ID: 906616164

View in Genome Browser
Species Human (GRCh38)
Location 1:47234267-47234289
Sequence CTGAGGAAACAGCTGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906616161_906616164 -10 Left 906616161 1:47234254-47234276 CCTTCCAGGTGGGCTGAGGAAAC 0: 1
1: 0
2: 0
3: 14
4: 182
Right 906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG 0: 1
1: 0
2: 1
3: 38
4: 313
906616159_906616164 -4 Left 906616159 1:47234248-47234270 CCAGAACCTTCCAGGTGGGCTGA 0: 1
1: 0
2: 0
3: 32
4: 172
Right 906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG 0: 1
1: 0
2: 1
3: 38
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906616164 Original CRISPR CTGAGGAAACAGCTGGACCA AGG Intergenic
900548504 1:3241873-3241895 CTGAGGCCACAGCAGGCCCAGGG + Intronic
900811370 1:4803797-4803819 CTGAGCAAACAGCTCAAGCATGG - Intergenic
901028220 1:6290473-6290495 CTGAGGGCACAGCAGGGCCATGG - Intronic
901150276 1:7096701-7096723 GTGAGGACACAGCTGAACCTGGG - Intronic
902256946 1:15195710-15195732 CTGAGGGAAGAGCTGGCCCAGGG + Intronic
902568246 1:17329979-17330001 CTTAAGAAACAACTGGATCATGG - Intronic
902626059 1:17677014-17677036 CTGAGGACACAGCACGGCCAGGG - Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
902839111 1:19064294-19064316 CTGAGAAAAAGGCTGGCCCAGGG - Intergenic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
903469108 1:23573032-23573054 CTCAGGCCACAGCTGGGCCAGGG + Intergenic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
904654813 1:32036839-32036861 CTGAGAAATCATCTGGTCCACGG - Intronic
906475885 1:46169013-46169035 CTGTGAAAAAAGCTGAACCAAGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907029546 1:51157529-51157551 GAGAGGAAACAGCTGGCACAGGG + Intergenic
907313422 1:53552727-53552749 AGGAGGATCCAGCTGGACCACGG + Intronic
907321781 1:53607043-53607065 CTGAGGGAAAAGCTGGCCCCTGG - Intronic
907456791 1:54581423-54581445 CAGAGGGAAAAGCTGGCCCAGGG - Intronic
907460641 1:54603564-54603586 ATGAGGACACAGCAGCACCAGGG + Intronic
908648459 1:66305565-66305587 CATAGGAAAAAGGTGGACCAGGG + Intronic
911224181 1:95286668-95286690 ATCAGGAAACAGCGGGCCCAGGG + Intergenic
911585443 1:99684892-99684914 CTGTGGAATCAGGTGGACCTGGG - Intronic
913393891 1:118345082-118345104 ATGAGGAAACAAATGGGCCAAGG + Intergenic
914378876 1:147098481-147098503 CTGAGGCTACCGCTAGACCACGG + Intergenic
914392629 1:147236127-147236149 GTGAGGCTCCAGCTGGACCAGGG + Intronic
914601602 1:149211560-149211582 CTGAGTAAGCACTTGGACCATGG + Intergenic
914786009 1:150831767-150831789 GTGAGGAACCAACTGTACCAAGG + Intronic
915941467 1:160121011-160121033 GTGAGGGAACTGCTGGGCCATGG + Intronic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
917542517 1:175928296-175928318 GCCTGGAAACAGCTGGACCAGGG - Intergenic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
918099894 1:181364258-181364280 CTATGGAAAAAGCTGGACAAAGG - Intergenic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
920336481 1:205248662-205248684 CTGAGGAGCCAGGTGGCCCAAGG - Intronic
920413840 1:205784287-205784309 CTGAGGATGCAGCTGGACTCAGG + Intergenic
920657350 1:207886836-207886858 CTGAGGCAACAGCTCAACCCAGG + Exonic
