic
1142333410 16:89470700-89470722 CCGGGCGTGGCCGGGCGCGGTGG + Intronic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1142396801 16:89836690-89836712 TATCCCCCGGCCGGGGGCGGTGG + Intronic
1142403527 16:89873566-89873588 TCGCGCGGGGTCGGGGGCGGGGG - Intronic
1142719757 17:1768142-1768164 CAGTGAGGGGCCGGGCGCGGTGG + Intronic
1142764838 17:2059130-2059152 CAGCGCGGAGCCGGGGGAGGGGG - Exonic
1142795642 17:2304528-2304550 CAGGGGGCGGCCGGGCGCGGTGG - Intronic
1142859045 17:2749761-2749783 CGGCGCGCGGTCGGGGGGAGGGG + Intergenic
1142864309 17:2781095-2781117 CAGAGCGTGGCCGGGGCCAGGGG - Intronic
1142876315 17:2853715-2853737 CGGGGCGCGGCCCGGGCCGGCGG - Intronic
1143140581 17:4739878-4739900 GTGCGCGCGGCCGGGGCTGGCGG - Intronic
1143376278 17:6469446-6469468 CAGGGCTGGGCAGGGGGCGGAGG - Intronic
1143564516 17:7713490-7713512 CAGCTCCAGGCCGGGTGCGGTGG - Intergenic
1143749943 17:9021141-9021163 GAGCGCGCGGGCGGGGGAAGGGG - Intergenic
1143889884 17:10094753-10094775 CAGAGAGTGGCCGGGCGCGGTGG - Intronic
1143920440 17:10327286-10327308 TAGCAGGCGGCCGGGCGCGGTGG - Intronic
1144128115 17:12221139-12221161 GAGCCCACGGCGGGGGGCGGGGG - Intergenic
1144366551 17:14550148-14550170 AAGCAGGCGGCCGGGCGCGGTGG - Intergenic
1144500853 17:15786244-15786266 CGGGGGGCGGCCCGGGGCGGCGG - Intergenic
1144502344 17:15799595-15799617 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
1144756171 17:17681799-17681821 CAGCGAGCGCCGGGGCGCGGGGG + Intronic
1144764233 17:17724224-17724246 CTGCGCGCGGCGGCGGGCCGGGG - Intronic
1144870340 17:18365690-18365712 CTGTGCACGGCCGGGCGCGGTGG - Intergenic
1145163014 17:20588906-20588928 CGGGGGGCGGCCCGGGGCGGCGG - Intergenic
1145164521 17:20602254-20602276 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
1145225358 17:21123797-21123819 CAGCCCTCGGCCGGGCGCGGTGG + Intronic
1145750178 17:27349603-27349625 CCCCTCGCGGCCTGGGGCGGGGG - Intergenic
1145828226 17:27893279-27893301 CAGGCCGAGGCCGAGGGCGGGGG - Intronic
1145937978 17:28726273-28726295 GCGCGGGCGGCTGGGGGCGGGGG - Intronic
1145980119 17:29006065-29006087 CCGAGCGGGGCTGGGGGCGGGGG + Exonic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1146492349 17:33292121-33292143 CAGCCCGCGGCTGGCGGCAGCGG + Exonic
1146858524 17:36275782-36275804 CAGTTCTCGGCCGGGCGCGGTGG - Intronic
1146896645 17:36545876-36545898 CAGCGCTCGGCCTGGGGGAGGGG - Intronic
1147044472 17:37743084-37743106 CGGCGCGGGGCTGGGTGCGGAGG + Intronic
1147045639 17:37749928-37749950 CAGTGTGGGGCCGGGCGCGGTGG + Intergenic
1147088845 17:38079859-38079881 CAGTTCTCGGCCGGGCGCGGTGG - Intergenic
1147108363 17:38240666-38240688 CAGTTCTCGGCCGGGCGCGGTGG + Intergenic
1147382216 17:40062769-40062791 CGGGGCGCGGCAGGGGGCGGGGG + Intronic
1147681520 17:42250635-42250657 CATCACGAGGCCGGGCGCGGTGG + Intronic
1147702723 17:42405972-42405994 CGGCGCGAGGCCGGGCGCAGTGG - Intronic
1148035447 17:44656482-44656504 CAGCGCCCGGGCGGCGGAGGCGG + Exonic
1148271746 17:46266968-46266990 CGGCGCGCGGCCGGTTGGGGTGG - Intergenic
1148664182 17:49362173-49362195 CAGCGCGGGGCGGGCGGCAGGGG + Intronic
1148782587 17:50130062-50130084 GAGCGAGGGGGCGGGGGCGGGGG + Intergenic
1148792037 17:50178579-50178601 CAGCGTGCAGCAGGGGGCTGAGG - Intergenic
1148799236 17:50212781-50212803 CAGCTCTTGGCCGGGCGCGGTGG + Intergenic
1148854766 17:50572669-50572691 CTGCGCGGGGACGGGGGCGGTGG + Exonic
1149141693 17:53439032-53439054 CAGAGGTCGGCCGGGCGCGGTGG - Intergenic
1149296502 17:55265991-55266013 CTGTGCGGGGCAGGGGGCGGGGG + Intronic
1149923228 17:60678059-60678081 CGGAGGGCGGCCGGGGGCAGCGG + Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1150239823 17:63622571-63622593 CCGCCCGCGGCCGGGCGCTGTGG - Exonic
1150440522 17:65187708-65187730 CCGCGTGAGGCCGGGTGCGGTGG + Intronic
1150483037 17:65525131-65525153 CATTTCTCGGCCGGGGGCGGTGG + Intergenic
1150683941 17:67305190-67305212 GAGCTCCCGGCCGGGCGCGGTGG + Intergenic
1150764640 17:67993586-67993608 CGGCGCGCGGCCGGTTGGGGTGG + Intronic
1151237918 17:72734965-72734987 AAGCGCGGGGCCTGGGGTGGGGG - Intronic
1151307372 17:73271930-73271952 CAGCTCCAGGCCGGGCGCGGTGG + Intergenic
1151334783 17:73433574-73433596 CATCTCTCGGCCGGGCGCGGTGG - Intronic
1151438475 17:74113399-74113421 CACGGCGGGGGCGGGGGCGGGGG + Intergenic
1151558711 17:74859964-74859986 CAGCGTGGGGCGGGGGGCGCCGG - Intronic
1151708397 17:75784996-75785018 GCGCGCGCGGCGGGGGGGGGGGG - Intronic
1151780217 17:76240475-76240497 CATCACGCGGCCTGAGGCGGCGG - Intergenic
1151797051 17:76353496-76353518 GAGGGCCGGGCCGGGGGCGGCGG - Intronic
1152074921 17:78153195-78153217 GAGTGTGCGGCCGGGGACGGTGG + Intronic
1152099934 17:78295171-78295193 CAGTGTGAGGCCGGGCGCGGTGG + Intergenic
1152349689 17:79777924-79777946 CCGGGCGGGGGCGGGGGCGGGGG - Intergenic
1152349700 17:79777936-79777958 CCGCGCGGGGCCCCGGGCGGGGG - Intergenic
1152349756 17:79778062-79778084 CAGCGCGCGGGGGCGGGCGGCGG + Intergenic
1152407346 17:80105138-80105160 CAGGGCAGGGGCGGGGGCGGCGG + Intergenic
1152433102 17:80260504-80260526 CTGCGCGGGGCCGGCGGCGGCGG + Intergenic
1152433114 17:80260531-80260553 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433127 17:80260561-80260583 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433140 17:80260591-80260613 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433153 17:80260621-80260643 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433166 17:80260651-80260673 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433179 17:80260681-80260703 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433192 17:80260711-80260733 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433205 17:80260741-80260763 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433218 17:80260771-80260793 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152433231 17:80260801-80260823 CAGGGCGGGGCCGGCGGCGGCGG + Intergenic
1152468431 17:80477941-80477963 CTGCGCGCAGCCGGGGGCTGGGG + Intergenic
1152628838 17:81400553-81400575 CAGCCTGCGGCCCGGGGAGGAGG + Intronic
1152649905 17:81488034-81488056 CACGGCGCGCCCGGGGGCGCCGG - Intergenic
1152697428 17:81804097-81804119 CAGGGCGAGGGCGGCGGCGGAGG - Intergenic
1152697571 17:81804503-81804525 GGGGGCGCGGCTGGGGGCGGGGG + Intronic
1152700640 17:81817167-81817189 CACCTCGGGGCCGGGCGCGGTGG + Intergenic
1152703869 17:81833112-81833134 CCGGGCGGGGCCGGGCGCGGGGG - Intronic
1152744179 17:82031588-82031610 CGGCGGGGGGCGGGGGGCGGGGG - Intergenic
1152883333 17:82832988-82833010 AAGCGCCCTGCCGGGGGCTGAGG + Intronic
1152953040 18:11986-12008 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1152970706 18:158674-158696 CGGGGCGCGGCGGGAGGCGGCGG - Exonic
1153285205 18:3450114-3450136 GGGCGGGCGGCTGGGGGCGGAGG + Intronic
1153457230 18:5295275-5295297 CCTCCCGCGGCCGGGGGCGGGGG + Intronic
1153794493 18:8609749-8609771 CAGAGGCGGGCCGGGGGCGGCGG + Exonic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1153997549 18:10454885-10454907 CCGCACCCGGCCGGAGGCGGAGG + Exonic
1154160959 18:11980951-11980973 CAGCGCGCGGCGGTGGGGCGGGG + Intergenic
