ID: 906615051

View in Genome Browser
Species Human (GRCh38)
Location 1:47228278-47228300
Sequence TCACAAACACTGATGGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906615045_906615051 -3 Left 906615045 1:47228258-47228280 CCATGCCCCAAAGAAGCCACTCA 0: 1
1: 0
2: 3
3: 24
4: 229
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615048_906615051 -10 Left 906615048 1:47228265-47228287 CCAAAGAAGCCACTCACAAACAC 0: 1
1: 0
2: 2
3: 29
4: 290
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615044_906615051 5 Left 906615044 1:47228250-47228272 CCAGAGGTCCATGCCCCAAAGAA 0: 1
1: 0
2: 1
3: 16
4: 156
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615040_906615051 27 Left 906615040 1:47228228-47228250 CCTGCCGGTTTAGGATTACCAGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615041_906615051 23 Left 906615041 1:47228232-47228254 CCGGTTTAGGATTACCAGCCAGA 0: 1
1: 0
2: 1
3: 3
4: 54
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615046_906615051 -8 Left 906615046 1:47228263-47228285 CCCCAAAGAAGCCACTCACAAAC 0: 1
1: 0
2: 1
3: 32
4: 272
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615043_906615051 9 Left 906615043 1:47228246-47228268 CCAGCCAGAGGTCCATGCCCCAA 0: 1
1: 1
2: 0
3: 10
4: 131
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149
906615047_906615051 -9 Left 906615047 1:47228264-47228286 CCCAAAGAAGCCACTCACAAACA 0: 1
1: 0
2: 2
3: 43
4: 389
Right 906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906615051 Original CRISPR TCACAAACACTGATGGTTGT TGG Intronic
901895699 1:12310140-12310162 ACAGAAACACTGATGGGAGTGGG - Intronic
905475606 1:38225148-38225170 ACACACACACTGGTGGTTCTCGG - Intergenic
906475921 1:46169313-46169335 ACACAAAGAGTGGTGGTTGTGGG + Intronic
906615051 1:47228278-47228300 TCACAAACACTGATGGTTGTTGG + Intronic
908466898 1:64404954-64404976 TCACCAACTCTGTTGTTTGTTGG - Intergenic
915085415 1:153384998-153385020 TCAGAACCACCGATGGCTGTTGG + Intergenic
915656633 1:157366257-157366279 GTACAAACAGTGATAGTTGTGGG + Intergenic
919122812 1:193362096-193362118 CCACAAACACTGATGGGGTTTGG + Intergenic
919410060 1:197231740-197231762 TTGCAAACAGTGATGGTTCTAGG - Intergenic
919417780 1:197332848-197332870 CCACAAACACTGGTGGTCATGGG - Intronic
920748326 1:208650246-208650268 TCACAGACAGTGATGTTGGTAGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922718929 1:227890555-227890577 ACCCAGACACTGATGGCTGTGGG + Intergenic
1062861398 10:813103-813125 AGCCAAACACTGTTGGTTGTGGG - Exonic
1063225435 10:4011149-4011171 TCACAAAGAATGATTGGTGTGGG - Intergenic
1063258292 10:4353479-4353501 TAACAAACACAGATGGATGCTGG - Intergenic
1064986145 10:21211787-21211809 TCACAATCACTGCTGGTTTGAGG - Intergenic
1066180289 10:32955913-32955935 TCACAAACACTTAAAATTGTAGG + Intronic
1066319229 10:34283991-34284013 ACCCAAATATTGATGGTTGTGGG - Intronic
1069064361 10:63926937-63926959 TCACTAACACTGATGCTTAGAGG + Intergenic
1069151485 10:64966219-64966241 ACACCCACACTGAAGGTTGTGGG + Intergenic
1069196020 10:65552419-65552441 TCAGCATCACTGATGGTTGGTGG - Intergenic
1071682466 10:87719837-87719859 TCACAACCACTGATGGGGGGCGG - Intronic
1072412300 10:95214520-95214542 TCACAAACACTTCTGGCTTTGGG + Intronic