922574697 1:226654056-226654078 ATCAGAAAACAGCCGGACCAGGG + Intronic
922704463 1:227781729-227781751 CTGAGGCTCCAGCTGGACTAGGG + Intergenic
922799139 1:228356436-228356458 CTGCTGAAACAGTGGGACCACGG - Intronic
923621137 1:235580529-235580551 CTGAGGAGAGAGCTGAACCTAGG - Intronic
924426635 1:243957010-243957032 CTGAAGTAGCAGCTGGATCATGG + Intergenic
1062838215 10:650242-650264 CTCAGGAGACAGCTGGCCCGAGG + Intronic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1064118321 10:12597596-12597618 ATGAGGGAACAACTGGGCCATGG - Intronic
1065362219 10:24899208-24899230 CTGAGGAAATTGCTGGAACCAGG + Intronic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1066348630 10:34615387-34615409 CTGAGGAAACAGTGTAACCATGG + Intronic
1067237093 10:44460177-44460199 CTGACGAACCAGTAGGACCAAGG + Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1073319192 10:102603986-102604008 CTGGGGAAACAGCTGGGCTGTGG + Intronic
1075584405 10:123646737-123646759 ATGAGAAAGCAGCTGGACAAAGG + Intergenic
1076414229 10:130273789-130273811 TTGGGGAAAGAGCTGGGCCAGGG - Intergenic
1077160727 11:1111664-1111686 CTGCGGACCCAGCTGGACAAGGG + Intergenic
1077871774 11:6268966-6268988 CTGAGAAACCAGCTTGAGCAGGG + Intronic
1078006353 11:7535320-7535342 TTGAGGAAACAGCATGACAAAGG + Intronic
1078019010 11:7640038-7640060 CTTAGAAAACAGCTCGCCCAGGG - Intronic
1078452860 11:11453211-11453233 CTGAGGAGACCCCTGGGCCAGGG + Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080774290 11:35371323-35371345 CTGAGGGTCCAGCTGGACCATGG - Intronic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081192260 11:40118622-40118644 CAGAGGGATCAGCTGAACCAAGG + Intronic
1082689019 11:56277471-56277493 CTGAGGCTACCGCTAGACCATGG - Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083851648 11:65371161-65371183 CTCAGGAAACAGCTGAGCCAAGG - Intergenic
1084468976 11:69344105-69344127 CTGAGGCAGCAGCTGGATCTTGG + Intronic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1085884273 11:80504376-80504398 CTGAAGAAACAGCTGATCTATGG - Intergenic
1086028197 11:82320359-82320381 CTGAGGTAAGACCTGGACCAAGG - Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089641793 11:119852714-119852736 CTGATTAAACAGCTAGCCCAAGG - Intergenic
1089730210 11:120514521-120514543 CTGAGGAACAGGCAGGACCAAGG - Intronic
1090621052 11:128561556-128561578 CTGAAGAAAGAGTTGGGCCATGG + Intronic
1090967798 11:131613870-131613892 CTGAGGAAACAGAGGAACCCTGG + Intronic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091599484 12:1909141-1909163 TTGAGGAAACAGTGGGACCTGGG - Intronic
1092058912 12:5532115-5532137 CTGAAGAAACAGCCAGCCCATGG + Intronic
1092238556 12:6824110-6824132 CTGACGACGCAGCTGCACCACGG - Exonic
1093490802 12:19701571-19701593 TTTAGGAAACTGCTGCACCAGGG - Intronic
1094474810 12:30833004-30833026 CTGAGGACAGACCTGGACAAGGG - Intergenic
1096361036 12:50987175-50987197 CTGAGGAAACAGCTGTAGAGAGG + Exonic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1101984905 12:109438342-109438364 CTCAGGCAACAACTGAACCAGGG - Intronic
1102409214 12:112702656-112702678 AAGAGGGAAGAGCTGGACCAAGG + Intronic
1103592888 12:122004749-122004771 CTGAGGAAGAAGCTGGTCTAGGG - Intergenic