1154480900 18:14823291-14823313 AAGCACGTGGCCGGGCGCGGTGG - Intronic
1155150750 18:23121216-23121238 CAGGGGTCGGCCGGGTGCGGTGG - Intergenic
1155928955 18:31685614-31685636 CCCCGGGCGGGCGGGGGCGGCGG - Intronic
1156099675 18:33578492-33578514 AGGCGCGCGGGCGGTGGCGGCGG - Intergenic
1156710845 18:39943547-39943569 AAGCACGCGGCTGGGCGCGGTGG - Intergenic
1157279103 18:46334191-46334213 CGGGGCGCGGGCGCGGGCGGCGG - Intronic
1157279162 18:46334406-46334428 CCGCGGGCGGCCGGGGGCTCAGG + Intronic
1157376987 18:47176151-47176173 CGGGGCGCGGGCTGGGGCGGCGG - Intronic
1157386144 18:47261184-47261206 CGGCGGGCGGCGGGCGGCGGCGG - Intergenic
1157464287 18:47930757-47930779 CGGCCGGCGGCCGAGGGCGGAGG - Intronic
1157464452 18:47931278-47931300 CGGGGCGCGGCCGGGCGGGGCGG + Intergenic
1157473692 18:48008323-48008345 GGGCGCTGGGCCGGGGGCGGGGG + Intergenic
1157971335 18:52272738-52272760 CAGCTCTCAGCCGGGTGCGGTGG - Intergenic
1158876980 18:61743231-61743253 CAGCCAGCTGCCGGGGGCCGAGG - Intergenic
1158954273 18:62524037-62524059 CTGCGCGCGGCCCGGGGCGAGGG + Exonic
1159045553 18:63366573-63366595 CGGCGCGCGGCCCCGGGCGGGGG - Intronic
1159952709 18:74496596-74496618 GAGCGCGCGGTCGGGGGCGGAGG + Intronic
1160231044 18:77049204-77049226 CTGCCCTCGGCCGGGTGCGGTGG - Intronic
1160453447 18:78980165-78980187 CGGCGCGGGGCGCGGGGCGGCGG - Intergenic
1160577382 18:79864292-79864314 GTGAGCGCGGCCGGGGGTGGCGG + Intronic
1160603723 18:80033823-80033845 CAGTGTGCGGGCGGGGGGGGCGG - Intronic
1160675866 19:390948-390970 CAGGGCGGGGGCCGGGGCGGGGG - Intergenic
1160739637 19:680006-680028 GTGCGCGCGGGCCGGGGCGGGGG - Intronic
1160745333 19:708782-708804 GCGCGCGGGGCGGGGGGCGGCGG + Intergenic
1160776810 19:860437-860459 CCGCGCGGGGGCGGGGGGGGAGG - Intronic
1160814449 19:1028696-1028718 CAGCGGGGGGGCGGGGGTGGGGG + Intronic
1160828262 19:1090703-1090725 CAGATCCCGGCCGGGCGCGGTGG - Intronic
1160869123 19:1269090-1269112 CAGCGCGCGGCGGGGCGGGGCGG - Intronic
1160869852 19:1272332-1272354 CAGGGCGCGGCCTGCGGCCGGGG - Intronic
1160887010 19:1354849-1354871 CGGCGCGCGGCCGTGGACGCCGG + Intronic
1160935422 19:1592429-1592451 CAGGCCGCGGCCCGGGGCAGGGG + Intronic
1160935521 19:1592769-1592791 GCGCGCCCGGCTGGGGGCGGAGG - Intronic
1160936896 19:1600498-1600520 CTGTGCCCGGCCGGGCGCGGTGG - Intronic
1160947997 19:1652322-1652344 CGGCGCGTGGGGGGGGGCGGCGG + Exonic
1160958609 19:1706851-1706873 CAGAGGGGGGCCGGGCGCGGCGG + Intergenic
1160991982 19:1863780-1863802 CCGCGCGCGGCCGCCGGGGGCGG + Intergenic
1161025422 19:2034609-2034631 CAGCACCTGGCCGGGTGCGGTGG - Intronic
1161037949 19:2096029-2096051 AAGGGCGAGGCCGGGCGCGGTGG - Intronic
1161070546 19:2257787-2257809 CGGCTCTCGGCCGGGCGCGGTGG + Intronic
1161132017 19:2596069-2596091 TAGTGGGCGGCCGGGCGCGGTGG + Intronic
1161132310 19:2598233-2598255 TAGTGGGCGGCCGGGCGCGGTGG + Intronic
1161150107 19:2702872-2702894 CCGGGCGCGGGCGGGGCCGGGGG + Intergenic
1161215813 19:3094587-3094609 CAGGGCCGGGCCGGGGGCCGGGG + Exonic
1161273584 19:3403822-3403844 CCGGGCGCGGCGGGGGGTGGCGG - Intronic
1161325747 19:3663151-3663173 CAGCAGCCGGCCGGGCGCGGAGG - Intronic
1161333817 19:3700393-3700415 CCGCGCGCGGACGGCGGCGGGGG + Exonic
1161337213 19:3721185-3721207 CAGGGCAGGGCCGGGCGCGGTGG - Intronic
1161433500 19:4248154-4248176 CTGCGTGGGGCCGGGCGCGGTGG - Intronic
1161608811 19:5229658-5229680 CAGCGCGCCGCCGCGGAAGGTGG - Exonic
1161649975 19:5478322-5478344 CAGCGCGCTGCTGGGGGGGTGGG - Intergenic
1161703174 19:5805620-5805642 CAGCGCGTGGGGAGGGGCGGGGG + Intergenic
1161707592 19:5829371-5829393 CAGAGCGCGGGAGGGGTCGGCGG + Intergenic
1161779203 19:6279905-6279927 GAGCGGGCGGCCGGGATCGGCGG - Exonic
1161802675 19:6424637-6424659 CCGCCCGCCGGCGGGGGCGGGGG - Exonic
1161813393 19:6483931-6483953 CACCTCGTGGCCGGGTGCGGTGG + Intergenic
1162021357 19:7869918-7869940 CTGCGCGAGGGCGGCGGCGGCGG + Exonic
1162029239 19:7910196-7910218 CAGTGGGGGGCAGGGGGCGGTGG + Intronic
1162090887 19:8279320-8279342 CAGCTCTGGGCCGGGTGCGGTGG - Intronic
1162093120 19:8294158-8294180 CAGCTCTGGGCCGGGTGCGGTGG - Intronic
1162312145 19:9913909-9913931 CGGAGCCCGGCGGGGGGCGGGGG + Intronic
1162384501 19:10353135-10353157 CGGGGTTCGGCCGGGGGCGGCGG + Intronic
1162486067 19:10961203-10961225 CGGCGCGGGGCCGGGGAGGGCGG + Intronic
1162723836 19:12677963-12677985 CAGCTTGTGGCCGGGCGCGGTGG + Intronic
1162727066 19:12696150-12696172 GTGCGCGGGGCCGGGGGCCGGGG - Intronic
1162907552 19:13832803-13832825 CACCCAGCGGCCGGGCGCGGTGG + Intergenic
1162935236 19:13978700-13978722 CAGCGGGCGGGCGGGGGCGGGGG - Intronic
1163041691 19:14607488-14607510 CAGCTCCTGGCCGGGCGCGGTGG - Intronic
1163085882 19:14979593-14979615 AAGCGCCCGGCCGGGGCCGCGGG + Intronic
1163085934 19:14979740-14979762 CACCGAGCGGCCGGGGGAGGGGG + Intronic
1163089717 19:15011235-15011257 CTGCGCGCGGCCGAGGCGGGCGG - Exonic
1163138816 19:15332518-15332540 CAGTGCGCTGGCGGCGGCGGCGG - Intronic
1163601448 19:18251682-18251704 GAGGGCGGGGGCGGGGGCGGGGG - Intronic
1163607280 19:18281995-18282017 CCGGGCGGGGGCGGGGGCGGGGG + Intergenic
1163674144 19:18646951-18646973 CAGGGCGGGGGCAGGGGCGGCGG + Intronic
1163720439 19:18895967-18895989 CAGCGCGCTGGCGGCGGCGCGGG - Exonic
1163965596 19:20744529-20744551 AAGCTTGAGGCCGGGGGCGGTGG - Intronic
1164498701 19:28793663-28793685 CGGGGCTCGGCCGGGCGCGGCGG - Intergenic
1165205571 19:34182548-34182570 CAACTCTCGGCCGGGCGCGGTGG + Intronic
1165337333 19:35180506-35180528 CAGATCTCGGCCGGGCGCGGTGG - Intergenic
1165349523 19:35268525-35268547 CTGCGCGCGCGCGGCGGCGGCGG - Intergenic
1165349610 19:35268828-35268850 CGGCGGGCGGGCGGAGGCGGAGG + Intergenic
1165420071 19:35718091-35718113 CGGGGCGCCGGCGGGGGCGGGGG + Exonic
1165752807 19:38271202-38271224 GAGGGCGAGGCCGGGCGCGGTGG + Intronic
1165816802 19:38647619-38647641 CAGTGCGCAGGCGCGGGCGGAGG + Intergenic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1165876600 19:39012118-39012140 CAGGGCTCGGCCGGGCGTGGTGG - Intronic
1165928607 19:39342435-39342457 CAGCGCGACGGCGGCGGCGGCGG + Intronic
1165940749 19:39413632-39413654 CAGCGCGCAGCCCTCGGCGGGGG + Intronic
1166055563 19:40286093-40286115 CACCCTGCGGCCGGGCGCGGTGG + Intergenic
1166083268 19:40458302-40458324 AGGGGCGGGGCCGGGGGCGGGGG + Intronic
1166304261 19:41928604-41928626 CGGCGCGGGGGAGGGGGCGGGGG + Intronic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166529325 19:43533385-43533407 CGGCGCGCGTCCGGCGTCGGGGG - Exonic
1166602049 19:44104947-44104969 CAGGGCTCGGCTGGGCGCGGTGG - Intronic
1166682613 19:44778115-44778137 CGGCGGGCGGCCGGCGGAGGCGG + Exonic
1166694402 19:44844641-44844663 AAGCGGGAGGCCGGGGGAGGGGG - Intergenic
1166765171 19:45248665-45248687 CAGCATGTGGCCGGGCGCGGTGG - Intronic
1166772682 19:45293852-45293874 CAGCCTGGGGCCGGGGGTGGTGG + Intronic
1166852878 19:45768799-45768821 GAGCGCGGGGCCGGCGGCTGGGG - Exonic
1166913514 19:46177989-46178011 GAGAGCGTGGCCGGGTGCGGTGG + Intergenic
1167237138 19:48321941-48321963 CAGCGCGCGGACGTGGTAGGCGG - Intronic
1167401819 19:49277626-49277648 TAGCGGGCGGCCGGGTGCAGTGG + Intergenic