1073749840 10:106512764-106512786 TTTCAAACACTGATGGATTTTGG + Intergenic
1074249940 10:111734928-111734950 TCACAAACTATGTTGGTTGCAGG - Intergenic
1080860659 11:36147648-36147670 TCTGAAACACTGATTGTTTTAGG - Intronic
1081726376 11:45332314-45332336 GCACAAACACTCATGGGTGATGG - Intergenic
1082178446 11:49088933-49088955 TCACAAGCACTAAAGGTTTTGGG + Intergenic
1082992119 11:59216162-59216184 TACCAAACACTGATGGGTATTGG + Intergenic
1083973406 11:66097473-66097495 TTCCAAACACACATGGTTGTTGG - Intronic
1088328104 11:108622509-108622531 TCACAAGATCTGATGGTTTTGGG - Intergenic
1096877548 12:54642281-54642303 TGACAAATCCTGATGCTTGTGGG + Intergenic
1098660709 12:73089598-73089620 TCAAAAACAATGAAAGTTGTAGG + Intergenic
1099071649 12:78051890-78051912 TCATAAACATTGCTGGTGGTGGG - Intronic
1101658671 12:106747034-106747056 TCACATTCACTAATGGGTGTAGG + Intronic
1103418020 12:120757706-120757728 GCATAAACACTGATGGCTCTAGG - Intergenic
1104137539 12:125954576-125954598 TCAGAAACAGAGATGGATGTGGG + Intergenic
1104423541 12:128656606-128656628 TCAGAAACTCTGAAGGTTGGTGG - Intronic
1104573678 12:129947143-129947165 CCTGAAACACAGATGGTTGTCGG - Intergenic
1105703429 13:22951143-22951165 ACACCCACACTGAAGGTTGTGGG + Intergenic
1106546937 13:30738862-30738884 TCACAAACCCTTATGATTGCAGG - Intronic
1110544541 13:76741696-76741718 ACCAAAACACTGATGTTTGTTGG - Intergenic
1111005985 13:82249654-82249676 ACACTAACACTGATGTTTGGCGG - Intergenic
1111266127 13:85816433-85816455 TTAAAAACACTATTGGTTGTGGG + Intergenic
1112120320 13:96403171-96403193 TCACAAACAAAGATGTTTGCAGG - Intronic
1117207165 14:53455308-53455330 TCAGAAAGAGTGAGGGTTGTGGG + Intergenic
1118850101 14:69576515-69576537 TCACTCACACTGTTGGTTTTAGG - Intergenic
1124358886 15:29019794-29019816 TCACAAACAGTGATGCTGGTGGG + Intronic
1125811545 15:42546239-42546261 TCAGAAACACTGAGGGTAGGGGG + Intronic
1126327367 15:47494904-47494926 TCACAAACACAGTTAGTTGTTGG + Intronic
1129550159 15:76439770-76439792 TTACAAACACTGATGCATGCTGG - Intronic
1131958526 15:97763813-97763835 TCCCACACACTCTTGGTTGTAGG - Intergenic
1133012518 16:2922312-2922334 TCACAAAGACCAAGGGTTGTAGG - Intronic
1134906231 16:17982121-17982143 TAATAAACATTGATGTTTGTAGG - Intergenic
1140201650 16:72899696-72899718 TCACATACACTGTTGGGTCTCGG + Intronic
1152670755 17:81604358-81604380 TAACATACACTGAAGGTTTTAGG + Intronic
1152748894 17:82053495-82053517 TCAGAAACGCTGATGGTTTCGGG - Intronic
1157320627 18:46631314-46631336 CCACCAAGACTGATGGTGGTGGG - Intronic
1168458276 19:56532750-56532772 TCAGAAACACTGATTATTCTTGG + Intergenic
924965472 2:72762-72784 TTAAAAACATTTATGGTTGTGGG - Intergenic
927249533 2:20985171-20985193 TGAGAATCACTTATGGTTGTTGG + Intergenic
928994196 2:37269347-37269369 TCACACATACAGATGTTTGTCGG - Intronic
930402984 2:50914549-50914571 TCACAACCACTGATGGTCAAAGG - Intronic
939834408 2:147110880-147110902 TCAAAATCATTGATGGATGTTGG - Intergenic
942071902 2:172323784-172323806 TCACAAGCACTGACTGTCGTAGG - Intergenic
945191466 2:207192273-207192295 CAACAAACACTGAGGCTTGTTGG - Intergenic
945500446 2:210566326-210566348 TCTCAAGCACTGAAGATTGTTGG - Intronic
945776145 2:214108858-214108880 TCACAAACAATGAAAATTGTTGG + Intronic
946755133 2:222936894-222936916 TCACAAGATCTGATGGTTTTAGG - Intronic