1104157738 12:126149722-126149744 CTGGGGTAGCAGCTGGACCTTGG + Intergenic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1106201919 13:27545274-27545296 CTGAGGAGGCTGCTGGAGCAAGG + Intergenic
1106411853 13:29516173-29516195 CTCATGATGCAGCTGGACCAGGG - Exonic
1106715949 13:32387996-32388018 AAGAGAAAACAGCTGGACCCAGG - Intronic
1108523819 13:51268306-51268328 CTGAAGAAATAACAGGACCAAGG + Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1109953049 13:69527624-69527646 CTGTTGAAACAGCTGGACACAGG + Intergenic
1112462241 13:99613392-99613414 GTGAGGAAGCAGCAGGGCCATGG + Intronic
1114165805 14:20217100-20217122 CTGAGGCTACCGCTAGACCACGG + Intergenic
1117341143 14:54792606-54792628 CTGGGGAAGCAGCCTGACCAAGG + Exonic
1118466934 14:66039495-66039517 CAGAGGAAACAACTGGAGCTTGG - Intergenic
1119277589 14:73373165-73373187 CCTAGGAAACAGCTGGGCCTGGG - Intronic
1119300649 14:73569020-73569042 CTGCGGAATGGGCTGGACCAGGG - Intronic
1119739452 14:77004816-77004838 CTGAGCAGACACCTGGACTATGG - Intergenic
1122054272 14:99081993-99082015 CTGAGAAAACTGCGGGACCCAGG + Intergenic
1122280577 14:100619958-100619980 CTGAGGGAAAGGCTGGTCCAGGG + Intergenic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1123429287 15:20201260-20201282 CTGAGGAAATAGCTTGCTCAAGG - Intergenic
1124532999 15:30522703-30522725 CAGAGGAAACTGCTGGGTCAGGG + Intergenic
1124765658 15:32484941-32484963 CAGAGGAAACTGCTGGGTCAGGG - Intergenic
1125183296 15:36902062-36902084 CTGAGGAAATAACTGGGCCTGGG + Intronic
1127920923 15:63493537-63493559 CAGAGGAAACAGCTCGAGCCAGG + Intergenic
1128673333 15:69590978-69591000 CTGAGGAAACATCAGTACCTGGG + Intergenic
1129774918 15:78230258-78230280 CGGAGGAAACAGCCAGGCCAGGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131563141 15:93461758-93461780 TTGAGGAAAGAGATGGGCCAAGG + Intergenic
1132372055 15:101306172-101306194 CTGAGGACACCGCTGCAGCAAGG + Intronic
1132405954 15:101542014-101542036 ACGAGCAAACAGGTGGACCAGGG - Intergenic
1132481343 16:167642-167664 CTGAGGAAAGAGTGGGACCTTGG + Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136855028 16:33648472-33648494 CTGAGGAAATAGCTTGCTCAAGG + Intergenic
1139625719 16:68187172-68187194 GTGAGGCTGCAGCTGGACCAGGG + Intronic
1140509946 16:75499751-75499773 CTGAAGACTCAGCAGGACCATGG - Intergenic
1141215922 16:82023831-82023853 CAGAGGAAACTGCTGGATCAAGG + Intergenic
1141362466 16:83408930-83408952 ATGCAGAAACACCTGGACCAAGG - Intronic
1141623548 16:85249682-85249704 CTGCGGGGACAGCTGGACAACGG - Intergenic
1142172081 16:88628162-88628184 CTCAGGAAGCAGATGGACCCAGG - Intronic
1203116610 16_KI270728v1_random:1496957-1496979 CTGAGGAAATAGCTTGCTCAAGG + Intergenic
1142500034 17:327175-327197 CTAAGGAGTCAGCTGGACCCAGG + Intronic
1142581957 17:948781-948803 ACGAGGAAACAGCAGGGCCAGGG + Intronic
1142597387 17:1036216-1036238 CTGAGCAGCCAGCTAGACCAAGG + Intronic
1144854524 17:18260689-18260711 CGGAGGAGGCAGCGGGACCACGG - Intronic
1146643108 17:34555900-34555922 TGGAGGAAACAGCTGGACAAAGG - Intergenic
1146906382 17:36620964-36620986 CTGAGGCAGCAACTGAACCAAGG - Intergenic
1147584106 17:41643179-41643201 CTGAGGTGACAGTTGGTCCAAGG + Intergenic