1167456379 19:49598359-49598381 CATCGGGAGGCCGGGCGCGGTGG - Intronic
1167466171 19:49652016-49652038 CAGGGCGAGGCCGGGGCGGGCGG - Exonic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1168072950 19:53962953-53962975 CAGAGCGCGGCCATGGTCGGCGG - Intergenic
1168339118 19:55613794-55613816 CGGCGGGGGGCCGGGGGCGCAGG - Exonic
1168400774 19:56085101-56085123 CAGCAGGGGGCCGGGGGTGGGGG + Intergenic
1168584087 19:57578716-57578738 CGGAGCGGGGCCGGGAGCGGCGG + Exonic
1202710754 1_KI270714v1_random:18293-18315 GGGCGGGCGGGCGGGGGCGGCGG + Intergenic
925009113 2:468491-468513 CAGGACGCAGCGGGGGGCGGGGG + Intergenic
925027505 2:621281-621303 CTGCGCGCGCCCCAGGGCGGAGG - Intergenic
925068905 2:951012-951034 CGGGAGGCGGCCGGGGGCGGGGG - Exonic
925609788 2:5693139-5693161 AAGAGCGCGGCCGGCGGCGGCGG + Exonic
926035296 2:9631116-9631138 GAGCGCGCGGAAGGGGGCGAGGG + Intergenic
926077254 2:9951511-9951533 CGGCGCGGGGCGGGGGGCGGGGG - Intergenic
926094631 2:10073215-10073237 CAGCCCACAGCCGGGGGGGGGGG - Intronic
926154969 2:10448538-10448560 GGGCGCGAAGCCGGGGGCGGGGG - Intergenic
926208356 2:10849970-10849992 TATTGAGCGGCCGGGGGCGGTGG - Intronic
926320675 2:11746680-11746702 CAGCGGGAGGCTGGAGGCGGCGG - Intronic
926791441 2:16575566-16575588 CAGTTCCCGGCCGGGCGCGGTGG + Intronic
927065058 2:19462887-19462909 GAGCTCTCGGCCGGGGGCAGTGG + Intergenic
927625694 2:24715853-24715875 CAGCAGGCGGCCGGGCGCAGTGG + Intronic
927637905 2:24829302-24829324 CAGTGGGGGGCCGGGCGCGGTGG - Intronic
927698406 2:25252415-25252437 CTGCGAGCGGCCCGGGGAGGGGG + Intronic
927714210 2:25341907-25341929 GGGCGCGCGGGCGGCGGCGGCGG - Intronic
927917958 2:26948569-26948591 CAGCCCCTGGCCGGGTGCGGTGG + Exonic
928096140 2:28406347-28406369 GAGAGCGTGGCCGGGCGCGGTGG - Intronic
928606292 2:32947383-32947405 CGGCGCACGGCCGGCTGCGGAGG + Exonic
929593256 2:43160405-43160427 CAGGGAGGGGCCGGGAGCGGTGG - Intergenic
929701083 2:44163453-44163475 CTGTGCTCGGCCGGGCGCGGTGG - Intergenic
929783320 2:44971812-44971834 CAGCTCTCGGCCGGGCGTGGTGG + Intergenic
930046245 2:47175822-47175844 CAGGGAGCGGCCGGTGGGGGCGG - Intronic
930358228 2:50346894-50346916 CTGGGCTCGCCCGGGGGCGGCGG - Intronic
930534510 2:52629903-52629925 CAGCGCCCGGCCTGGCCCGGCGG + Intergenic
931357282 2:61548370-61548392 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
931382343 2:61765174-61765196 CAGAGGGGGGCCGGGCGCGGTGG - Intergenic
931590469 2:63877704-63877726 CTGCATGCGGCCGGGCGCGGTGG + Intronic
932112547 2:69013772-69013794 GACCGCGCGGCAGGCGGCGGCGG + Intronic
932496666 2:72148989-72149011 GAGCGCGCGGGTTGGGGCGGGGG - Intergenic
932567232 2:72917713-72917735 CAGCGTACGGCCAGGCGCGGCGG - Exonic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
933637138 2:84720563-84720585 AAGCACTCGGCCGGGCGCGGTGG - Intronic
933684710 2:85133691-85133713 CAGCTCGGCGGCGGGGGCGGCGG + Exonic
933728169 2:85437959-85437981 AAGCGGGAGGCTGGGGGCGGGGG + Intergenic
933791827 2:85889098-85889120 GGCCGCGCGCCCGGGGGCGGGGG - Intergenic
934988616 2:98904961-98904983 CTGGGCCCGGCCGGGCGCGGTGG + Intronic
935112288 2:100104733-100104755 GGGCGCAGGGCCGGGGGCGGGGG - Intronic
935149115 2:100417686-100417708 ACGCGCACGGCCGGGGACGGCGG - Intergenic
935166466 2:100573384-100573406 CATCTGGCGGCCGGGTGCGGTGG + Intronic
935301618 2:101697936-101697958 CCTCGCGGGGCCGCGGGCGGCGG - Intronic
935593761 2:104863963-104863985 CTGCGCGCCGCACGGGGCGGTGG + Intergenic
935692682 2:105745082-105745104 CGGCGCGGGTCCCGGGGCGGTGG - Exonic
936122695 2:109760427-109760449 CGGCGCAGGGCCGGGGGCGGCGG + Intergenic
936221998 2:110611046-110611068 CGGCGCAGGGCCGGGGGCGGTGG - Intergenic
936234607 2:110732478-110732500 CAGGGCGGGGCCGGGGAGGGAGG + Intergenic
936365951 2:111855946-111855968 CAGCTAGCGGCTGGGCGCGGTGG + Intronic
936456337 2:112677338-112677360 CAGAGCTAGGCCGGGTGCGGTGG + Intergenic
936629718 2:114189094-114189116 CAGGGATCGGCCGGGTGCGGTGG - Intergenic
937414528 2:121703739-121703761 AAGCGTTCGGCCGGGCGCGGTGG + Intergenic
937426865 2:121807111-121807133 CAACACGCGGCCGGGCGCGGTGG - Intergenic
938073094 2:128318633-128318655 CGGAGCGCGGGCGGCGGCGGAGG - Intergenic
938451528 2:131425265-131425287 CTGAGCGAGGCCGGGCGCGGCGG - Intergenic
938496729 2:131801759-131801781 CGGCGCGCTCCCGGGGGCAGAGG - Intergenic
938835215 2:135095333-135095355 CTGCCTGCGGCCGGGCGCGGTGG - Intronic
940258997 2:151761075-151761097 TAGAGTGCGGCCGGGCGCGGTGG - Intergenic
940316703 2:152335099-152335121 CGGAGCCGGGCCGGGGGCGGGGG + Intergenic
940670058 2:156656647-156656669 CAGCACAGGGCCGGGTGCGGTGG + Intergenic
940893958 2:159062678-159062700 CAAAGCTCGGCCGGGCGCGGTGG + Intronic
942046521 2:172102306-172102328 CAGCACCCGGCGGGCGGCGGCGG - Exonic
942151065 2:173076157-173076179 CAGGGCCCGCCCGGCGGCGGCGG + Intronic
942457416 2:176147782-176147804 CAGAGCGAGGCCGGGGGTGGAGG - Intergenic
942471901 2:176269385-176269407 CGGCGCGGGGGCGGGGCCGGCGG + Intronic
943669862 2:190649081-190649103 CGGCGCGCGGGCGGCGGCGGCGG - Intronic
943759552 2:191593200-191593222 CAGGGGGTGGCCGGGCGCGGTGG + Intergenic
943781758 2:191831584-191831606 CAGCATGCGGCCAGGGGTGGGGG - Intergenic
944154097 2:196593073-196593095 CAGCCCGCTGCGGAGGGCGGCGG - Intronic
944422848 2:199549301-199549323 CATTGCCCGGCCGGGTGCGGTGG - Intergenic
944495904 2:200306964-200306986 CAGGGCGCGGGCGGACGCGGAGG + Intronic
944878795 2:203990186-203990208 CAGAGAGTGGCCGGGCGCGGTGG + Intergenic
944942369 2:204642824-204642846 CACCTCTCGGCCGGGCGCGGTGG + Intronic
945663050 2:212709955-212709977 CAAGGCCCGGCCGGGCGCGGTGG + Intergenic
945891603 2:215436203-215436225 CGGCGCGCGGTCGGCTGCGGCGG - Intergenic
946139889 2:217681428-217681450 CAGCACCAGGCCGGGCGCGGTGG + Intronic
946219960 2:218217547-218217569 GAGCGCGCGCCCGGGGCCGGGGG + Intronic
946329653 2:219002104-219002126 CAGAGCCCGGGCGGGGGAGGGGG - Intergenic
946373255 2:219293465-219293487 CAGTTCGGGGCCGGGCGCGGTGG - Intronic
946920585 2:224577279-224577301 CAGCTAGAGGCCGGGCGCGGTGG + Intronic
947864676 2:233388080-233388102 CAGCACGCTGCCGGGGGCATGGG - Intronic
947992324 2:234497232-234497254 CGGGGGGCGGCGGGGGGCGGCGG - Intergenic
948046866 2:234951957-234951979 CTGGGCGGGGGCGGGGGCGGGGG - Intronic
948046871 2:234951963-234951985 CCGCGCCTGGGCGGGGGCGGGGG - Intronic
948122702 2:235543104-235543126 CAACGAGGGGCAGGGGGCGGGGG - Intronic
948209229 2:236179769-236179791 CAGCGCCCGGCCGGGACGGGAGG - Intergenic
948322431 2:237081441-237081463 CAGATCTCGGCCGGGCGCGGTGG - Intergenic
948645269 2:239400552-239400574 CCGCGCGCGGCCGTGGGAGGCGG - Exonic
948805703 2:240452793-240452815 GCGCGCACGGCCGAGGGCGGTGG - Intronic
948912804 2:241013119-241013141 CTGCTCGTGGCCGGGCGCGGTGG - Intronic
948919150 2:241053205-241053227 CGGCACGCGGCTGGGCGCGGTGG + Exonic
1168777857 20:462586-462608 CTACGCCCGGCCGGCGGCGGGGG + Intergenic
1168795885 20:610047-610069 CGGCGGGCGGGCGGCGGCGGCGG - Exonic
1168802662 20:653248-653270 TTCCGCGCGGCCGGGGGGGGGGG + Exonic
1169121267 20:3097425-3097447 TAGCTGGTGGCCGGGGGCGGTGG - Intergenic
1169625541 20:7564121-7564143 AAGCAAGCGGCCGGGCGCGGTGG - Intergenic