947462583 2:230316201-230316223 TCACAAACACTGCAGGTGGTGGG + Intergenic
947519330 2:230831803-230831825 TCACAAACAATCATAGTTGATGG - Intergenic
1169544255 20:6634901-6634923 TCACACACAGAGATGGGTGTTGG + Intergenic
1170173995 20:13447133-13447155 TCTCAAACACTGTTTCTTGTGGG - Intronic
1170787287 20:19478593-19478615 TGAGAAACACTGCTGGTTGCTGG - Intronic
1172007020 20:31824620-31824642 CAACAAACACTGATGAGTGTGGG + Intronic
1174260395 20:49290500-49290522 TTACAAACTCACATGGTTGTTGG - Intergenic
1174680434 20:52401384-52401406 TCACAGACACTCATGGTGGCAGG - Intergenic
1175448006 20:59038772-59038794 TCTGAAACACTGATGATTATGGG + Intronic
1175533423 20:59690245-59690267 GCACAAACACAGATGTTTGCTGG + Intronic
1181372228 22:22427684-22427706 ACACAGACACTCATGGTTGATGG - Intergenic
1182733934 22:32517385-32517407 TCACACACACATCTGGTTGTTGG - Intronic
950865986 3:16189415-16189437 TAACAATCACTGATATTTGTAGG - Intronic
951295566 3:20929863-20929885 TCACACATATTGAGGGTTGTTGG + Intergenic
951575181 3:24106372-24106394 TCAAAAACAATTATGGTTGTGGG + Intergenic
951650864 3:24950104-24950126 TCACAAAGACTGATTTTTATGGG + Intergenic
956189787 3:66597561-66597583 TCACAATGACTGATGGGAGTTGG + Intergenic
957061181 3:75482476-75482498 TCCCAACCTCTCATGGTTGTTGG - Intergenic
957132528 3:76240804-76240826 CCATAAACACTGAGGGTTTTGGG + Intronic
958861152 3:99446448-99446470 TCACAAGCTCTGATGGTTATAGG + Intergenic
961244374 3:125438546-125438568 TCAAAAACACTGAGGGATTTTGG + Intergenic
962196024 3:133364436-133364458 TCATATACAGTGATGGTTGGAGG - Intronic
964079532 3:152736029-152736051 TCAAAAACATAGATAGTTGTGGG - Intergenic
964092867 3:152896457-152896479 TCACAATCACTGAGGGCTTTAGG - Intergenic
965937088 3:174127831-174127853 TCACAAACACAAATGTTTATAGG + Intronic
969599755 4:8169331-8169353 TCACAAACACTGATGACTTGGGG - Intergenic
969895159 4:10296842-10296864 TCACGCACACTGCTAGTTGTTGG - Intergenic
971624521 4:28901361-28901383 TCAAAAACACTTATTGTTCTAGG - Intergenic
972000990 4:34032565-34032587 TCACAAGAACTGAAGGTTTTTGG - Intergenic
974868035 4:67603942-67603964 CCACAAACACTGAGGGTCCTGGG - Intronic
975306947 4:72860760-72860782 TCTTAAACATTGGTGGTTGTTGG - Intergenic
975445134 4:74455194-74455216 TTATAAACACTCATGTTTGTGGG - Intergenic
976944123 4:90743519-90743541 TAACAAACATTGATTCTTGTAGG + Intronic
978544996 4:109861468-109861490 TCACCAACACTTAATGTTGTTGG + Intronic
980327186 4:131361954-131361976 TCTCAAACACTGATCTTTCTAGG - Intergenic
980588638 4:134854178-134854200 TCACAAACACTTGTTGTGGTTGG - Intergenic
980984704 4:139684224-139684246 TCACAAGATCTGATGGTTTTAGG - Intronic
983261622 4:165462964-165462986 TCACTAAGACTGCTGGTTCTTGG - Intronic
985640759 5:1062567-1062589 ACAGAAACACAGAAGGTTGTCGG + Intronic
987491491 5:18585128-18585150 TCACAAACACAAATGGTTCTAGG + Intergenic
987573966 5:19702809-19702831 GCACCCACACTGAAGGTTGTTGG + Intronic
988688700 5:33550167-33550189 TGATAAACACTGATGGGTCTGGG + Intronic
989618310 5:43359520-43359542 ACACCCACACTGAAGGTTGTGGG - Intergenic
989620788 5:43382241-43382263 TTACAAACACTGCTGCCTGTGGG + Intronic
992774464 5:80077451-80077473 TCACAAACACAGATGCCTGCAGG + Intronic
994694647 5:103058972-103058994 ACACAACCACTGAAGATTGTGGG - Intergenic