1147631994 17:41938241-41938263 CTGAGGACACAGCTTGAACTGGG + Intronic
1147991600 17:44337271-44337293 AAGAGAAAACAGCTGGACCCTGG + Intergenic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149473866 17:56942292-56942314 CTGAGAAAAACTCTGGACCAGGG + Intronic
1149531772 17:57401551-57401573 TTGAGGACACAGCTGTAGCAGGG - Intronic
1149615459 17:57993866-57993888 ACGAGGAAACAGCTGGAGGAGGG - Intronic
1151658153 17:75505160-75505182 GTAGGGAAAGAGCTGGACCAGGG - Intronic
1153344960 18:4015399-4015421 GTGAGGAAGCTGCTGGGCCACGG + Intronic
1154041332 18:10859220-10859242 TGGAGGAAAGAGCTGGTCCAAGG + Intronic
1156569247 18:38233996-38234018 CTGAGGAGACAGCTGCATTATGG - Intergenic
1157733563 18:50025783-50025805 CAGAGGAAAAAGCTGTCCCACGG - Intronic
1159680086 18:71338526-71338548 CTGAGGGAGCAGCTAGACCCTGG - Intergenic
1160811699 19:1015607-1015629 CTGAGGACCCAGCTGGGCCAAGG + Intronic
1160879225 19:1311913-1311935 GAGAGGAAACTGCTGGACCAAGG - Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164261521 19:23572057-23572079 CTGAGGCTACCGCTAGACCACGG - Intronic
1164389115 19:27802455-27802477 CTGAGGCTACCGCTAGACCACGG + Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165454770 19:35904035-35904057 CTGAGGAAACCCCTGAAGCAGGG + Intronic
1166434000 19:42751796-42751818 CTGAGGCTACTGCTAGACCAGGG + Intronic
1166446853 19:42865572-42865594 CTGAGGCTACTGCTAGACCAGGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167206743 19:48107564-48107586 CTGACGCAACCGCTAGACCAAGG - Intronic
1167334604 19:48876831-48876853 CTGAGGCTACCGCTAGACCATGG + Intergenic
1167458183 19:49609660-49609682 CAGAGGAAACAGCTGTGCAAAGG + Intronic
1167920710 19:52781010-52781032 CTGAGGAGACAACTGGACACAGG + Intronic
1167922580 19:52794075-52794097 CTGAGGAGACAACTGGACACAGG + Intronic
1167970202 19:53184509-53184531 TTGAGGAGACAACTGGACAAAGG + Intronic
925273822 2:2635136-2635158 CAGAGGACACAGCTGAACCATGG - Intergenic
925273827 2:2635170-2635192 TGGAGGACACAGCTGAACCATGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
926981623 2:18578152-18578174 CTGAGGATCCATCTGGTCCAGGG - Intronic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927827134 2:26316761-26316783 GTGAGGAAGGAGCTGGGCCACGG + Intronic
932454648 2:71841452-71841474 ATGAGGGAACACCTGGACTATGG - Intergenic
934044422 2:88160784-88160806 CTGAAGAAACAGCTCGCCTAAGG + Intergenic
939385028 2:141485246-141485268 CTCATGAGACAGCTGGATCATGG + Intronic
939809906 2:146818588-146818610 CTGAGGCAGAAGCTGTACCAGGG - Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
942235296 2:173898192-173898214 AGAAGGAAACAGCTGGGCCATGG + Intergenic
944465727 2:199997708-199997730 CTGAGGAATCTGCAGGACCAAGG + Intronic
945781448 2:214178453-214178475 CTGAGGAAACATCTGGATGTGGG + Intronic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
948755954 2:240159632-240159654 CAGAGGGAACCGCTGGACAAAGG - Intergenic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1169060172 20:2655281-2655303 TTGATGAAGCAGCTGGGCCAGGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1173927477 20:46791718-46791740 CTAAAGAAACATCTGGACTAAGG + Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174842360 20:53912196-53912218 CCGAGGAAAGAGCTGGAACCTGG - Intergenic