1170756814 20:19212505-19212527 CCGCGCTCGGCCTGGGGCGGCGG - Intergenic
1170943658 20:20870076-20870098 CACCTCCCGGCCGGGCGCGGTGG - Intergenic
1170999103 20:21396155-21396177 CGGCGCGGGGACGGCGGCGGAGG + Exonic
1171452865 20:25248159-25248181 CATCGCGCCGGCGGAGGCGGAGG - Exonic
1171473643 20:25390914-25390936 CGGGGCGGGGCCGGGGGAGGGGG - Exonic
1171767873 20:29300259-29300281 CAGCGCGGGGCGGTGGGAGGGGG + Intergenic
1171977596 20:31605422-31605444 CAGCGCGCAGCTGGGGCCCGCGG - Exonic
1172118636 20:32585217-32585239 CCGCGGGCGGCCGGGGGAGGCGG + Intronic
1172344270 20:34184833-34184855 TAGTGCTCGGCCGGGCGCGGTGG + Intergenic
1172354338 20:34269171-34269193 CTGCTCGCGGCCGGGAGTGGGGG - Exonic
1172474499 20:35226793-35226815 CAGCGCGGGGCCTGGCCCGGCGG - Exonic
1172474527 20:35226882-35226904 CGCCGCGCGGGCGGCGGCGGCGG + Exonic
1172840958 20:37902732-37902754 CAGGGCGGGGCCGGGGTCAGGGG - Intergenic
1172896199 20:38301884-38301906 CAGCTGACGGCCGGGGGTGGTGG - Intronic
1173704702 20:45101129-45101151 CCGCTGGCGGCCGGAGGCGGCGG + Intergenic
1173736438 20:45364756-45364778 CTGTGCTCGGCCGGGCGCGGTGG - Intronic
1174003321 20:47390628-47390650 CAGGAGGCGGCCGGGCGCGGTGG - Intergenic
1174072470 20:47908775-47908797 CAGAGCCAGACCGGGGGCGGGGG - Intergenic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1174308909 20:49635231-49635253 CATGGCGGGGCGGGGGGCGGGGG - Exonic
1174469028 20:50741831-50741853 CAGAGTGCGGCCGGGCGCGGTGG - Intronic
1174505177 20:51013014-51013036 CAGCCCTCGACCGGGTGCGGTGG + Intronic
1174736900 20:52973240-52973262 CAGCGCGCGGCTCGGGGCTGGGG + Exonic
1175079442 20:56406824-56406846 CAGAGAGCGGCCGGGCACGGTGG - Intergenic
1175199148 20:57266261-57266283 CAGAGCGCGGCCGGCCGGGGAGG - Exonic
1175429600 20:58891944-58891966 GAGCGCGCGCCCGGGGCGGGGGG - Intronic
1175847285 20:62065510-62065532 TAGAGCGCGGCCGGGGGGCGGGG - Exonic
1175847420 20:62065932-62065954 GGGCGCGCGGCCGGGGGGCGGGG + Intergenic
1175859575 20:62143170-62143192 CTGCGCGGGGCCGGGGACGCGGG - Intronic
1175864412 20:62167328-62167350 CTGAGCTCGGCCGGGCGCGGTGG - Intronic
1175992145 20:62794883-62794905 CTGGGCCCGGCCGGGCGCGGTGG + Intergenic
1175997150 20:62817006-62817028 CGGCGCGCGGGCGGGCGGGGCGG - Intronic
1176164773 20:63667124-63667146 CAGAGCTGGGCCGGGCGCGGTGG - Intronic
1176194533 20:63831161-63831183 CAGCGCCCTCCCGGCGGCGGCGG - Intronic
1176221086 20:63969682-63969704 TCGGGCGCGGCGGGGGGCGGGGG + Intronic
1176242134 20:64080042-64080064 GAGCGCGGGGCGGGGCGCGGCGG - Intergenic
1176247160 20:64102718-64102740 CACCGCGGGGTGGGGGGCGGAGG - Intergenic
1176285427 21:5016688-5016710 CAGCCCCCGGCCGGGGGAGGCGG + Intergenic
1176375761 21:6086234-6086256 CAGCGTGCGGAAGGGGCCGGTGG + Intergenic
1176951072 21:15047252-15047274 CAGATCTCGGCCGGGCGCGGTGG + Intronic
1177027168 21:15934085-15934107 CAGAGCTCGGCCGGGCGCGGTGG - Intergenic
1177389037 21:20443029-20443051 CAGGGAGAGGCCGGGCGCGGCGG + Intergenic
1178351140 21:31873668-31873690 GAGCGCGATGCCGGCGGCGGCGG + Exonic
1178493820 21:33070830-33070852 CAGCACGGAGCCGGGCGCGGCGG - Exonic
1178843670 21:36157100-36157122 CGGCGCGCGGCCCGGGCCTGCGG + Intronic
1179213738 21:39349121-39349143 GAGCCCGCGGCCGGGGACGCGGG - Exonic
1179747713 21:43452010-43452032 CAGCGTGCGGAAGGGGCCGGTGG - Intergenic
1179871754 21:44246787-44246809 CAGCCCCCGGCCGGGGGAGGCGG - Intronic
1179994560 21:44967992-44968014 CAGCTCTCAGCAGGGGGCGGGGG - Intronic
1180095935 21:45555315-45555337 CGGGGGGCGGCGGGGGGCGGCGG + Intergenic
1180843536 22:18970115-18970137 CAGGGGGCGGGGGGGGGCGGGGG + Intergenic
1180843635 22:18970431-18970453 CAGGGCGCGGGAGGCGGCGGCGG - Intergenic
1181478947 22:23185376-23185398 CAGAACCCGGCCGGGCGCGGTGG + Intronic
1181598439 22:23934193-23934215 TAGCACTCGGCCGGGCGCGGTGG + Intergenic
1181831670 22:25564957-25564979 CGGGGCGCGGCGGGCGGCGGCGG + Exonic
1181943815 22:26499482-26499504 CAGCGCGAAGCCGGGGGCCTTGG + Exonic
1182278636 22:29205877-29205899 AGGCGGGCGGGCGGGGGCGGGGG - Exonic
1182516090 22:30859925-30859947 CAGAGAGGGGCCGGGGGCGGCGG - Intronic
1182532129 22:30968867-30968889 CGGCGCGCGGGCGGCGGCGGAGG - Intergenic
1182586341 22:31346154-31346176 CGGGGCGCGCACGGGGGCGGTGG + Exonic
1182586369 22:31346229-31346251 GAGCGGGCGGGCGGCGGCGGCGG + Exonic
1182697184 22:32205498-32205520 CTGCCCGCGGCCGGGGGGCGGGG + Intergenic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183162437 22:36123859-36123881 CAGCGTCTGGCCGGGCGCGGTGG - Intergenic
1183486185 22:38088892-38088914 GAGCGCCCGGGCGGCGGCGGGGG - Exonic
1183546115 22:38455506-38455528 CAGAGCCCGGCCGGCGGGGGCGG - Intergenic
1183601690 22:38843856-38843878 CAGCGTGAGGCGGGCGGCGGGGG + Exonic
1183649444 22:39145652-39145674 GTGCGCGCGGCCGGCGGGGGCGG - Intronic
1183683643 22:39349820-39349842 CAGCGCGCGACCTCGGGCGCGGG - Intergenic
1183702225 22:39457268-39457290 CGGCGAGCGGACGGGCGCGGGGG - Intergenic
1183912924 22:41092360-41092382 CATCGCGCGGCGGCCGGCGGAGG - Exonic
1184023088 22:41833722-41833744 CGACGCGCGGTCGCGGGCGGCGG - Intronic
1184027326 22:41867517-41867539 CAGCAAGCGGCCGGGCGCGGTGG + Intronic
1184101387 22:42343443-42343465 GCGGGCGCGGCGGGGGGCGGGGG - Intronic
1184107483 22:42376667-42376689 CAGAGCCCGGCCAGGGGTGGTGG - Intergenic
1184161140 22:42697961-42697983 CAGGGCATGGCCGGGCGCGGTGG + Intronic
1184186934 22:42871318-42871340 CAGCGGGGGGACGGAGGCGGCGG - Exonic
1184236753 22:43187144-43187166 CGGGGCGGGGCAGGGGGCGGAGG - Intergenic
1184465874 22:44668721-44668743 GAGCCCGGGGCCGGGGGAGGGGG - Intronic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184523501 22:45008817-45008839 CAGCTCGCGGGGCGGGGCGGGGG + Intronic
1185052735 22:48562423-48562445 CTCCGCGGGGCCGGGCGCGGTGG - Intronic
1185259325 22:49853235-49853257 GAGCGCGGGGCCGGGGCTGGCGG - Intergenic
1185291620 22:50030403-50030425 CAGCGCACCGCCGGCGGCGCAGG + Intronic
1185313623 22:50169872-50169894 CGGGGCGCGGCCGGGGCAGGTGG + Intergenic
1185417928 22:50720294-50720316 TAGGGCGCGGGCGGGGGAGGCGG - Intergenic
1185420353 22:50731364-50731386 GAGCCCGCGGCCCGGGGTGGGGG - Intergenic
949414315 3:3799583-3799605 CAGCGAGCGGCCAGGTCCGGAGG - Exonic
949559478 3:5188326-5188348 GGGCGCGCGGCCCCGGGCGGCGG - Intronic
949896005 3:8768115-8768137 CGCCGCGCCGCCGGGGGCCGAGG - Exonic
950012216 3:9731803-9731825 CAGCGCGAGGACAGCGGCGGCGG - Exonic
950388686 3:12679336-12679358 CAGGGCCTGGCCGGGTGCGGTGG - Intergenic
950393853 3:12718574-12718596 CAGCCTGGGGCCGGGCGCGGTGG - Intergenic
950434003 3:12967739-12967761 CAGGGCGGGGGCGGGGCCGGAGG + Intronic
950487826 3:13283163-13283185 CAGCGGGCGGCGGAGCGCGGCGG - Intergenic
950509990 3:13420285-13420307 GCGCGCGCGGGCGGGAGCGGAGG - Exonic
950729785 3:14947604-14947626 CAGCGCGCGGGCGGCGGCGGCGG + Intronic
952240452 3:31526975-31526997 CAGAGGAAGGCCGGGGGCGGTGG - Intergenic
952363197 3:32651577-32651599 CAGCCTGGGGCCGGGCGCGGTGG + Intergenic
952451870 3:33440404-33440426 CGGGGCGGGGCCGGGGGAGGCGG - Intronic
953485001 3:43286689-43286711 CGGAGCGCGGCGGGGCGCGGCGG + Intronic
953587940 3:44222023-44222045 CAGTAAGCGGCCGGGCGCGGTGG - Intergenic