995071336 5:107925412-107925434 TCACAAACAGTGATCGTTGAAGG - Intronic
996927338 5:128843320-128843342 TCAAAAACTAAGATGGTTGTGGG + Intronic
998543228 5:143003108-143003130 TTATTAACACTGATTGTTGTGGG - Intronic
1008386877 6:50902041-50902063 TCAAAACAAATGATGGTTGTGGG + Intergenic
1011949263 6:92943974-92943996 TCAAAGACACAGATGGTAGTTGG + Intergenic
1013471407 6:110469626-110469648 TCACAAACTCTGATGTATGTTGG - Intronic
1014349426 6:120321193-120321215 CCAAAAACCCTGAGGGTTGTAGG + Intergenic
1015910418 6:138163068-138163090 TGACAGACAGTGATGGTTCTTGG - Intronic
1020845723 7:13279766-13279788 ACACAAACACTAAAAGTTGTAGG - Intergenic
1021502494 7:21346214-21346236 TCACAAACTATGAGGGCTGTAGG - Intergenic
1023063348 7:36350978-36351000 TCACAAACTCAGATGCCTGTAGG - Intronic
1023804776 7:43864866-43864888 ACACCCACACTGAAGGTTGTAGG - Intergenic
1027840281 7:83301783-83301805 TCAAAAACAGTGATAGTAGTGGG + Intergenic
1028097143 7:86775217-86775239 TCATAAATAATAATGGTTGTTGG - Intronic
1028779736 7:94722682-94722704 ACACCCACACTGATGGTTGTGGG - Intergenic
1031067648 7:117123118-117123140 TCACAAAGTCTCATGGATGTTGG + Intronic
1031676187 7:124615219-124615241 TGAAAAACACTGATGGTCTTTGG + Intergenic
1031836818 7:126689368-126689390 TCACAATAACTTATTGTTGTTGG - Intronic
1034226783 7:149490696-149490718 TCACAGTCACGGATGGCTGTGGG + Intronic
1037288575 8:17326707-17326729 TTCCAAGCACTTATGGTTGTTGG - Intronic
1040932216 8:52747198-52747220 TCACAAACACTGGCCCTTGTGGG - Intergenic
1043914586 8:85906736-85906758 TTACCAACCCTGATGGTTGTTGG - Intergenic
1044651123 8:94497038-94497060 TCACATACACTTATGGTAGAGGG + Intronic
1045290494 8:100828491-100828513 TCACAACCACAGATGGTTTCAGG - Intergenic
1045395367 8:101755448-101755470 TCATGAACCCTGATGGCTGTTGG - Intronic
1046339060 8:112827637-112827659 TCATAAACACTGAAGTTTCTTGG - Intronic
1051796497 9:20877599-20877621 TCACTATGACTGGTGGTTGTGGG + Intronic
1054992160 9:71340951-71340973 TGACAAAAACTGATGATTTTTGG - Intronic
1055316746 9:75041633-75041655 TCACATACAGTGATGGAGGTGGG - Intergenic
1055504852 9:76937643-76937665 TCAAAAACACTGATGGGGGTCGG + Intergenic
1056415900 9:86376076-86376098 ACACCCACACTGAAGGTTGTGGG + Intergenic
1057009616 9:91589827-91589849 TCACAGACACTGATGGGTGGAGG - Intronic
1186246222 X:7619501-7619523 ACACAAACACAGATGGGGGTGGG + Intergenic
1187260058 X:17677222-17677244 TCACATACAATGATGGTTCCTGG + Intronic
1187337393 X:18393131-18393153 TCACAAGATCTGATGGTTTTAGG - Intergenic
1188257529 X:27980936-27980958 TAACAAACACTGATCATGGTTGG + Exonic
1189227736 X:39427363-39427385 TCACAAACACTGACTCATGTTGG + Intergenic
1190232838 X:48595604-48595626 TCATAATAACTGAAGGTTGTGGG - Intronic
1193499350 X:82255245-82255267 TGTCAAAGATTGATGGTTGTAGG + Intergenic
1194156914 X:90401924-90401946 TCACAATTAGAGATGGTTGTTGG + Intergenic
1196150171 X:112364823-112364845 TCAAAAACATTCATGGTAGTAGG - Intergenic
1199122829 X:144077148-144077170 TCACATACACTGATGATTTCTGG - Intergenic
1200503254 Y:3978898-3978920 TCACAATTAGAGATGGTTGTTGG + Intergenic
1201684142 Y:16682488-16682510 ACACCCACACTGAAGGTTGTGGG - Intergenic
1201857051 Y:18556239-18556261 ACACTCACACTGAGGGTTGTGGG - Intronic
1201876270 Y:18764141-18764163 ACACTCACACTGAGGGTTGTGGG + Intronic