1176007405 20:62873900-62873922 CTGAGGCTACCGCTAGACCACGG - Intergenic
1176076643 20:63251480-63251502 CTGAGGCTACCGCTAGACCACGG + Intronic
1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG + Exonic
1176154928 20:63614455-63614477 CTGAGGCTACCGCTAGACCACGG - Intronic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1180154267 21:45970618-45970640 GTGAGGGAGCAGCTGGAACAGGG - Intergenic
1180992811 22:19947852-19947874 CTGACGCAACTGCTAGACCAAGG + Intronic
1181409785 22:22710841-22710863 CTGAAGCAACACCTGGACCCAGG + Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1183077752 22:35437460-35437482 CTGAGGAAACAGCTGAGAGATGG + Intergenic
1183724568 22:39581259-39581281 CTGAGGAAGCAGCCTGATCAAGG + Intronic
1185170858 22:49293204-49293226 TGGAGGAAACAGCTGGATCAAGG + Intergenic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949706343 3:6822079-6822101 CTGAGGCCACATCTGCACCAGGG - Intronic
950722045 3:14890393-14890415 CGGAGGAAACAGTGGGAGCATGG - Intronic
952436277 3:33275715-33275737 GTGAGGAAACAGCGGAATCAGGG + Intergenic
952912727 3:38204332-38204354 CTTAGTTACCAGCTGGACCACGG - Intronic
953294126 3:41696040-41696062 CTGAGGCTACTGCTAGACCACGG - Intronic
953478469 3:43227106-43227128 TTGATGAAAGAGCTGGACTAGGG + Intergenic
953573126 3:44088679-44088701 CTAGGAAAACATCTGGACCAGGG + Intergenic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
955789331 3:62572244-62572266 ATGAGGAAACAGAAGGACCCAGG - Intronic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957409493 3:79819642-79819664 CAGAGGACAAAGCTGGACCTTGG + Intergenic
957627056 3:82666716-82666738 ATGAGGAAACAGCTGGTCAGTGG + Intergenic
958192730 3:90204212-90204234 CTGAGGAAGCTGCAGGACCAGGG - Intergenic
958416148 3:93876142-93876164 CTGAGGAAGCTGCAGGACCAGGG - Intronic
960944111 3:122954315-122954337 CTCAGGAAAGGGCTGGAACAGGG - Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
963306197 3:143656007-143656029 ATGAGAAAACTGCTGGAGCAAGG + Intronic
968262943 3:197339830-197339852 CTGGGAAAACAGCAGGACCTAGG - Intergenic
968404750 4:330198-330220 CTGATGCTACAGCTAGACCATGG + Intergenic
968559160 4:1268065-1268087 CTGATGCTACAGCTAGACCATGG + Intergenic
968889101 4:3358065-3358087 CTGAGGAATTAACTGAACCAAGG - Intronic
969461500 4:7331491-7331513 CTGAGGCATCAGCTCTACCAGGG - Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
970393769 4:15644196-15644218 CTGAGGAAACATCAAGGCCAAGG - Intronic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
973330367 4:48906237-48906259 CTGAGGAAACAGAGGGTCCCCGG - Intronic
975582039 4:75915663-75915685 GTAAGGAATCTGCTGGACCAAGG - Intronic
976530946 4:86151232-86151254 CTGAGAAAACAGATGGACTCAGG - Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
982228338 4:153185969-153185991 CTGAGGAAATTGCTAGACCAGGG + Intronic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982763430 4:159316043-159316065 CTGAGGCTACCGCTAGACCATGG + Intronic
983905817 4:173181714-173181736 CTAAGCAAACAGCAGGACCTGGG - Intronic
984328517 4:178285109-178285131 ATGAAGAAACATTTGGACCACGG + Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