954015282 3:47683963-47683985 CAGTACTCGGCCGGGCGCGGTGG + Intronic
954130431 3:48557822-48557844 CCACGCACGGCCGGGCGCGGTGG - Intronic
954375812 3:50193677-50193699 CAGCGCGGGGCGCGGGGCGCGGG + Intronic
954539766 3:51385525-51385547 GAGGGCGAGGGCGGGGGCGGGGG + Intronic
954539770 3:51385531-51385553 GAGGGCGGGGGCGGGGGCGGGGG + Intronic
954606237 3:51912395-51912417 CAGCACTCGGCCGGGCGCGGTGG + Intergenic
954775402 3:53012687-53012709 GAGCACTCGGCCGGGCGCGGTGG - Intronic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
955775312 3:62426434-62426456 CAACACACGGCCGGGCGCGGTGG - Intronic
956144906 3:66182706-66182728 CAGTGGGCGGCGGGGGGGGGGGG + Intronic
956507835 3:69961417-69961439 CAGCTTGTGGCCGGGTGCGGTGG + Intronic
956681418 3:71785128-71785150 CGGCGGGCGGACGGGCGCGGCGG + Intronic
956813554 3:72888077-72888099 CGGCGGGCGGCCGGCGGCGGCGG - Exonic
958990649 3:100840111-100840133 TAGGGCGGGGACGGGGGCGGGGG + Intronic
959663718 3:108897873-108897895 AAGCTCTCGGCCGGGTGCGGTGG - Intergenic
960047541 3:113212167-113212189 CAGCGCTCGGCCGGGCGCCCGGG + Intronic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
961013416 3:123449855-123449877 CATGGCCAGGCCGGGGGCGGAGG - Intergenic
961202517 3:125055946-125055968 CAGCGGGCAGCGGGCGGCGGGGG + Exonic
961377244 3:126475371-126475393 GGGCGCGCGGCGGGGAGCGGCGG + Exonic
961446306 3:126983265-126983287 CGGGGCGCGCCCCGGGGCGGCGG + Intergenic
962275497 3:134010464-134010486 CAGATCTCGGCCGGGCGCGGTGG + Intronic
962520754 3:136195859-136195881 CGGCGGGCGGGAGGGGGCGGGGG + Intronic
962887906 3:139644914-139644936 CAGCTCGCGGCCGGGAGTGGTGG + Intronic
962891741 3:139678072-139678094 GAGCCAGCGGGCGGGGGCGGGGG - Intergenic
963121249 3:141778593-141778615 CAGCGCGCTGCAGGGGCTGGTGG + Exonic
963335765 3:143972205-143972227 TAGCGCGCGGGCTGGGGCGGAGG - Exonic
963953749 3:151230259-151230281 CAGATCCCGGCCGGGTGCGGTGG - Intronic
966182158 3:177197371-177197393 GCGCACGCGGCCGGCGGCGGGGG + Intronic
966292715 3:178379016-178379038 AGGCACGCGGCCGGGCGCGGTGG + Intergenic
966382964 3:179361823-179361845 GAGAGCTAGGCCGGGGGCGGTGG - Intronic
966594205 3:181711785-181711807 CCCCGCGCGGCCGGCGGCGCGGG + Intergenic
966787759 3:183636135-183636157 CCGGGCGCCGCCGGGGGAGGCGG + Intronic
966852351 3:184171800-184171822 CAGCCTGCGGCGGGGGGAGGGGG + Exonic
966866534 3:184261497-184261519 CCGGGCGGGGGCGGGGGCGGGGG + Intronic
967032220 3:185618589-185618611 CACCACTCGGCCGGGCGCGGTGG + Intronic
967659231 3:192085222-192085244 CAGAGCTTGGCCGGGCGCGGTGG + Intergenic
968138153 3:196234033-196234055 CAGGACACGGCCGGGCGCGGGGG + Intronic
968286039 3:197509449-197509471 GAGTGCGTGGCCGGGCGCGGTGG - Intergenic
968510754 4:994722-994744 CAGGGGGCGGCCGGGTGCAGTGG - Intronic
968514715 4:1011351-1011373 GGGCGCGCGGGCGGGGCCGGGGG + Intronic
968556411 4:1248392-1248414 CAGCGCGCGGCCACGGTCGCCGG + Intronic
968556526 4:1248750-1248772 CCGCGCGTGGCCGCGGTCGGGGG - Intronic
968584585 4:1410249-1410271 CATCGGCCGGACGGGGGCGGGGG + Intergenic
968842153 4:3015396-3015418 CAGTGTGGGGCCGGGCGCGGTGG + Intronic
969138876 4:5051966-5051988 CAGGGCTCGGCCGAGGGTGGTGG - Intronic
969167392 4:5328918-5328940 CAGCTGGTGGCCGGGCGCGGTGG + Intronic
969344785 4:6563796-6563818 CTGCGGGGGGCCGGGCGCGGCGG + Intergenic
969360276 4:6658850-6658872 CAGCCCGCGCGCGGAGGCGGAGG + Intergenic
969520304 4:7674290-7674312 CAACACTCGGCCGGGCGCGGTGG + Intronic
969614651 4:8245205-8245227 CAGCGCCCGGCCTGGGGAGCAGG + Intergenic
971196079 4:24472318-24472340 GAGCGCGCGGCAGGGGGCAAGGG + Intergenic
971457321 4:26857525-26857547 CACCGCGTGGGCGGGCGCGGCGG - Intergenic
972675574 4:41257038-41257060 GAGCGCGAGGCCGAGGGAGGGGG + Intronic
973317633 4:48779320-48779342 CAGCTCGCGGGCGGTGGCCGCGG + Intronic
973531870 4:51843430-51843452 CTGCGGGCGGCGTGGGGCGGGGG + Intronic
973623943 4:52752458-52752480 CAAGGGGCGGCCGGGCGCGGTGG + Intergenic
973907348 4:55545991-55546013 CAGCCCGCGGCCGGCAACGGCGG + Intronic
975113165 4:70649496-70649518 AAGCTGGCGGCCGGGTGCGGTGG - Intronic
975166880 4:71187248-71187270 CGGCGCGCCGCCGGGGTTGGAGG - Intergenic
975715871 4:77205498-77205520 GAGGGGGCGGCTGGGGGCGGGGG - Intronic
976765503 4:88593215-88593237 CTGGGCGGGGCCGGGGGCGAGGG + Intronic
977809920 4:101346886-101346908 CAGCGCGGCGGCGGCGGCGGCGG - Exonic
979560002 4:122090738-122090760 AAGTGCCCGGCCGGGCGCGGTGG - Intergenic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
979894351 4:126139620-126139642 CAGTACTCGGCCGGGAGCGGTGG - Intergenic
980464230 4:133152196-133152218 CAGGGCGGGGGCGGGAGCGGAGG + Exonic
980920740 4:139083683-139083705 CTGCCCGCGTTCGGGGGCGGCGG - Intronic
981504084 4:145481655-145481677 CGCAGCGCGGCCGGGGCCGGAGG - Intronic
981520860 4:145660982-145661004 CAGTTCGGGGCCGGGCGCGGTGG + Intergenic
981953106 4:150435055-150435077 CAGGGAGAGGCCGGGCGCGGTGG + Intronic
982712255 4:158769142-158769164 CAGCGCGCAGCCGGGGGCGGCGG - Exonic
983608872 4:169620455-169620477 CAGCGAGTGGCCGGAGGAGGAGG + Intronic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984002598 4:174268721-174268743 CGGCCCCCGGCCGGGCGCGGTGG - Intronic
984039956 4:174719248-174719270 AAGCACGAGGCCGGGCGCGGTGG - Intronic
984206551 4:176793070-176793092 CAGAGGGGGGCCGGGGGAGGTGG - Intergenic
984587101 4:181577326-181577348 CAGAGAGGGGCCGGGTGCGGTGG - Intergenic
985219932 4:187693402-187693424 CACCTCTCGGCCGGGCGCGGTGG - Intergenic
985432442 4:189894021-189894043 CAGCGCGGGGCGGGGGGGCGGGG + Intergenic
985660709 5:1155514-1155536 GAGCGCGCGGCGGGCGGCAGGGG + Intergenic
985784460 5:1886703-1886725 CGGCGCGGGGCGGGGGGTGGGGG - Intronic
985895625 5:2748794-2748816 CGGGGCGCGGCCTCGGGCGGGGG + Exonic
985896292 5:2751559-2751581 CGGCCCGCGGGCCGGGGCGGCGG + Exonic
986225037 5:5804445-5804467 CAGCGGGCGGCCGGGCACGGTGG + Intergenic
986297112 5:6448794-6448816 CAGGGCGGGGCCGGGCCCGGCGG + Exonic
986311141 5:6551935-6551957 CAGCATGGGGGCGGGGGCGGGGG - Intergenic
986402616 5:7395539-7395561 CAGAGCGCAGCCGGGGTCAGAGG - Intergenic
987308482 5:16660586-16660608 CAGGGCTCGGCCGGGTGCAGTGG + Intergenic
987327272 5:16823760-16823782 CTGCGCCTGGCTGGGGGCGGGGG + Intronic
988494441 5:31733014-31733036 CTGCTCCCGGCCGGGCGCGGTGG - Intronic
988532282 5:32038241-32038263 CAGCTGGAGGCCGGGCGCGGTGG + Intronic
988784284 5:34551638-34551660 CCGGGCGCGGCCGGAAGCGGTGG - Intergenic
989150111 5:38290792-38290814 CAGGGGTCGGCCGGGCGCGGTGG + Intronic
989604225 5:43228431-43228453 CAGGTCTCGGCCGGGTGCGGTGG - Intronic
990247818 5:53881104-53881126 CAGCTCCCGGCCGGGCGCGGTGG + Intergenic
990509959 5:56481127-56481149 GCGCGCGGGGCTGGGGGCGGCGG - Intronic
990523694 5:56604541-56604563 CAGAGAGTGGCCCGGGGCGGGGG - Intronic
992067419 5:73120565-73120587 CACCGCGCGTCCTGGTGCGGAGG - Exonic
992114595 5:73527292-73527314 CATGACGCGGCCGGGCGCGGTGG + Intergenic
992561655 5:77958206-77958228 ATGCGCGCTGCCCGGGGCGGAGG - Intergenic
992769702 5:80035499-80035521 CCCCGCGAGGCCGGGGGCGACGG - Exonic
993503087 5:88683753-88683775 CTGAGCGCTGCCAGGGGCGGGGG - Intergenic
994679374 5:102866131-102866153 CAGCGCGGGGCTGGGGCTGGCGG - Exonic