986720807 5:10560268-10560290 CTGAGGAAATACCTGGACAAGGG + Intergenic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
987544473 5:19295138-19295160 ATGAGGAAACAGCTGGTACATGG - Intergenic
988451126 5:31344093-31344115 CTGAGGAAACAGTCGGAATATGG - Intergenic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
995060426 5:107807146-107807168 CAGAGGAAACAGCTAGAACAAGG + Intergenic
996203691 5:120703991-120704013 CTGATGATACAGCTGGACTTAGG + Intergenic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
998186463 5:139983368-139983390 CTCAGGACACAGCTGGCCCAAGG + Intronic
998427240 5:142039319-142039341 CTGGGGAAACAGCAGTGCCAAGG - Intergenic
999227907 5:150042514-150042536 CAGAGGGAACAGCTCGAACAGGG + Intronic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999690660 5:154143400-154143422 GTGAGAACAGAGCTGGACCATGG + Intronic
1001480562 5:172086464-172086486 CTGAGAGCACAGGTGGACCAGGG - Intronic
1001969972 5:175947651-175947673 CTGAGGGAACAACAGGAGCAGGG - Intronic
1002247465 5:177896113-177896135 CTGAGGGAACAACAGGAGCAGGG + Intergenic
1002322359 5:178383417-178383439 CTGGGGAACAAGCTGGACCAAGG - Intronic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1004427600 6:15516951-15516973 CTGACCAAACACCTGGAACATGG - Intronic
1005689886 6:28293781-28293803 ATGAGGGAACAGCTGGTCAATGG - Intronic
1006295800 6:33169503-33169525 CGGAGGACACAGATGGCCCAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006450800 6:34104710-34104732 GTGGGGAAACACCTGGAACAGGG - Intronic
1006507890 6:34502148-34502170 CTGTGGAAAACGCTGCACCAGGG - Intronic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1008028538 6:46666639-46666661 CTGAGTAAATAGCTGGAACTTGG - Intronic
1008936564 6:56999014-56999036 GAGAGGAAACTGCTGCACCATGG - Intronic
1011471453 6:87711965-87711987 CTGAGAACACACCTGGGCCATGG - Intergenic
1011985545 6:93439584-93439606 ATGAGGAAACAGTTGGGTCAGGG - Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1013624898 6:111927192-111927214 GTAAGGGAACAGCTGGGCCAGGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015845383 6:137515154-137515176 CTGAGGAAACAGCTCTCCCAAGG - Intergenic
1017816773 6:158021959-158021981 CTGAGGAAGGATCTGCACCAGGG + Intronic
1017862690 6:158413706-158413728 CTCAGGAAACAGTTGCACCCAGG + Intronic
1018222355 6:161593644-161593666 CTGAGGAACCGGCTGGACAGTGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018714755 6:166523410-166523432 GTGAGGATGCAGCTGGCCCAGGG + Intronic
1019481344 7:1268296-1268318 CTGAGGAGAGAGCTGTGCCAGGG + Intergenic
1019523326 7:1470117-1470139 CTGCGGGAACTGCTGGCCCAAGG + Intergenic
1019934711 7:4246721-4246743 CTCACCAAGCAGCTGGACCAGGG + Intronic
1022117378 7:27274019-27274041 CTGAGGAGACAGCCTGACCCAGG + Intergenic
1023292871 7:38686319-38686341 CGGAGCAAACTGCAGGACCAGGG - Exonic
1023431318 7:40094343-40094365 CTGAGCAAGCAGCTGTAACAGGG - Exonic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1026045506 7:66903418-66903440 CTGAGGCAACAGCTGGGACTGGG - Intergenic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028583361 7:92429233-92429255 CTGAGGCAACTCCTAGACCAAGG - Intergenic
1029699712 7:102238267-102238289 CTGAGGCTACCGCTAGACCACGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031989107 7:128184627-128184649 CTGAGAAAAATGGTGGACCAGGG + Intergenic
1032029051 7:128467054-128467076 CTGGGGCACCAGCTGCACCAGGG + Intergenic
1032542078 7:132711553-132711575 CGGAGGGAACAGCTGCACCTGGG - Intronic
1033040882 7:137917112-137917134 CTGAGAAAACAGCTGCATCTTGG + Intronic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1033546847 7:142409057-142409079 CAGAGGAGACAACTGGACCAGGG - Intergenic
1033549727 7:142436003-142436025 CAGAGGAGGCAACTGGACCAGGG - Intergenic
1034898815 7:154894898-154894920 CTGAGGCAGCAGCTGCTCCATGG - Intergenic
1036956212 8:13190931-13190953 CTGAGGAAAAATCTGGAAGAGGG + Intronic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038057207 8:23871724-23871746 CTGAGGTAAGAGCAGTACCAGGG - Intergenic
1038898111 8:31810537-31810559 GTGAGGAAACAGCTGTGCAAAGG - Intronic
1040568996 8:48591701-48591723 CTGATGAAGCAGGTGGACCTGGG - Intergenic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1043395595 8:79832675-79832697 CTGAGGAAAGAGCTGGATTTAGG - Intergenic
1046285768 8:112091826-112091848 CTCAGGCAACAGCTGCAGCAAGG + Intergenic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047520325 8:125591065-125591087 CTGAGGGGGAAGCTGGACCAGGG + Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1049415209 8:142491910-142491932 AGGAGGAGACAGCTGGAGCAAGG + Intronic
1050157040 9:2678817-2678839 CCCAGGAAGCAGCTGGAACAGGG + Intergenic
1050451518 9:5786593-5786615 CTGAAGAAACAGCTTGACACAGG + Exonic
1051593081 9:18796216-18796238 CTTAGATACCAGCTGGACCAAGG + Intronic
1051681084 9:19608951-19608973 CAGAGGAACCAGCTGGCTCAGGG - Intronic
1052718698 9:32148786-32148808 CTGAGGCTACCGCTAGACCACGG - Intergenic
1053202883 9:36164705-36164727 TTGAGGAAAAAGCTGGACCGGGG + Intergenic
1054818405 9:69497661-69497683 CTGAAGAAAGAGCAGGTCCATGG - Intronic
1056022162 9:82450321-82450343 ATGAGGAAACAGCTAAAACAGGG + Intergenic
1059443867 9:114326176-114326198 CTGTGGAACCAGCTCAACCAGGG - Intronic
1059445073 9:114332953-114332975 CTGTGGAACCAGCTCAACCAGGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060544381 9:124451673-124451695 CAGAGGAAACAGTAGCACCACGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062094547 9:134696036-134696058 CTGAGGTTTCAGCTGGACCCTGG - Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062717990 9:138020782-138020804 CCCAGGAAACACCTGGAGCAGGG - Intronic
1062731053 9:138109463-138109485 TTGAGGACACAGCAGGACCATGG - Intronic
1185448503 X:270983-271005 TCCAGGAAGCAGCTGGACCAAGG + Intergenic
1186785822 X:12955206-12955228 CAGAGGACCCAGCTGGAGCAGGG + Intergenic
1188728162 X:33610472-33610494 GTGAGGAGAAGGCTGGACCAGGG - Intergenic
1189764522 X:44356806-44356828 CTGAAGAATCACCTGAACCAGGG - Intergenic
1192228975 X:69251385-69251407 TTGAGGAAACAGCATGGCCAAGG - Intergenic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1198139818 X:133791474-133791496 ATCAGGAAACAGCTAGACCCTGG - Intronic
1198998698 X:142606806-142606828 CTGAGGCTACCGCTAGACCACGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic
1202599207 Y:26575264-26575286 CTGAAGAATCAGCTGAACCTGGG + Intergenic