995443199 5:112214474-112214496 CAGAGGGCAGCCGGGCGCGGCGG + Intronic
995873610 5:116767495-116767517 CTGGGCGTGGCCGGGGGCAGTGG + Intergenic
996329334 5:122312008-122312030 GGGCGCCCGGCCGGGGACGGGGG - Intronic
996862575 5:128083373-128083395 CAGAGCGCGGCGGGGGAGGGAGG + Intergenic
997239182 5:132294362-132294384 CCGCGCCCGGCCGGGGATGGGGG + Intronic
997248281 5:132369932-132369954 CAGAGCGCGGCCTGGGGTCGGGG - Exonic
997470609 5:134115084-134115106 GAGGGCGCGGCCGGCGGCGCAGG + Exonic
997525312 5:134549234-134549256 CAGCCCAGGGCCGGGCGCGGTGG + Intronic
997529129 5:134571409-134571431 CAGCCCTGGGCCGGGCGCGGTGG + Intronic
997548837 5:134734827-134734849 CTGGGCTCGGCCGGGGACGGTGG + Intergenic
997953101 5:138257701-138257723 CAGCGCGCAGTTGGGGGCGATGG + Exonic
997975391 5:138439009-138439031 CAGCGGCGGGCCGTGGGCGGTGG - Exonic
998077294 5:139247019-139247041 AAGAGCTCGGCCGGGCGCGGTGG + Intronic
998101791 5:139440566-139440588 CAGAGAACGGCCGGGCGCGGTGG + Intronic
998366648 5:141636816-141636838 CCGCGGGCGGCGGGCGGCGGAGG - Exonic
998850421 5:146345930-146345952 CTGCGCGCGCCCGGGGACGCGGG - Intergenic
999129411 5:149271689-149271711 GAGCGAGCGGCAGGGCGCGGCGG + Intergenic
999301480 5:150493466-150493488 CAGCACGCGGCCAGGTGCGGTGG - Intronic
999328274 5:150656758-150656780 ATGCGCGGGGGCGGGGGCGGGGG - Intronic
1000328781 5:160191672-160191694 CTGGGCTCGGCCGGGCGCGGTGG + Intronic
1000357987 5:160419159-160419181 CCTGGCGGGGCCGGGGGCGGAGG + Exonic
1001064989 5:168529364-168529386 CGGCGGGCGGCGGGCGGCGGGGG - Exonic
1001640231 5:173238810-173238832 CAGCGCGGAGGCGGAGGCGGAGG - Intergenic
1001734906 5:173989603-173989625 CAGGGCGGGACCGGGCGCGGCGG + Intronic
1001926186 5:175638911-175638933 CTGCTAACGGCCGGGGGCGGTGG - Intergenic
1002006223 5:176237217-176237239 CAGATTGCGGCCGGGTGCGGCGG - Intergenic
1002058005 5:176609827-176609849 GTGCGCGCGGCTGGGGGCGGTGG - Intronic
1002092397 5:176812991-176813013 CAGCGGGCAGCAGGGGGCGCCGG + Intronic
1002201551 5:177531512-177531534 CAGCGGGTGGCTGGGGGTGGGGG + Intronic
1002220152 5:177673420-177673442 CAGACTGCGGCCGGGTGCGGCGG + Intergenic
1002389159 5:178895977-178895999 GAGTGCGGGGCCGGTGGCGGGGG + Intronic
1002462705 5:179383530-179383552 CACAGCCCGGCCGGGCGCGGTGG - Intergenic
1002590995 5:180291754-180291776 AACCGCGCGGCCGGGGGCTTCGG - Intronic
1002709288 5:181184627-181184649 TAGCTCGGGGCCGGGCGCGGTGG + Intergenic
1002926972 6:1610411-1610433 CGGCGGGCGGCGCGGGGCGGCGG + Exonic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1003139084 6:3456522-3456544 CGGCGCGAGGCGGCGGGCGGCGG - Exonic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1003590730 6:7434501-7434523 CAGCGTGAGGCCAGGCGCGGTGG - Intergenic
1003866013 6:10363534-10363556 CAGTTTGCGGCCGGGTGCGGTGG + Intergenic
1004170513 6:13292267-13292289 CAGAGAGCGGCCGGGCGCAGTGG - Intronic
1004396297 6:15248685-15248707 CCGAGCGCCGCGGGGGGCGGAGG - Intronic
1004396308 6:15248712-15248734 CAGAGTGCGGCCGGGAGCGTCGG - Intronic
1004562305 6:16761780-16761802 CTGCGCGCCGCCCGGGGAGGCGG + Intergenic
1004570032 6:16835880-16835902 CAGCTCTGGGCCGGGCGCGGTGG - Intergenic
1004684490 6:17929685-17929707 GAGAGTGCGGCCGGGCGCGGTGG - Intronic
1004690234 6:17987306-17987328 GAGAGCGCGGCCGGGGCCGGGGG - Intronic
1005040442 6:21595577-21595599 GGGCGAGCGGCCGGCGGCGGGGG - Exonic
1005825202 6:29628083-29628105 CGGCGCGCGGCAGCGGGGGGTGG + Intronic
1005943174 6:30576574-30576596 GAGCACCCGGCCGGGCGCGGTGG - Intronic
1006119602 6:31795860-31795882 CAGCGCGGGGCGCGGGGCGCTGG + Exonic
1006304127 6:33208659-33208681 CGGCGCGGGGGCGGGAGCGGGGG + Intronic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1007014369 6:38448803-38448825 CAGCAAGGGGCCGGGTGCGGTGG - Intronic
1007328318 6:41081200-41081222 CAGGGCTCGGCCGGGCGCGGTGG + Intronic
1007367789 6:41406968-41406990 CAGAGCGCGGCGCGGCGCGGCGG + Intergenic
1007390184 6:41546345-41546367 CGGCGCGCGGGCGGGGCGGGAGG - Intergenic
1007396225 6:41579237-41579259 CAGGGCGTGGCCTGGGGTGGAGG + Intronic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007521392 6:42453367-42453389 CGCGGCGCGGGCGGGGGCGGAGG + Intergenic
1007676421 6:43599274-43599296 CAGCACGTGGCCGGGCGCGGTGG - Intronic
1007755381 6:44096044-44096066 CAGGGCGGGGCCTGGGGCTGGGG - Intergenic
1007784198 6:44270770-44270792 GAGAGCGCCGCCGGCGGCGGCGG + Exonic
1007785012 6:44274829-44274851 AAATGCGCGGCCGGGGGCGGTGG + Intronic
1007799689 6:44381565-44381587 CAGAGCTCGGCCGGGCGCAGTGG - Intergenic
1007902061 6:45422088-45422110 CAGCGCGCGGCGCGGCGCGGCGG + Intronic
1007902268 6:45422975-45422997 CCGCTCCCGGCCGGGGGCGGGGG - Intronic
1007902273 6:45422978-45423000 CCGCCCCCGGCCGGGAGCGGCGG + Intronic
1008013256 6:46491026-46491048 CAGGGCGGGGGCGGGGGCGGGGG - Intronic
1008149294 6:47931070-47931092 CAATGCTCGGCCGGGTGCGGTGG - Intronic
1008843509 6:55934380-55934402 CAGACCGGGGCCGGGAGCGGTGG + Intergenic
1008932440 6:56954866-56954888 CTGCGCACGGACGGGGGCGGGGG - Intergenic
1010187153 6:73157423-73157445 CCGCCCGGGGGCGGGGGCGGTGG + Intronic
1010244795 6:73653511-73653533 CCGGGCGGGGGCGGGGGCGGGGG - Intronic
1011416250 6:87122764-87122786 CAGCGCGGCGGCGGCGGCGGCGG + Intergenic
1011488370 6:87866677-87866699 CTGCGGTCGGCCGGGCGCGGTGG - Intergenic
1012450664 6:99349854-99349876 CCGCGCGCGGGCAAGGGCGGCGG + Intronic
1013369315 6:109455783-109455805 GAGGGCGGGGGCGGGGGCGGGGG + Exonic
1014035829 6:116765652-116765674 CAGCGCGCGGCAGGCCGGGGCGG - Exonic
1014736322 6:125099513-125099535 GAGGGCGGGGGCGGGGGCGGGGG + Intergenic
1014801012 6:125778000-125778022 CAGAGAGGGGCCGGGCGCGGTGG - Intergenic
1015523572 6:134154645-134154667 CAGCTAGTGGCCGGGTGCGGTGG - Intergenic
1015626029 6:135181550-135181572 GGGCGGGCGGCCGAGGGCGGGGG + Intronic
1016049561 6:139516375-139516397 CTGCTCCCGGCCGGGCGCGGTGG - Intergenic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1017157099 6:151332321-151332343 CAGGGCTGGGCCGGGCGCGGTGG - Intronic
1017422598 6:154288374-154288396 CTGTGGGCGGCCGGGCGCGGTGG + Intronic
1017738158 6:157381736-157381758 CAGCCCGCGTCCCGGGGCGCGGG - Exonic
1017877565 6:158536968-158536990 CCGCGCCCGGCCGGCGGAGGCGG - Intronic
1017920673 6:158869657-158869679 CCGCGCGGATCCGGGGGCGGCGG - Intergenic
1018196363 6:161359079-161359101 CAGAAGGCGGCCGGGCGCGGTGG - Intronic
1018283806 6:162216241-162216263 CAGTTTGCGGCCGGGCGCGGTGG + Intronic
1018612809 6:165661301-165661323 CAGGACGCGGCCCGGGGTGGGGG + Intronic
1018706487 6:166467447-166467469 CAGAGCAAGGCCGGGGGCTGGGG + Intronic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1018937042 6:168280198-168280220 CAGGGCTGGGCCGGGGGCTGAGG - Intergenic
1019179033 6:170175808-170175830 CAGGGCAGGGGCGGGGGCGGGGG - Intergenic
1019297044 7:283086-283108 CAGTGAGGGGCCGGGCGCGGTGG + Intergenic
1019349576 7:548065-548087 CAGAACTCGGCCGGGCGCGGCGG - Intergenic
1019662722 7:2233677-2233699 CATCTGGCGGCCGGGCGCGGTGG + Intergenic
1019690737 7:2410067-2410089 AAGCGCTCGGCCGGGCGTGGCGG - Intronic
1020132743 7:5568753-5568775 CTGAGAGCGGCCGGGCGCGGTGG + Intergenic
1020274314 7:6615538-6615560 CGGCGGGCGGGCAGGGGCGGGGG + Intergenic
1020274373 7:6615701-6615723 CCGCGCGGGGGCCGGGGCGGGGG - Exonic
1020926468 7:14333169-14333191 CAGTGAGAGGCCGGGGGCAGTGG + Intronic
1021450419 7:20778664-20778686 CAGCCCCAGGCCGGGCGCGGTGG + Intergenic
1021678523 7:23105878-23105900 GAACGCGCGGCAGGCGGCGGTGG - Exonic
1021969357 7:25951367-25951389 CCGCGCGGGGCTGGGGGCGGGGG + Intergenic
1022091436 7:27110342-27110364 GGGGGCGCGGCCTGGGGCGGCGG + Exonic
1022106338 7:27200139-27200161 GAGCGCGCGGCGCGGGGCCGGGG + Intergenic
1022207971 7:28180819-28180841 GAGGGCGGGGGCGGGGGCGGGGG + Intergenic
1022973493 7:35537307-35537329 CAGGGCGGGGCGGGGGGCGGGGG + Intergenic
1023352201 7:39331796-39331818 CACAGCGAGGCCGGGCGCGGTGG - Intronic
1023395012 7:39744392-39744414 CAACAGGCGGCCGGGCGCGGTGG - Intergenic
1023955703 7:44885269-44885291 CAGCCCGCGTCCCGCGGCGGCGG - Exonic
1024236740 7:47404597-47404619 CTGTGCCCGGCCGGGCGCGGTGG + Intronic
1025069775 7:55887828-55887850 CGGCGGGCGGCGGGCGGCGGCGG + Intronic
1025069784 7:55887851-55887873 CGGCGGGCGGCGGGCGGCGGCGG + Intronic
1025097291 7:56106278-56106300 CAGAGGGAGGCCGCGGGCGGGGG - Intronic
1026522758 7:71131551-71131573 CAGCCTGCGGGCGGCGGCGGCGG + Intergenic
1027129572 7:75581489-75581511 CAGCGACAGGTCGGGGGCGGTGG + Intronic
1027190038 7:75991226-75991248 CAGTAGGCGGGCGGGGGCGGTGG - Intronic
1027796090 7:82695601-82695623 CATCACGGGGCCGGGCGCGGTGG - Intergenic
1028929066 7:96392684-96392706 CAGGGTGGGGCCAGGGGCGGGGG - Intergenic
1029250818 7:99234884-99234906 CAGTGCCTGGCCGGGCGCGGTGG - Intergenic
1029385644 7:100241731-100241753 CAGTGAGCGGCCGGGCGCGGTGG + Intronic
1029386083 7:100244614-100244636 CACCAGGCGGCCGGGCGCGGTGG + Intronic
1029461208 7:100694579-100694601 CGTCGCGGGGCCGGGGGAGGTGG - Intergenic
1030138773 7:106284755-106284777 GAGCGCGCGGCAGGGGGGCGGGG - Intronic
1030176534 7:106660528-106660550 CAGCCCGCGGCCAGGCGCGCCGG - Exonic
1030884418 7:114921214-114921236 CAGCCTTCGGCCGGGAGCGGTGG - Intergenic
1030884780 7:114923079-114923101 CAGCGCGTGGCCGAGGCGGGCGG + Exonic
1031054412 7:116977838-116977860 CACCACTCGGCCGGGCGCGGTGG - Intronic
1031302987 7:120086690-120086712 CAGGGTGGGGGCGGGGGCGGGGG + Intergenic
1031361719 7:120856827-120856849 CAGCGATCTGCAGGGGGCGGGGG + Exonic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1031406901 7:121396483-121396505 CAGCGCCTGGCCGGGGGCGGTGG - Intergenic
1031794046 7:126149069-126149091 CAGCTTGAGGCCGGGCGCGGTGG + Intergenic
1031966581 7:128031749-128031771 TTGCGCGCCGCCGGGGGCTGCGG - Intronic
1031981218 7:128126662-128126684 CTGTGCCCGGCCGGGCGCGGTGG - Intergenic
1032011896 7:128352353-128352375 CAGCGCCAGGCAGGGGGCGCCGG + Exonic
1032027449 7:128454992-128455014 CATCTAGCGGCCGGGCGCGGTGG + Intergenic
1032188427 7:129747986-129748008 CAGTCCTCGGCCGGGCGCGGTGG + Intronic
1032274396 7:130441279-130441301 CTGCGCAAAGCCGGGGGCGGGGG + Intronic
1032359893 7:131245515-131245537 GAGGCCGAGGCCGGGGGCGGGGG - Intronic
1033219495 7:139518930-139518952 CCGCGCCCGGCCTAGGGCGGGGG + Intergenic
1033220499 7:139523967-139523989 GGGCGCGCGGCGAGGGGCGGCGG - Exonic
1033253251 7:139777961-139777983 CAGCGCGCGGCCAGGGCCGGCGG + Intronic
1033299936 7:140176667-140176689 GCGCGGGCGGCCGGCGGCGGCGG + Intronic
1033299971 7:140176819-140176841 CAGTACACGGGCGGGGGCGGCGG + Exonic
1033361337 7:140640720-140640742 AAGCGCGCCGCTGGGGCCGGGGG - Exonic
1033365948 7:140672911-140672933 CAGGGCGCGGGCGCAGGCGGGGG - Intronic
1034169983 7:149055476-149055498 CAGTGGGCGGCCGGGCGCGGTGG + Intergenic
1034268015 7:149790528-149790550 CCGCGCATGGCCGGGGGCGCGGG - Intergenic
1034441212 7:151086852-151086874 CGGCGCGGGGCCCGGGGCCGGGG + Exonic
1034441215 7:151086859-151086881 GGGCCCGGGGCCGGGGGCGGCGG + Exonic
1034446288 7:151115723-151115745 CCGCGCGCGTCCGGGGCTGGCGG + Intronic
1034469850 7:151249220-151249242 CTGCCCGGGGCCGGCGGCGGTGG + Intronic
1034547562 7:151799028-151799050 CACCGCTCGGCAGGGGGCTGGGG - Intronic
1034620289 7:152451666-152451688 TAGCCTGCGGCGGGGGGCGGGGG - Intergenic
1034622123 7:152464211-152464233 CGGCCGGCGGCCGGCGGCGGAGG - Intergenic
1035160919 7:156949598-156949620 CTGCGCGGAGCCGGGTGCGGGGG - Intergenic
1035169566 7:157010040-157010062 CTGGGCGCGGGCGGCGGCGGCGG - Exonic
1035476197 7:159145317-159145339 CGGCGCGGGGCCGGGAGAGGAGG + Intergenic
1036720771 8:11173046-11173068 CAGCTTCCGGCCGGGCGCGGTGG + Intronic
1036738397 8:11339998-11340020 AAGGCCGCGGCCGGGCGCGGTGG + Intergenic
1038205631 8:25462337-25462359 CAGTTAGCGGCCGGGCGCGGTGG + Intronic
1038326029 8:26573379-26573401 CTGGGCGTGGCCGGGCGCGGTGG + Intronic
1038444361 8:27593073-27593095 CTGCGCGGGGCCGGGGGGGCGGG + Intergenic
1039060282 8:33567033-33567055 AAGCCCTCGGCCGGGGGAGGAGG + Exonic
1039064075 8:33594303-33594325 AAGTGTGCGGCCGGGCGCGGTGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039910470 8:41822852-41822874 CAGCACGAGAGCGGGGGCGGTGG + Intronic
1040471246 8:47737587-47737609 CCGGGCGGGGCCGGGCGCGGGGG + Exonic
1041072177 8:54135808-54135830 CTGGGTGCGGCCGGGGGCGGTGG - Intronic
1041167260 8:55102318-55102340 CGGCGGGCGGCGGGCGGCGGCGG + Intergenic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1041906494 8:63038803-63038825 CTGCGGGCGGGCGGGGGCTGCGG + Exonic
1042611663 8:70607784-70607806 CAGCCTGCGGGAGGGGGCGGCGG + Intronic
1042784990 8:72537040-72537062 CAGCGCACCGCCGGGGACGCCGG - Intergenic
1043372615 8:79611917-79611939 AAGCGCGCGGCAGGGAGGGGTGG + Intronic
1044821535 8:96158979-96159001 GAGCTCGGGGCTGGGGGCGGGGG + Intronic
1045300252 8:100904608-100904630 CAGAGAGGGGCCGGGTGCGGTGG - Intergenic
1045571323 8:103371617-103371639 CAGCGCGGAGCTGGAGGCGGAGG - Exonic
1045741045 8:105359659-105359681 CAGAGTGGGGCCGGGCGCGGTGG - Intronic
1046252483 8:111650847-111650869 CAGCAGTCGGCCGGGAGCGGTGG + Intergenic
1047124782 8:121948351-121948373 CATGGCGGGGGCGGGGGCGGGGG - Intergenic
1047203172 8:122782722-122782744 CCGCGCGGGGCGGGGGGCCGAGG + Intronic
1047262377 8:123274418-123274440 CAGCGGCCGTCCGGGGGCGGAGG + Exonic
1047393720 8:124475030-124475052 GGGGCCGCGGCCGGGGGCGGGGG - Exonic
1048233635 8:132668727-132668749 CAGCTCAGGGCCGGGCGCGGTGG - Intronic
1049347480 8:142146575-142146597 CAGCGAGCCCCCGAGGGCGGAGG - Intergenic
1049396457 8:142403235-142403257 CCGCGCGCGTCCGGGACCGGCGG - Intronic
1049442252 8:142614779-142614801 CAGCGCCCGGGAGGGGGCGTGGG - Intergenic
1049621078 8:143598570-143598592 CCGCCCTCGGCCGGGGGCGGCGG - Exonic
1049697226 8:143990259-143990281 CCGCGTGGGGGCGGGGGCGGGGG - Exonic
1049697256 8:143990343-143990365 CAGCTCGCGGCCAGAGGTGGCGG + Intronic
1049765708 8:144354367-144354389 CTGCCCGCAGCCGGGGGTGGCGG + Intronic
1049802162 8:144522872-144522894 GGGCGGGCGGCCGGAGGCGGCGG + Exonic
1049843760 8:144790006-144790028 GACCCCGAGGCCGGGGGCGGGGG - Intronic
1049883077 9:11154-11176 CGGCGCCGGGCTGGGGGCGGGGG + Intergenic
1049945626 9:592329-592351 CAGCGGGAAGCCGGGGGAGGGGG + Intronic
1050230892 9:3525491-3525513 CGGCGCAGGGCCGGGGCCGGCGG + Intronic
1050351025 9:4741305-4741327 AGGCGCTCGGTCGGGGGCGGGGG - Exonic
1050876299 9:10641040-10641062 CAGCGTGGGGTCGGGGGAGGGGG - Intergenic
1052991829 9:34523059-34523081 CAGCGCTCGGGCGGCGGCGGCGG + Intergenic
1053188272 9:36037161-36037183 TGGCGCGGGGCAGGGGGCGGGGG + Intronic
1053526170 9:38832935-38832957 CGGTGCTCGGCCGGGCGCGGCGG + Intergenic
1053732749 9:41074372-41074394 CAGCGGCCGTCCGGCGGCGGGGG - Intergenic
1054198397 9:62057360-62057382 CGGTGCTCGGCCGGGCGCGGCGG + Intergenic
1054639957 9:67531003-67531025 CGGTGCTCGGCCGGGCGCGGCGG - Intergenic
1054662489 9:67711621-67711643 CAGTCCGGGGCCGGGGGCCGGGG - Intergenic
1054695678 9:68357182-68357204 CAGCGGCCGGCCGGCGGCGGGGG + Exonic
1054798679 9:69325560-69325582 CAGCGCGGAGCCCGGGGCCGCGG - Intronic
1055052426 9:71994013-71994035 CAGTTTGCGGCCGGGCGCGGTGG + Intergenic
1055484780 9:76746416-76746438 CAAAGAGCGGCCGGGCGCGGTGG + Intronic
1055611610 9:78030996-78031018 CCGCGGGCGCCGGGGGGCGGGGG + Intronic
1055611756 9:78031517-78031539 CTGAGCGAGGCCGGGCGCGGCGG - Intergenic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1056386249 9:86099480-86099502 GAGCTCGAGGCCGGCGGCGGCGG - Exonic
1056990468 9:91405888-91405910 GAGTCGGCGGCCGGGGGCGGGGG - Intergenic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057290145 9:93801243-93801265 CAGCCAGGGGCTGGGGGCGGTGG + Intergenic
1057592386 9:96383662-96383684 CAGTGCGCAGCCGGGGCTGGCGG - Exonic
1057772808 9:97983289-97983311 CAGGCCGCGGCCGGGGGCGGCGG + Intergenic
1057922058 9:99105387-99105409 TGGCGCGGGGCCGGGGGCGCAGG + Intronic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1058885875 9:109320787-109320809 CAGGGGGCTGCCGGGGGCGCGGG + Exonic
1059237170 9:112770708-112770730 CAGCCCCTGGCCGGGCGCGGTGG + Intronic
1060355124 9:122899375-122899397 AAGCGCAGGGCCGGGCGCGGTGG - Intronic
1060359432 9:122941054-122941076 CGGCGAGCGGCGGGCGGCGGAGG + Exonic
1060410828 9:123399081-123399103 CAGGCCACGGCCGGGCGCGGTGG - Intronic
1060477948 9:123999685-123999707 GCGCGTGCGGCCGGGGGCGGGGG - Intergenic
1060623009 9:125084455-125084477 CAGCAGCCGGCCGGGCGCGGTGG - Intronic
1060952597 9:127613107-127613129 CGCGGCGCGGCCCGGGGCGGGGG - Intronic
1060979725 9:127785431-127785453 GAGCGGGCGGGCGGTGGCGGCGG + Intergenic
1060979809 9:127785668-127785690 CTGCGCGGGGCGGCGGGCGGGGG - Intronic
1060982699 9:127802898-127802920 TAGAGCGCTGCCGGGGGCGCCGG + Exonic
1061028959 9:128068278-128068300 CCGGGCGCGGGCGGGAGCGGGGG - Exonic
1061090990 9:128426089-128426111 GATCTCGCAGCCGGGGGCGGTGG - Intronic
1061311846 9:129768679-129768701 CAGCGCGTGGCTGGGAGCGGTGG + Intergenic
1061465959 9:130779996-130780018 CAGCCCTGGGCCGGGCGCGGTGG + Intronic
1061541002 9:131277728-131277750 GGGGGGGCGGCCGGGGGCGGAGG + Intergenic
1061541052 9:131277963-131277985 CTGCGCTCGGCCGGCGGCGGCGG - Intergenic
1061662289 9:132138203-132138225 CTGCACGAGGCCGGGCGCGGTGG - Intergenic
1061699647 9:132406312-132406334 CAAGCCGCGGCCGGGCGCGGTGG + Intronic
1061737044 9:132668853-132668875 CAAGCCGCGGCCGGGCGCGGTGG - Intronic
1061755911 9:132812553-132812575 CACCTAGCGGCCGGGCGCGGCGG - Intronic
1061928232 9:133818075-133818097 CAGAGGGCGGCCGGGCGCGGCGG + Intronic
1062270803 9:135707483-135707505 CACAGCGTGGCCGGGGGCAGGGG + Intronic
1062346771 9:136118610-136118632 GGGCGCGCGGCTGGGGGCGCTGG + Exonic
1062435639 9:136545583-136545605 AAGCGGGCGGCCCGGGGCGTGGG - Intronic
1062574661 9:137200585-137200607 GGGCGCGGGGCCCGGGGCGGCGG - Exonic
1062596506 9:137302168-137302190 CCGGGCCCGGCCGGGGACGGCGG + Exonic
1062630025 9:137459304-137459326 CAGCGCTCTCCCGGGAGCGGCGG - Exonic
1185469413 X:373712-373734 CAGGGCCGGGCCGGGGCCGGCGG + Intronic
1185691238 X:2156816-2156838 CAGCACAAGGCCGGGTGCGGTGG + Intergenic
1185724822 X:2411254-2411276 AAGGGTGCGGCCGGGTGCGGTGG + Intronic
1185744997 X:2565539-2565561 CACCGAGAGGCCGGGCGCGGTGG + Intergenic
1185750966 X:2609357-2609379 CAGCGCGCGGGCGAAGGCGGCGG - Intergenic
1185778874 X:2829026-2829048 CTGGGCGCGGCGGGGGGCCGGGG + Intronic
1186107994 X:6227030-6227052 AAGCGCGCAGCCGGCGGCGGAGG - Intronic
1187189583 X:17020920-17020942 CAGCAGGCGGCCGGGCGCAGTGG - Intronic
1188811394 X:34657257-34657279 CGGCGCGGGGCCGGCGGCGAAGG - Exonic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1189648259 X:43158070-43158092 CAGAGCGTGGCCTGGGGCTGGGG - Intergenic
1189731832 X:44029111-44029133 CCACGCGGGGCCGGGCGCGGTGG - Intergenic
1189899117 X:45687472-45687494 GAGGGCGAGGCCGGGCGCGGTGG - Intergenic
1190294936 X:49020754-49020776 GAGCTCCCGGCCGGGCGCGGTGG + Intergenic
1190865366 X:54380194-54380216 CAGCAGCCGGCCAGGGGCGGTGG + Intergenic
1191902837 X:66056631-66056653 CAGCAGGCGGGCGGGGGTGGGGG + Intergenic
1192274752 X:69616937-69616959 CAGCCCGCAGCCAGGGGCCGCGG - Intronic
1192422967 X:71050284-71050306 CTGGGCACGGCCGGGCGCGGTGG - Intergenic
1192806186 X:74511466-74511488 CAAATCGCGGCCGGGTGCGGTGG - Intronic
1192816331 X:74596532-74596554 CAGCACGAGGCTGGGTGCGGTGG - Intronic
1193307474 X:79966312-79966334 AAGGGCTCGGCCGGGCGCGGTGG - Intergenic
1193633569 X:83920269-83920291 CAGCATGCGGCTGGGTGCGGTGG - Intergenic
1193732004 X:85113016-85113038 CAGCGCGGGGCTGGTGGTGGTGG + Intergenic
1195085684 X:101411700-101411722 CAGCAATCGGCCGGGTGCGGTGG - Intronic
1195216889 X:102712139-102712161 CAGCGGGCGGCTGGGGGCCCGGG - Intergenic
1195544255 X:106097843-106097865 TAGCACTCGGCCGGGAGCGGTGG + Intergenic
1196442261 X:115728090-115728112 CGGCGCGCGGCCAGCAGCGGCGG + Intergenic
1197109780 X:122758596-122758618 CTGCTGGCGGCCGGGTGCGGTGG + Intergenic
1197195910 X:123700502-123700524 CGGGGCGGGGCTGGGGGCGGCGG + Intronic
1197694960 X:129540509-129540531 CCGCGCAGGGCCGGGGGTGGGGG + Intronic
1198205320 X:134460089-134460111 AGGCGCGCGGGCGGGGCCGGGGG + Intergenic
1198379445 X:136070217-136070239 CATGGCTCGGCCGGGCGCGGTGG + Intergenic
1198424030 X:136497159-136497181 CGGCGCGAGGCCCGGGGAGGCGG - Exonic
1199204889 X:145137164-145137186 CAGCGCTTTGACGGGGGCGGGGG + Intergenic
1199445105 X:147912046-147912068 CAGCGCGGCGGCGGCGGCGGCGG + Exonic
1199772741 X:150984408-150984430 CCGCGCGCGGCCGGCGCGGGCGG - Intronic
1199772775 X:150984533-150984555 ACGCGCGGGGCCGGGGGCGGCGG - Intronic
1200109127 X:153730303-153730325 CAACACGCAGCCGGGCGCGGGGG + Intronic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1200128972 X:153830818-153830840 GAGAGCGCGGCCGGGCGAGGCGG - Intergenic
1200235536 X:154466183-154466205 CAGCCCGCCGCCGGGGCCCGTGG + Exonic
1200244806 X:154517273-154517295 CAGCGTGCGGGCAGGCGCGGAGG - Intergenic
1200292604 X:154886796-154886818 CAGCTCGAGGCAGAGGGCGGCGG - Exonic
1200339448 X:155382536-155382558 CAGCTCGAGGCAGAGGGCGGCGG - Exonic
1200347022 X:155458157-155458179 CAGCTCGAGGCAGAGGGCGGCGG + Exonic
1200402724 X:156028987-156029009 CGGCGCCGGGCTGGGGGCGGGGG - Intergenic
1200541333 Y:4461038-4461060 AAGTGGGCGGCCGGGCGCGGTGG - Intergenic
1201291151 Y:12421478-12421500 CTGGGCGCGGCTGGGGGCCGGGG - Intergenic
1202366382 Y:24168594-24168616 CAGGGCGGGGCCCGGGGCTGGGG - Intergenic
1202504399 Y:25501529-25501551 CAGGGCGGGGCCCGGGGCTGGGG + Intergenic